Você está na página 1de 680

Mantenedora

FUNDAÇÃO ESPERANÇA

CONSELHO DIRETOR - 2017/2020


Presidente – Vânia Pereira Maia
Vice-Presidente – Renato Dantas
1º Secretário – Jocivan Pedroso
2º Secretário – Denis Maia
1º Tesoureiro – Sinval Ferreira
2º Tesoureiro – Ivanilson Malheiros

CONSELHO FISCAL – 2017/2020


Presidente: Ivair Chaves
Vice-presidente: José Pinheiro Lopes
Secretário: Antonio Jorge Hamad

ASSEMBLEIA GERAL - 2017/2020


Presidente: Emannuel Silva
Vice-presidente: Geraldo Sirotheau

GERENTE ADMINISTRATIVO
Edney Martins Pimentel

Mantida
INSTITUTO ESPERANÇA DE ENSINO SUPERIOR

Diretor
Juarez de Souza
Coordenador do Núcleo de Apoio Acadêmico e Pedagó-
gico - NAAP
Paulo Marcelo Pedroso Pereira
Coordenador de Pós-graduação, Extensão e Pesquisa
Daniel Berretta Moreira Alves

Comissão Própria de Avaliação - CPA


Alexandre Freitas (Coordenador)
Bibliotecária
Lenil Cunha Pinto

Secretária Acadêmica
Mara Rúbia Almeida

Núcleo de Apoio Acadêmico e Pedagógico - NAAP


Paulo Marcelo Pedroso Pereira
Marinete Costa de Lima
Quézia Fragoso Xabregas

COORDENADORES DE CURSOS

Administração e Logística: Romilda da Silva Uchôa


Ciências Contábeis: José de Jesus Pinheiro Neto
Comunicação Social - Jornalismo: Milton Mauer
Enfermagem: Claudia Nascimento
Estética e Cosmética: Alessandra Couto de Camargo
Farmácia: Ana Camila Sena Souza
Biomedicina: José Olivá Apolinário Segundo
Fisioterapia: Milene Ribeiro Duarte Sena
Gestão Ambiental: Ederly Silva
Odontologia: Verena Maia Miranda
Pedagogia: Marinete Costa de Lima
Psicologia: Thayanne Branches Pereira
Radiologia: Luciano Sales
Redes de Computadores: Angel Pena Galvão
COMISSÃO EDITORIAL
Juarez de Souza
Angel Pena Galvão
Aloísio Costa Barros
Daniel Berretta Moreira Alves
Giovana Andreia Gibbert de Souza

COMISSÃO CIENTIFICA DO I CONGRESSO INTERNACIONAL DE


PESQUISA E CIÊNCIA DO IESPES

Adriana Caroprezo Morini Jorge Carlos Menezes Nascimento Júnior


Adriana Pessoa Cunha José Jesus Pinheiro Neto
Alberto Soares Evangelista José Olivá Apolinário Segundo
Aldo Melo Lucena Juarez de Souza
Alessandra Couto de Camargo Ferreira Juliana Gagno Lima
Aline Aparecidade Muncher Kasper Juliana Machado Portela
Aloisio Costa Barros Katiane Araújo Lourido
Ana Betânia Ferreira Araújo Katilin Azevedo Gomes da Cunha
Ana Camila Garcia Sena Souza Liliane de Oliveira Queiroz
Andrei Silva Freitas Lívia Cristinne da Costa Arrelias
Angel Pena Galvão Lucas Cunha Ximenes
Antônio Junio Amorim dos Santos Luciano Sales
Antonio Junior Amorim Luiz Fernando Gouvêa e Silva
Arimar Chagas de Almeida Maria Ivone Aguiar
Barbara Begot Oliveira Risuenho Mariana dos Anjos Furtado de Sá
Bárbara Begot Oliveira Risuenho Marijara Serique de A Tavares
Bruna Nairara Rocha Garcia Marina Celere Meschede
Carla Marina Costa Paxiuba Maxwell Barbosa de Santana
Carla Simone Siqueira de Oliveira Neyton Souza dos Santos
Chistian Diniz Lima e Silva Nicole Patrícia de Lima Vinagre da Ponte
Cláudia Costa Nascimento Osvaldo Gato Nunes
Cristiane Mota dos Santos Paulo Marcelo Pedroso
Daniel Berretta Moreira Alves Renê Silva Pimentel
Ederly Santos Silva Rodrigo de Sousa Cruz
Edilmara Patricia Rocha Sara Freitas de Sousa
Edna Ferreira Coelho Galvão Solange Maria de Azevedo Gomes
Elenise Pinto de Arruda Suelen Maria Santos de Souza
Elidiane Moreira Kono Tatiane Costa Quaresma
Fernanda Tabita Zeidan De Souza Thayanne Branches Pereira
Giovana Andreia Gibbert de Souza Trícia Ferreira Brito Figueira
Helaine Furtado Verena Pereira Maia
Iracy Leane Batista Lopes Yane Santos Almeida
Jocileia da Silva Bezerra Ygor da Silva Rebelo
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

Apresentação

Com raízes na esperança, o IESPES – Instituto Esperança de Ensino Superior – nasceu em 2001.
É resultado de um projeto iniciado na década de 70, a Fundação Esperança, criada com o objetivo
de cuidar de vidas na Amazônia. Começou com atendimentos em saúde e se fortaleceu com a edu-
cação.
O Instituto Esperança de Ensino Superior – IESPES, uma instituição mantida pela Fundação
Esperança, há 17 anos vem formando profissionais nas diversas áreas do conhecimento, buscando,
conforme seu Plano de Desenvolvimento Institucional, promover a educação integral do ser humano,
visando à formação técnico-científica de qualidade, em consonância com as exigências do século
XXI, incorporando inovações científicas e tecnológicas que contribuam para o desenvolvimento so-
cioambiental, econômico, político e cultural do município de Santarém e de toda a região.
A Política Institucional de Apoio à Pesquisa e à Extensão está voltada ao Programa de Iniciação
Científica, com o incentivo docente e discente para o desenvolvimento de projetos, e ao Programa
Institucional de Apoio à Extensão Universitária, por meio do Projeto Interdisciplinar, que proporciona
aos acadêmicos a integração direta com a comunidade.
Como principal evento de cunho acadêmico-científico do Iespes, realizado por meio da Co-
ordenação de Pós-Graduação, Pesquisa e Extensão, o I CONGRESSO INTERNACIONAL DE PES-
QUISA E CIÊNCIA DO IESPES discute o tema “Conhecimento e inovação para a transformação da
sociedade”, e conta com palestras, mesas redondas, minicursos e oficinas, além do principal foco
da jornada que é a comunicação dos trabalhos de pesquisa e iniciação científica em diversas áreas
do conhecimento, produzidos por estudantes e pesquisadores de instituições de educação superior
públicas e privadas da região Oeste do Pará.
Todos os trabalhos aprovados para o evento estão compilados neste LIVRO DE RESUMOS DO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES, configurando-se como uma
fonte de buscas para as pesquisas desenvolvidas na região, fazendo chegar até a comunidade em
geral uma parte do conhecimento produzido no âmbito do ensino superior.

Juarez de Souza
Diretor do IESPES

4 APRESENTAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

SUMÁRIO
JOVEM PESQUISADOR - PÓS GRADUAÇÃO
RASTREAMENTO GENÉTICO DE TAMBAQUI PRODUZIDOS EM ESTAÇÕES DE REPRODUÇÃO............................................................................................. 22

CONTROLE DA DIABETES MELLITUS: DESAFIO DE UMA EQUIPE DA ESTRATÉGIA SAÚDE DA FAMÍLIA DO MUNICÍPIO EM SANTARÉM-PARÁ......................... 25

LEVANTAMENTO DE CASOS DE ACIDENTE VASCULAR ENCEFÁLICO EM UM HOSPITAL PÚBLICO DE SANTARÉM – PA NOS ANOS DE 2011 A 2016............ 28

A PREVALÊNCIA DE MICRONÚCLEOS EM CÉLULAS ESFOLIATIVAS DA MUCOSA ORAL EM FRENTISTAS DE SANTARÉM, PARÁ............................................... 32

CARACTERIZAÇÃO QUÍMICA DOS CONSTITUINTES DA PRIPRIOCA CYPERUS ARTICULATUS.............................................................................................. 35

TEOR E IDENTIFICAÇÃO DOS CONSTITUINTES QUIMICOS DO ÓLEO ESSENCIAL (OE) DE LIPPIA ORIGANOIDES KUNTH (VERBENACEAE)......................... 38

AVALIAÇÃO QUALITATIVA DOS PRINCIPAIS SOFTWARES UTILIZADOS EM FOTOGRAMETRIA COMPUTADORIZADA............................................................. 43

AVALIAÇÃO DO EFEITO DA MANGIFERINA NO REPARO TECIDUAL E FUNCIONAL EM MODELO DE LESÃO DE TENDÃO CALCÂNEO................................ 47

ATIVIDADE ANTIPLASMÓDICA IN VITRO DOS ÓLEOS ESSENCIAIS DE FOLHAS E GALHOS DE PIPER MARGINATUM JACQ. (PIPERACEAE)............................. 51

ACTINOBACTÉRIAS CULTIVÁVEIS DA RIZOSFERA DE ANIBA PARVIFLORA: UMA FONTE NATURAL DE BIOCONTROLE DE ESPÉCIES DE FUNGOS AFLATOXIGÊ-
NICOS.............................................................................................................................................................................................................................. 54

JOVEM PESQUISADOR - GRADUAÇÃO


AVALIAÇÃO DA SENSIBILIDADE TÁTIL PROTETORA DOS MEMBROS INFERIORES EM INDIVÍDUOS DIABÉTICOS................................................................... 57

CARACTERÍSTICAS FÍSICO-QUÍMICAS, COMPOSTOS FENÓLICOS E POTENCIAL ANTIOXIDANTE DE MÉIS DE ABELHAS SEM FERRÃO (MELIPONINAE SPP.)
PRODUZIDOS EM BELTERRA, PARÁ..................................................................................................................................................................................... 60

OCORRÊNCIA DE MICOBACTÉRIAS NÃO TUBERCULOSAS (MNT) EM PRIMATAS NÃO HUMANOS NO ZOOLÓGICO DE SANTARÉM-PARÁ......................... 63

PESQUISA DE FORMAS PARASITOLÓGICAS, PARA FINS DE DIAGNÓSTICO DE LEISHMANIA SP. PELA CITOLOGIA DE LINFONODO E MEDULA ÓSSEA EM CÃES
COM DIAGNÓSTICO POSITIVOS PELO ELISA PARA LVC, NO MUNICÍPIO DE SANTARÉM-PA............................................................................................... 66

ANÁLISE DO BEM-ESTAR SUBJETIVO INFANTIL A PARTIR DO DESENHO DA FIGURA HUMANA: CARACTERÍSTICAS DA PESSOA FELIZ E INFELIZ.................... 69

PERFIL DAS MULHERES COM CÂNCER DO COLO DE ÚTERO E DE MAMA ATENDIDAS NO HOSPITAL REGIONAL DO BAIXO AMAZONAS, SANTARÉM/PA, 2010
A 2015............................................................................................................................................................................................................................. 72

PERFIL DE RESISTÊNCIA ANTIMICROBINA DOS ESTAFILOCOCOS PRESENTES NAS SUPERFÍCIES DA UTI DE UM HOSPITAL DA AMAZÔNIA.......................... 75

AVALIAÇÃO DE GERMINAÇÃO E DESENVOLVIMENTO INICIAL DE PLÂNTULAS PROGÊNIES DE DIFERENTES MATRIZES DE MOGNO BRASILEIRO (SWIETENIA
MACROPHYLLA)................................................................................................................................................................................................................ 78

AÇÃO ANTIMICROBIANA DO ÓLEO DE CUMARU NAS INFECÇÕES CAUSADAS POR STAPHYLOCOCCUS AUREUS............................................................ 82

SAÚDE PÚBLICA E ACESSO AOS SERVIÇOS DE SAÚDE: PERCEPÇÕES E VIVÊNCIAS DOS MORADORES DE UMA COMUNIDADE RIBEIRINHA NO INTERIOR DA
AMAZÔNIA....................................................................................................................................................................................................................... 85

JOVEM PESQUISADOR - ENSINO MÉDIO


DETECÇÃO DE PARTÍCULAS SÓLIDAS EM ÁGUA UTILIZANDO SENSORES DE LUZ INTEGRADOS À PLATAFORMA ARDUINO................................................ 88

PRODUÇÃO DE MASSA DE FORRAGEM DO PANICUM MAXIMUM CV. BRS ZURI SOB DOSES CRESCENTES DE NITROGÊNIO EM SOLO AMAZÔNICO......... 89

TAXA DE ALONGAMENTO DO PSEUDOCOLMO DO PANICUM MAXIMUM CV. BRS ZURI SOB DOSES CRESCENTES DE NITROGÊNIO EM SOLO AMAZÔNI-
CO................................................................................................................................................................................................................................... 90

CARACTERIZAÇÃO CITOGENÉTICA DE HYPOSTOMUS GR. PLECOSTOMUS (SILURIFORMES:LORICARIIDAE) DA REGIÃO DE CONFLUÊNCIA ENTRE OS RIOS
TAPAJÓS E AMAZONAS, SANTARÉM-PA.............................................................................................................................................................................. 91

PERCEPÇÃO SOBRE A CONTAMINAÇÃO POR AGROTOXICOS DO AMBIENTE E DO LEITE MATERNO DE MÃES LACTANTES RESIDENTES EM DEZ COMUNIDA-
DES NO ENTORNO DE ÁREAS DE PRODUÇÃO AGRÍCOLA DO MUNICÍPIO DE BELTERRA, PARA......................................................................................... 92

PROJETO AQUAPONIA: INTEGRAÇÃO SUSTENTÁVEL DA PRODUÇÃO AGROPECUÁRIA COMO MEIO EDUCATIVO............................................................ 93

AVALIAÇÃO DO PESO DE CAMUNDONGOS (MUS MUSCULUS) UTILIZADOS EM UM TESTE DE TOXICIDADE AGUDA......................................................... 94

POSTER
EXTENSÃO UNIVERSITÁRIA: PREVENÇÃO DE DOENÇAS RENAIS EM ALUSÃO AO DIA MUNDIAL DO RIM............................................................................ 95

A EDUCAÇÃO EM SAÚDE COMO INSTRUMENTO PARA A INTEGRAÇÃO ENSINO-SERVIÇO-COMUNIDADE PROPOSTA PELO PET-SAÚDE.......................... 96

RELATÓRIO EPIDEMIOLÓGICO DA DENGUE NO MUNICÍPIO DE SANTARÉM-PA, NO PERÍODO DE JANEIRO 2000 A MARÇO DE 2017.............................. 97

EFEITOS DA FISIOTERAPIA NA DOR CAUSADA PELA LOMBOCIATALGIA: ESTUDO DE CASO............................................................................................... 98

EXTENSÃO UNIVERSITÁRIA: A EXPERIÊNCIA DE ACADÊMICOS DE MEDICINA ATUANDO NO GRUPO HIPERDIA DA COMUNIDADE QUILOMBOLA DO MURU-

5 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

MURU, EM SANTARÉM-PA.................................................................................................................................................................................................. 99

PRINCIPAIS DIAGNÓSTICOS DE ENFERMAGEM EVIDENCIADOS NOS PACIENTES COM TROMBOSE VENOSA PROFUNDA RELACIONADO À DIABETES MELI-
TUS................................................................................................................................................................................................................................. 100

APLICABILIDADE DO MÉTODO MONTESSORI NO ENSINO INFANTIL EM ESCOLAS PÚBLICAS DE SANTARÉM................................................................... 101

UM OLHAR ANALÍTICO COMPORTAMENTAL PARA AS CONTINGÊNCIAS QUE FAVORECEM A ADESÃO AO TRATAMENTO HEMODIALÍTICO A PARTIR DO INÍ-
CIO DOS TRANSPLANTES EM UM HOSPITAL DA REGIÃO NORTE..................................................................................................................................... 102

O USO DO IMPERATIVO NO PORTUGUÊS FALADO SANTARENO: ANÁLISE DE NARRATIVAS DE EXPERIÊNCIA PESSOAL.................................................... 103

PROTOCOLO FISIOTERAPÊUTICO NA PARALISIA DE BELL: ESTUDO DE CASO.................................................................................................................. 104

DIAGNOSTICO DE MALASSEZIOSE EM CANINOS E SUA CORRELAÇÃO COM SINAIS CLINICOS DE OTOTPATIAS............................................................. 105

EXPERIÊNCIA DOS ACADÊMICOS DO CURSO DE MEDICINA NA PROMOÇÃO DE SAÚDE INFANTIL................................................................................. 106

HUMANIZAÇÃO NO LABORATÓRIO DE ANÁLISES CLÍNICAS: DIREITOS E DEVERES.......................................................................................................... 107

PROPOSTA DE AVALIAÇÃO CLÍNICA DA CICATRIZAÇÃO DE FERIDAS EM MODELO EXPERIMENTAL................................................................................... 108

APRESENTAÇÃO DA SÍNDROME DE GUILLAIN-BARRÉ....................................................................................................................................................... 109

SAUDE MENTAL E QUALIDADE DE VIDA EM PACIENTES COM FERIDAS CRÔNICAS: O PSICÓLOGO COMO COMPONENTE DA EQUIPE MULTIDISCIPLINAR...
110

OS FAZERES DA PSICOLOGIA JUNTO AO SOFRIMENTO PSÍQUICO DO PROFISSIONAL DA SAÚDE.................................................................................. 111

ENDODONTIA: PARTICULARIDADES, CAMPOS DE ATUAÇÃO E MERCADO DE TRABALHO – UMA REVISÃO DE LITERATURA.............................................. 112

ASSISTÊNCIA DE ENFERMAGEM AO PACIENTE PORTADOR DE SÍNDROME DE FOURNIER EM CLÍNICA CIRÚRGICA: PRINCIPAIS DIAGNÓSTICOS DE ENFERMA-
GEM............................................................................................................................................................................................................................... 113

SÍNDROME DE SOBREPOSIÇÃO: RELATO DE CASO......................................................................................................................................................... 114

ASSISTÊNCIA DE ENFERMAGEM A UM GRANDE QUEIMADO NO HOSPITAL REGIONAL DO BAIXO AMAZONAS COM ÊNFASE A SEGURANÇA DO PACIENTE.
115

DENTÍSTICA RESTAURADORA E ESTÉTICA: UMA REVISÃO DE LITERATURA......................................................................................................................... 116

PESQUISA ETNOBOTÂNICA DE PLANTAS MEDICINAIS UTILIZADAS COMO ANTI-INFLAMATÓRIAS EM SANTARÉM-PARÁ.................................................... 117

A MORTALIDADE DO CÂNCER DE OVÁRIO ENTRE 2012 E 2015 NA REGIÃO NORTE E SUA EXPECTATIVA PARA 2018....................................................... 118

EMPATIA COMO FACILITADORA NAS RELAÇOES AMOROSAS: UM ESTUDO BIBLIOGRÁFICO........................................................................................... 119

AVALIAÇÃO DO RISCO DE LESÃO POR PRESSÃO EM PACIENTES IDOSOS ACAMADOS ATRAVÉS DA ESCALA DE BRADEN................................................. 120

A IMPORTÂNCIA DOS “MIL DIAS DE OURO” NO ÂMBITO DO PLENO DESENVOLVIMENTO DA CRIANÇA, UMA ABORDAGEM EM UMA COMUNIDADE REMA-
NESCENTE QUILOMBOLA NO INTERIOR DA AMAZÔNIA................................................................................................................................................. 121

ASPECTOS EPIDEMIOLÓGICOS DA MALÁRIA NO ESTADO DO PARÁ NO PERÓIODO DE 2015 A 2017............................................................................ 122

A ESCOLA NA ERA DIGITAL: GAMIFICAÇÃO COMO METODOLOGIA ATIVA EM SALA DE AULA........................................................................................ 123

HANSENÍASE: DIFICIL DIAGNÓSTICO............................................................................................................................................................................. 124

ESTUDO EPIDEMIOLÓGICO DOS CASOS DE DENGUE NO MUNICIPIO DE ITAITUBA, ESTADO DO PARÁ, BRASIL............................................................. 125

QUERATOCISTO ODONTOGÊNICO................................................................................................................................................................................ 126

PERCEPÇÕES E CAPACITAÇÃO DE AGENTES COMUNITÁRIOS DE SAÚDE EM SUPORTE BÁSICO DE VIDA PARA ATUAÇÃO NA COMUNIDADE.................. 127

A IMPORTÂNCIA DA LIGA ACADÊMICA DE URGÊNCIA E EMERGÊNCIA NA MELHORIA DO ATENDIMENTO EM SAÚDE DA POPULAÇÃO DE UM MUNICÍPIO
NO INTERIOR DA AMAZÔNIA, UM RELATO DE EXPERIÊNCIA............................................................................................................................................ 128

O DESENCADEAMENTO DA SÍNDROME DE REYE............................................................................................................................................................ 129

A UTILIZAÇÃO DE SIMULAÇÃO COMO METODOLOGIA DE ENSINO NA PERCEPÇÃO DE MONITORAS DE LABORATÓRIO DE ENFERMAGEM.................. 130

RELATO DE UMA INTERAÇÃO SOCIAL NO ASSENTAMENTO AGROEXTRATIVISTA DA COMUNIDADE PONTE ALTA, REGIÃO DO EIXO FORTE – MUNICÍPIO DE
SANTARÉM...................................................................................................................................................................................................................... 131

PROGRAMAÇÃO NEUROLINGUÍSTICA APLICADA AO ENSINO E A APRENDIZAGEM......................................................................................................... 132

BRINCAR: EXPERIENCIA NECESSÁRIA PARA O DESENVOLVIMENTO INTEGRAL NA INFÂNCIA............................................................................................ 133

PERFIL EPIDEMIOLÓGICO DAS PRINCIPAIS CAUSAS DE TRAUMA RAQUIMEDULAR IDENTIFICADAS NAS DIFERENTES REGIÕES BRASILEIRAS...................... 134

INTERCORRÊNCIAS NA GESTAÇÃO DAS MÃES DE CRIANÇAS COM ATRASOS NEUROMOTOR ATENDIDAS EM UM CENTRO DE REFERÊNCIA NO OESTE DO
PARÁ............................................................................................................................................................................................................................... 135

6 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ALTERAÇÕES POSTURAIS DE PACIENTES EM TRATAMENTO PARA NEOPLASIA MAMÁRIA: UMA REVISÃO DE LITERATURA.................................................... 136

PERCEPÇÃO DOS PACIENTES QUE SOFRERAM AMPUTAÇÃO TRAUMÁTICA ACERCA DA ASSISTÊNCIA DE ENFERMAGEM EM UM HOSPITAL PÚBLICO DE SAN-
TARÉM PARÁ.................................................................................................................................................................................................................... 137

PERFIL CLINICO-FUNCIONAL E RISCO CARDIOVASCULAR EM PACIENTES HEMIPARÉTICOS PÓS-AVE............................................................................... 138

INVESTIGAÇÃO DE FATORES DE RISCO PARA DOENÇA ARTERIAL CORONARIANA (DAC) EM PACIENTES ATENDIDOS EM UNIDADES DE SAÚDE (US) NO MU-
NICÍPIO DE SANTARÉM-PA SEGUNDO O ESCORE DE FRAMINGHAN E INCIDÊNCIA DE SÍNDROME METABÓLICA............................................................ 139

AVALIAÇÃO COMPARATIVA DO USO DE HIPOCLORITO DE SÓDIO EM ÁGUA DE CONSUMO HUMANO ORIUNDA DE POÇO ARTESIANO E DE MICROSSIS-
TEMAS EM SANTARÉM PARÁ............................................................................................................................................................................................. 140

ANÁLISE ECTOPARASITÁRIA DE ORTHEMIS DISCOLOR (ANISOPTERA-ODONATA) EM CORPOS HÍDRICOS COM DIFERENTES NÍVEIS DE CONSERVAÇÃO NA
REGIÃO OESTE DO PARÁ................................................................................................................................................................................................ 141

ANÁLISE DE DESEMPENHO DE DISTRIBUIÇÕES LINUX VIRTUALIZADAS EM SISTEMA HOSPEDEIRO WINDOWS UTILIZANDO VIRTUALBOX......................... 142

FAZERES DO PSICÓLOGO DA SAÚDE: A ESPIRITUALIDADE COMO RECURSO DE ENFRENTAMENTO DO PACIENTE COM DOR........................................ 143

O FENÔMENO RELIGIOSO: REFLEXÕES SOB O PONTO DE VISTA ÉTICO E PSICOLÓGICO............................................................................................. 144

CARACTERÍSTICAS GERADORAS DE ESTRESSE OCUPACIONAL EM ENFERMEIROS DO SETOR DE URGÊNCIA E EMERGÊNCIA DO HOSPITAL MUNICIPAL DE
ITAITUBA, ESTADO DO PARÁ, BRASIL............................................................................................................................................................................... 145

PERFIL EPIDEMIOLÓGICO DOS PACIENTES ATENDIDOS EM UM CENTRO DE TESTAGEM E ACONSELHAMENTO EM SANTARÉM PARÁ............................... 146

APLICAÇÃO DA TERAPIA MANUAL NO REJUVENESCIMENTO FACIAL............................................................................................................................... 147

DESENVOLVIMENTO DE FUNÇÕES COGNITIAS ATRAVÉS DE MÉTODOS BASEADOS NA TEORIA CONSTRUTIVISTA.......................................................... 148

A CONTAÇÃO DE HISTÓRIA E O LÚDICO E SUAS INFLUÊNCIAS NO DESENVOLVIMENTO DA CRIANÇA.......................................................................... 149

QUALIDADE DE VIDA DE MULHERES EM TRATAMENTO DE NEOPLASIA MAMÁRIA: UMA REVISÃO DE LITERATURA............................................................. 150

PERFIL EPIDEMIOLÓGICO DA MICROÁREA 04 DA ESTRATÉGIA DE SAÚDE DA FAMÍLIA II DO BAIRRO SANTARENZINHO NO MUNICÍPIO DE SANTARÉM –
PARÁ............................................................................................................................................................................................................................... 151

EFEITOS DA SUPLEMENTAÇÃO DA FARINHA EXTRUSADA DE AMARANTO E QUIRERA DE ARROZ SOBRE O NÍVEL DE PROLACTINA EM RATOS ADULTOS DES-
NUTRIDOS...................................................................................................................................................................................................................... 152

AVALIAÇÃO DAS AUTORIZAÇÕES DE INTERNAÇÃO HOSPITALAR (AIH) DE CARATÉR ELETIVO E DE URGÊNCIA APROVADAS NO HOSPITAL MUNICIPAL DE
SANTARÉM-PA................................................................................................................................................................................................................. 153

VANTAGENS EDUCACIONAIS PROPORCIONADAS POR UM GRUPO DE ESTUDOS DE ROBÓTICA E AUTOMAÇÃO........................................................... 154

ANÁLISE DO EQUILÍBRIO POSTURAL ESTÁTICO APÓS A COLOCAÇÃO DE PEÇAS PODAIS EM ADULTOS MILITARES......................................................... 155

ANÁLISE DA DIÁSTASE DOS MÚSCULOS RETO-ABDOMINAIS (DMRA) ENTRE GESTANTES PRIMÍPARAS E MULTÍPARAS ATENDIDAS NO CENTRO DE REFERÊNCIA
EM SAÚDE DA MULHER EM SANTARÉM-PA....................................................................................................................................................................... 156

TRAJETÓRIA DA LIGA ACADÊMICA DE FISIOTERAPIA DESPORTIVA DO OESTE DO PARÁ (LAFID)........................................................................................ 157

ADOLESCENTES EM CONFLITOS COM A LEI:MEDIDAS SOCIOEDUCATIVAS..................................................................................................................... 158

DENTES SUPRANUMERÁRIOS: REVISÃO DA LITERATURA E RELATO DE CASO................................................................................................................... 159

OSTEDISTROFIA RENAL ASSOCIADO COM TUMOR MARROM DO HIPERPARATIREIDISMO NA MANDÍBULA: RELATO DE CASO......................................... 160

BRINCADEIRAS E JOGOS: INSTRUMENTOS QUE DESENVOLVEM HABILIDADES NA EDUCAÇÃO INFANTIL........................................................................ 161

ASSISTÊNCIA MULTIPROFISSIONAL AOS PACIENTES ACAMADOS DA ESTRATÉGIA DE SAÚDE DA FAMÍLIA II DO BAIRRO SANTARENZINHO NO MUNICÍPIO DE
SANTARÉM- PARÁ............................................................................................................................................................................................................ 162

CARACTERIZAÇÃO E EPIDEMIOLOGIA DOS CASOS DE MALÁRIA NO MUNICÍPIO DE ITAITUBA, ESTADO DO PARÁ, BRASIL.............................................. 163

LEARNING EXPERIENCE: UMA ABORDAGEM SOBRE NOVAS METODOLOGIAS DE APRENDIZAGEM.................................................................................. 164

SOBREPESO E OBESIDADE EM ESCOLARES DO MUNICIPIO DE SANTARÉM-PA................................................................................................................. 165

ANSIEDADE E DESESPERANÇA NO PACIENTE RENAL CRÔNICO EM HEMODIÁLISE.......................................................................................................... 166

PERFIL EPIDEMIOLÓGICO E CARACTERIZAÇÃO DOS CASOS DE HIV (AIDS) NO MUNICÍPIO DE ITAITUBA, ESTADO DO PARÁ, BRASIL.............................. 167

SISTEMATIZAÇÃO DA ASSISTÊNCIA DE ENFERMAGEM AO PACIENTE PEDIÁTRICO COM ARTRITE SÉPTICA DO QUADRIL: UM RELATO DE CASO............... 168

DOENÇAS CAUSADAS POR PROTOZOÁRIOS INTESTINAIS NO MUNICÍPIO DE ITAITUBA, ESTADO DO PARÁ, BRASIL........................................................ 169

SISTEMATIZAÇÃO DA ASSISTÊNCIA DE ENFERMAGEM A UM PACIENTE COM DIAGNÓSTICO DE FRATURA DIAFISÁRIA DE FEMUR: UM RELATO DE CASO.170

CUIDADOS DE ENFERMAGEM NA PREVENÇÃO E TRATAMENTO DE LESÕES POR PRESSÃO EM PACIENTES NA UNIDADE DE TERAPIA INTENSIVA: UMA REVISÃO
DESCRITIVA..................................................................................................................................................................................................................... 171

7 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO DA NECESSIDADE DE TERAPIA RENAL SUBSTITUTIVA NOS CASOS DE LEPTOSPIROSE.................................................................................... 172

ATUAÇÃO DA HIDROTERAPIA EM PACIENTES COM ESCLEROSE LATERAL AMIATRÓFICA: REVISÃO DE LITERATURA............................................................ 173

A ASSISTÊNCIA DE ENFERMAGEM NAS ORIENTAÇÕES VOLTADAS AO ALEITAMENTO MATERNO...................................................................................... 174

AVALIAÇÃO DA SÍNDROME DE BURNOUT RELACIONADA COM A PRÁTICA DE ATIVIDADE FÍSICA EM ESTUDANTES DE MEDICINA................................... 175

O CONTEXTO DO CÂNCER DE ESÔFAGO NO BRASIL: UMA REVISÃO............................................................................................................................. 176

ATUAÇÃO DO ENFERMEIRO NO TRATAMENTO ASSISTIDO DE TUBERCULOSE PULMONAR.............................................................................................. 177

LEVANTAMENTO RÁPIDO DA QUALIDADE DOS CORPOS HÍDRICOS................................................................................................................................ 178

CONTAGEM DE OVOS POR GRAMA DE FEZES (OPG) EM EQUÍDEOS ATENDIDOS POR ACADÊMICOS DE MEDICINA VETERINÁRIA NA CAMPANHA DO CAVA-
LO LEGAL NA CIDADE DE SANTARÉM – PARÁ................................................................................................................................................................... 179

EFEITO DA INTEGRIDADE DO AMBIENTE SOBRE AS COMUNIDADES DE ODONATAS (INSECTA) EM IGARAPÉS COM DIFERENTES NIVEIS DE CONSERVAÇÃO
NO OESTE PARAENSE..................................................................................................................................................................................................... 180

TECNOLOGIAS DE INFORMAÇÃO E COMUNICAÇÃO: REPRESENTAÇÕES SOCIAIS E PRÁTICAS DE UTILIZAÇÃO ENTRE DOCENTES E DISCENTES UNIVERSI-
TÁRIOS........................................................................................................................................................................................................................... 181

EDUCAÇÃO QUILOMBOLA: REFLEXÕES HISTÓRICAS E EDUCACIONAIS......................................................................................................................... 182

AVALIAÇÃO DA TOXICIDADE AGUDA DO HIDROLATO DA PIPER MARGINATUM............................................................................................................... 183

AÇÃO EM SAÚDE PARA A COMUNIDADE EM UMA ESCOLA LOCALIZADA EM SANTARÉM-PARÁ........................................................................................ 184

IMAGEM CORPORAL E BUSCA PELA \”MUSCULARIDADE\”: PERSPECTIVAS PARA A PRESCRIÇÃO DA MUSCULAÇÃO......................................................... 185

EMPIEMA SUBDURAL OS PARADIGMAS DA ASSISTÊNCIA DE ENFERMAGEM A UM PACIENTE NO INTERIOR DA AMAZÔNIA.............................................. 186

AVALIAÇÃO DA TOXICIDADE AGUDA DO ÓLEO ESSENCIAL DA PIPER MARGINATUM...................................................................................................... 187

A IMPORTÂNCIA DO ENFERMEIRO NO TRATAMENTO DA HANSENÍASE NA ESTRATÉGIA SAÚDE DA FAMÍLIA.................................................................... 188

CONDUTAS DE ENFERMAGEM NA ADMINISTRAÇÃO DE QUIMIOTERÁPICOS.................................................................................................................. 189

RELATO DE EXPERIÊNCIA VIVENCIADO EM UMA SALA DE VACINA DE UMA UNIDADE BÁSICA DE SAÚDE NO MUNICÍPIO DE SANTARÉM-PARÁ................ 190

TAXA DE APARECIMENTO FOLIAR DO PANICUM MAXIMUM CV. BRS ZURI SOB DOSES CRESCENTES DE NITROGÊNIO EM SOLO AMAZÔNICO................ 191

ATUAÇÃO DOS PROFISSIONAIS DE ENFERMAGEM NA PREVENÇÃO DE SEPSE NO SETOR DE UTI PEDIÁTRICA................................................................. 192

OCORRÊNCIA DE ACIDENTES COM CORPO ESTRANHO EM PACIENTES ATENDIDOS NO SETOR DE URGÊNCIA E EMERGÊNCIA EM UM HOSPITAL PÚBLICO
DE SANTARÉM – PA NO ANO DE 2016............................................................................................................................................................................ 193

DETERMINAÇÃO DA FREQUÊNCIA DE MICRONÚCLEOS EM CÉLULAS ESFOLIATIVAS DA MUCOSA ORAL EM INDIVÍDUOS FUMANTES E ETILISTAS........... 194

A INCIDÊNCIA DE PARTO NORMAL E CESÁREO NO HOSPITAL MUNICIPAL DE SANTARÉM - PARÁ NO PERÍODO DE 2012 A 2015.................................... 195

AUTORIZAÇÃO DE INTERNAÇÃO HOSPITALAR (AIH) RELACIONADA A ACIDENTES DE TRANSPORTE EM SANTARÉM-PA.................................................... 196

TUBERCULOSE PULMONAR COMO CONSEQUÊNCIA DO TABAGISMO........................................................................................................................... 197

EDUCAÇÃO SEXUAL E PROTEÇÃO À SAÚDE.................................................................................................................................................................... 198

DESAFIOS E APRENDIZAGENS NOS FESTEJOS RELIGIOSOS DA COMUNIDADE SÃO JOÃO DO LAGO GRANDE, EM SANTARÉM- PARÁ............................ 199

PERFIL DA SÍFILIS GESTACIONAL NO MUNICÍPIO DE SANTARÉM/PA................................................................................................................................. 200

SEPSE: A IMPORTÂNCIA DE UM DIAGNÓSTICO RÁPIDO EM CASOS DE URGÊNCIA E EMERGÊNCIA................................................................................ 201

PERFIL EPIDEMIOLÓGICO DE PACIENTES COM HIV/AIDS DO MUNICÍPIO DE SANTARÉM ENTRE O ANO DE 2012 A 2016............................................... 202

ANÁLISE DO PERFIL CLÍNICO-EPIDEMIOLÓGICO DOS INDIVÍDUOS DIAGNOSTICADOS COM FEBRE AMARELA: UMA REVISÃO INTEGRATIVA................. 203

PERFIL EPIDEMIOLÓGICO DAS MORTES AUTOPROVOCADAS EM SANTARÉM-PA DE 2007 A 2015.................................................................................... 204

PET-SAÚDE/GRADUASUS: UM RELATO DE EXPERIÊNCIA ACADÊMICA NA ATENÇÃO BÁSICA............................................................................................ 205

FISIOTERAPIA NAS DISFUNÇÕES DO ORGASMO FEMININO – UMA REVISÃO LITERÁRIA.................................................................................................. 206

ALTERAÇÃO NEUROBIOLÓGICA E COMPORTAMENTAL DO DEPENDENTE DE SUBSTÂNCIAS QUÍMICAS......................................................................... 207

DIÁLOGO COM ADOLESCENTES SOBRE VIOLÊNCIA DOMÉSTICA E INTRAFAMILIAR: UM RELATO DE EXPERIÊNCIA......................................................... 208

AS CONTRIBUIÇÕES DA MÚSICA NO DESENVOLVIMENTO PSICOMOTOR DE CRIANÇAS DE 02 Á 04 DA EDUCAÇÃO INFANTIL: UM OLHAR A PARTIR DO


MÉTODO DALCROZE...................................................................................................................................................................................................... 209

ISQUEMIA MESENTÉRICA: RELATO DE EXPERIÊNCIA EM UM HOSPITAL PÚBLICO DO BAIXO AMAZONAS.......................................................................... 210

8 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A PESSOA COM DEFICIÊNCIA E O RESPEITO A SUA DIGNIDADE: UMA CONSTRUÇÃO HISTÓRICA.................................................................................. 211

DAS ESTRATÉGIAS DE LEITURA A GÊNEROS TEXTUAIS: UM PASSO PARA O LEITOR CRÍTICO............................................................................................. 212

ANGIOGRAFIA DE MEMBROS SUPERIORES...................................................................................................................................................................... 213

CREATININA COMO PREDITOR INSUFICIENTE NO DIAGNÓSTICO DE DOENÇA RENAL CRÔNICA.................................................................................. 214

AVALIAÇÃO DA QUALIDADE DE VIDA DO PACIENTE HEMODIALÍTICO............................................................................................................................. 215

EXTRATIVISMO DO AÇAÍ: INFLUÊNCIA NA RENDA FAMILIAR DOS MORADORES DA COMUNIDADE DE MURUMURU, SANTARÉM-PARÁ............................. 216

AVALIAÇÃO DO EFEITO CICATRIZANTE DE CORONOPUS DIDYMUS (L.) SMITH EM LESÕES CUTÂNEAS EXTERNAS EM RATOS WISTAR.............................. 217

OS ASPECTOS GERAIS DO CUMARU (DIPTERYX ODORATA WILLD)................................................................................................................................... 218

ASSISTÊNCIA DE ENFERMAGEM EM CRIANÇAS PORTADORAS DE DOENÇAS CRÔNICAS EM UNIDADE DE TERAPIA INTENSIVA DE UM HOSPITAL PÚBLICO DA
CIDADE DE SANTARÉM, ESTADO DO PARÁ...................................................................................................................................................................... 219

SEGURANÇA DO TRABALHO: UM ESTUDO NA EMPRESA MRW ENERGIA NA PERCEPÇÃO DOS AGENTES DE COBRANÇA............................................... 220

A PRÁTICA NA FORMAÇÃO DOS ACADEMICOS DE LICENCIATURA EM PEDAGOGICA: RELATO DA VISITA TECNICA NA ESCOLA DE ENSINO TECNICO DO
ESTADO DO PARÁ (EETEPA)............................................................................................................................................................................................. 221

SÍNDROME DE BURNOUT EM PROFESSORES DE UMA INSTITUIÇÃO PRIVADA DO ENSINO FUNDAMENTAL EM SANTARÉM, PARÁ..................................... 222

MALÁRIA PULMONAR ASSOCIADA A SEPTICEMIA: UM RELATO DE CASO......................................................................................................................... 223

PERCEPÇÃO ENTOMOLÓGICA DOS ALUNOS DE ENSINO FUNDAMENTAL DA COMUNIDADE INDÍGENA (MUNDURUKU) EM AÇAIZAL, SANTARÉM-PA... 224

TOXICIDADE DO HERBICIDA ATRAZINA EM PEIXES DE ÁGUA DOCE................................................................................................................................. 225

CATETER CENTRAL DE INSERÇÃO PERIFÉRICA: PRINCIPAIS INDICAÇÕES, RISCOS E BENEFÍCIOS NA UNIDADE DE TERAPIA INTENSIVA NEONATAL........... 226

SÍNDROME DE BURNOUT: EDUCAÇÃO EM SAÚDE PARA FUNCIONÁRIOS DE UMA UNIDADE BÁSICA DE SAÚDE EM SANTARÉM..................................... 227

DURAÇÃO DE VIDA DAS FOLHAS DO PANICUM MAXIMUM CV. BRS ZURI SOB DOSES CRESCENTES DE NITROGÊNIO EM SOLO AMAZÔNICO............... 228

PRÁTICAS MUSICAIS PARA CRIANÇAS E ADOLESCENTES EM CONTEXTO DE ACOLHIMENTO INSTITUCIONAL EM SANTARÉM, PARÁ: UM RELATO DE ATIVIDA-
DE EXTENSIONISTA......................................................................................................................................................................................................... 229

TAXA DE ALONGAMENTO FOLIAR DO PANICUM MAXIMUM CV. BRS ZURI SOB DOSES CRESCENTES DE NITROGÊNIO EM SOLO AMAZÔNICO............... 230

SELEÇÃO DE PLANTAS MATRIZES PARA O CULTIVO IN VITRO DE ANANAS COMOSUS CV. IMPERIAL................................................................................. 231

MOBILIZAÇÃO PRECOCE, SUA INFLUÊNCIA NA FORÇA MUSCULAR E NO TEMPO DE INTERNAÇÃO DO PACIENTE CRÍTICO EM UMA UNIDADE DE TERAPIA
INTENSIVA: REVISÃO DE LITERATURA............................................................................................................................................................................... 232

ATRASO NO DESENVOLVIMENTO MOTOR E FATORES SOCIOECONÔMICOS E NUTRICIONAIS ASSOCIADOS EM CRIANÇAS QUILOMBOLAS DA REGIÃO DO
BAIXO-AMAZONAS......................................................................................................................................................................................................... 233

ALTURA DO PANICUM MAXIMUM CV. BRS ZURI SOB DOSES CRESCENTES DE NITROGÊNIO EM SOLO AMAZÔNICO....................................................... 234

ISOLAMENTO, CARACTERIZAÇÃO E IDENTIFICAÇÃO DE BACTÉRIAS AMILOLÍTICAS DO RIO NEGRO............................................................................... 235

ESTUDO COMPARATIVO DO RISCO CORONARIANO ENTRE JOVENS UNIVERSITÁRIOS COM RELAÇÃO CINTURA-QUADRIL NORMAL E ELEVADO DE UMA
INSTITUIÇÃO PÚBLICA DE ENSINO SUPERIOR................................................................................................................................................................. 236

ATRASO NO CRESCIMENTO E DESENVOLVIMENTO EM CRIANÇAS DE 0 A 24 MESES NO PRIMEIRO SEMESTRE DE 2015 EM UM CENTRO DE REFERÊNCIA EM
SAÚDE DA CRIANÇA NA AMAZÔNIA............................................................................................................................................................................... 237

PROJETO ENVELHESER: UMA EXPERIÊNCIA DE EXTENSÃO UNIVERSITÁRIA EM UMA INSTITUIÇÃO DE LONGA PERMANÊNCIA NO INTERIOR DA AMAZÔNIA..
238

SUSTENTABILIDADE: OBTENÇÃO DE RENDA ATRAVÉS DA RECICLAGEM DE RESÍDUOS SÓLIDOS NA COOPERATIVA PEREMA COOPERE RECICLA NA CIDADE
DE SANTARÉM - PA.......................................................................................................................................................................................................... 239

DOSES DE NITROGÊNIO EM SOLO AMAZÔNICO E SEU EFEITO SOBRE O FILOCRONO DA FORRAGEIRA PANICUM MAXIMUM CV. BRS ZURI................... 240

PREVALÊNCIA DE COMPLICAÇÕES INTRADIALÍTICAS NO CENTRO DE TERAPIA RENAL SUBSTITUTIVA EM UM HOSPITAL PÚBLICO DA REGIÃO OESTE DO
PARÁ............................................................................................................................................................................................................................... 241

ASPECTOS EPIDEMIOLÓGICOS RELACIONADOS À LOMBALGIA GESTACIONAL E QUALIDADE DE VIDA DE GESTANTES ATENDIDAS EM UM CENTRO DE
REFERÊNCIA DE SAÚDE DA MULHER................................................................................................................................................................................ 242

ODONTOLOGIA LEGAL: PARTICULARIDADES, CAMPOS DE ATUAÇÃO E MERCADO DE TRABALHO – UMA REVISÃO DE LITERATURA................................ 243

A APLICABILIDADE DO TESTE PROJETIVO RORSCHACH NA IDENTIFICAÇÃO DOS TRAÇOS PSICOLÓGICOS DE ADOLESCENTES HOMICIDAS................. 244

PROMOÇÃO A SAÚDE EM MULHERES MASTECTOMIZADAS: UMA REVISÃO BIBLIOGRÁFICA............................................................................................ 245

AVALIAÇÃO DA COBERTURA VACINAL NA CAMPANHA DE INFLUENZA EM SANTARÉM-PA............................................................................................... 246

9 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

O USO DE TERAPIAS ALTERNATIVAS NO ATENDIMENTO DO PACIENTE IDOSO DOMICILIAR: UM ESTUDO DE CASO....................................................... 247

AVALIAÇÃO DE CONTATOS INTRADOMICILIARES REGISTRADOS E EXAMINADOS DE CASOS DE HANSENÍASE NO MUNÍCIPIO DE SANTARÉM-PA............ 248

EXPERIÊNCIAS MUNICIPAIS DE PROGRAMAS DE COLETA SELETIVA E O CASO DO MUNICÍPIO DE SANTARÉM - PA........................................................... 249

OCORRÊNCIA DE PHTHIA PICTA (HEMIPTERA: COREIDAE) NA CULTURA DE BERINJELA EM SANTARÉM-PA........................................................................ 250

AVALIAÇÃO DE MULHERES QUE REALIZARAM MAMOGRAFIA NO PARÁ E REGIÃO NORTE DO BRASIL.............................................................................. 251

PERCEPÇÃO DAS MULHERES SOBRE O EXAME PREVENTIVO DO CANCER DE COLO UTERINO EM UMA UNIDADE DE REFERÊNCIA DO ESTADO DO PARÁ.....
252

INCIDENCIA DE FERIMENTO POR ARMA BRANCA QUE EVOLUIU COM TRATAMENTO DE DRENAGEM TORACICA, NO PERIODO DE DOIS MIL E TREZE A DOIS
MIL E QUATORZE............................................................................................................................................................................................................ 253

ÍNDICE DE VULNERABILIDADE DAS ÁGUAS SUBTERRÂNEAS NA ÁREA URBANA DO MUNICÍPIO DE ALTAMIRA, PARÁ......................................................... 254

A PARTICIPAÇÃO DAS CRIANÇAS DE UMA ESCOLA PÚBLICA DE PARINTINS NO PROJETO DE EXTENSÃO MALA DE LEITURA E LETRAMENTO DA UNIVERSIDADE
DO ESTADO DO AMAZONAS-UEA.................................................................................................................................................................................. 255

A UTILIZAÇÃO DE OFICINAS PEDAGÓGICAS PARA CONSTRUÇÃO DA ESCRITA ORTOGRÁFICA NO 4º ANO DO ENSINO FUNDAMENTAL EM UMA ESCOLA
PÚBLICA DO MUNICÍPIO DE PARINTINS-AM.................................................................................................................................................................... 256

A FILOSOFIA NA FORMAÇÃO DO PROFESSOR DE MATEMÁTICA: UMA RELAÇÃO NECESSÁRIA PARA CONSTRUÇÃO DA CIÊNCIA................................... 257

OSTEOSSARCOMA: UM RELATO DE CASO...................................................................................................................................................................... 258

AS PRINCIPAIS ALTERAÇÕES CAUSADAS PELA ENCEFALOPATIA CRÔNICA NÃO PROGRESSIVA (ECNP) E SUAS RELAÇÕES COM OS DISTÚRBIOS NO SISTEMA
RESPIRATÓRIO: UMA REVISÃO DE LITERATURA................................................................................................................................................................. 259

O PROCESSO DE AVALIAÇÃO NA PERSPECTIVA DOS ALUNOS E PROFESSORES DO 5º ANO DO ENSINO FUNDAMENTAL EM UMA ESCOLA NA REDE MUNI-
CIPAL NA CIDADE DE PARINTINS/ AM.............................................................................................................................................................................. 260

DIVERSIDADE DE ANUROS APÓS INCÊNDIO NA FLONA DO TAPAJÓS, BELTERRA, PARÁ, AMAZÔNIA, BRASIL................................................................... 261

AGIR EDUCATIVO CUIDATIVO NO COMPLEXO AQUÁTICO UNIVERSITÁRIO: PROMOVENDO SAÚDE E BEM ESTAR PARA A COMUNIDADE....................... 262

PERFIL EPIDEMIOLÓGICO DA MALÁRIA NA ETNIA ZOÉ.................................................................................................................................................... 263

O CONTEXTO ECONÔMICO, EDUCACIONAL E NOSSAS PERSPECTIVAS ORGANIZACIONAIS NA EDUCAÇÃO................................................................ 264

DIATOMÁCEAS PERIFÍTICAS COMO BIOINDICADORAS DE QUALIDADE DE ÁGUA NA MICROBACIA DO URUMARI: RESULTADOS PRELIMINARES.............. 265

ANÁLISE HISTÓRICO-ESPACIAL DA MUDANÇA DA PAISAGEM E USO DO SOLO EM TRECHO DO IGARAPÉ DE SÃO BRAZ (SANTARÉM-PA) E SUAS CONSEQU-
ÊNCIAS........................................................................................................................................................................................................................... 266

SEPSE NEONATAL: UMA ABORDAGEM ATUAL.................................................................................................................................................................. 267

A ATUAÇÃO MULTIDISCIPLINAR DO CIRURGIÃO DENTISTA NO TRATAMENTO DAS MALOCLUSÕES EM CRIANÇAS – UMA REVISÃO DE LITERATURA........ 268

CUIDADOS DE ENFERMAGEM EM PACIENTES COM USO DE TUBO OROTRAQUEAL EM UNIDADE DE TERAPIA INTENSIVA: UMA REVISÃO BIBLIOGRÁFICA....
269

AVALIAÇÃO DOS RESULTADOS DE EXAMES PAPANICOLAU (PCCU) EM UMA ESTRATÉGIA DE SAÚDE DA FAMÍLIA (ESF) DE SANTARÉM-PA.......................... 270

SEGURANÇA DA INFORMAÇÃO NAS ESCOLAS............................................................................................................................................................... 271

EXPERIÊNCIAS VIVENCIADAS POR MÃES DE RECÉM-NASCIDOS EM UNIDADE DE TERAPIA INTENSIVA.............................................................................. 272

CARACTERIZAÇÃO DAS OCORRÊNCIAS DO SERVIÇO DE ATENDIMENDO MÓVEL DE URGÊNCIA (SAMU) DO MUNICÍPIO DE SANTARÉM-PA................... 273

A LUTA PELO DIREITO A MORADIA NO BAIXO AMAZONAS: O PROCESSO DE RESISTÊNCIA DA OCUPAÇÃO VISTA ALEGRE DO JUÁ, SANTARÉM -PA........ 274

ANÁLISE DO USO IRRACIONAL DOS INIBIDORES DA BOMBA DE PRÓTONS ENTRE ACADÊMICOS DO CURSO DE FARMÁCIA DA FACULDADE DE ITAITUBA-
-PARÁ.............................................................................................................................................................................................................................. 275

TRATAMENTO CONSERVADOR DA ALOPÉCIA ANDROGENÉTICA EM MULHERES: UM ESTUDO DE CASO BASEADO EM EVIDÊNCIAS................................ 276

IMPLICAÇÕES NA QUALIDADE DE VIDA DE HIPERTENSOS E DIABÉTICOS ATENDIDOS EM UMA UNIDADE BÁSICA DE SAÚDE NO INTERIOR DA AMAZÔNIA..
277

TRATAMENTO DE ÁGUAS NEGRAS PELO TANQUE DE EVAPOTRANSPRAÇÃO NO ESPAÇO INFANTIL IGARA...................................................................... 278

DESLOCADOS INDÍGENAS VENEZUELANOS EM SANTARÉM: UM REFLEXO DA CRISE NA VENEZUELA............................................................................... 279

TESTE DE TOXICIDADE UTILIZANDO DICROMATO DE POTÁSSIO PARA AVALIAR A SENSIBILIDADE DE UMA ESPÉCIE DE PEIXE........................................... 280

ASSISTÊNCIA DE ENFERMAGEM AO PACIENTE PORTADOR DE CÂNCER HEPÁTICO E VIAS BILIARES INTRA-HEPÁTICAS NO INTERIOR DA AMAZÔNIA....... 281

AS COMPLICAÇÕES DA RADIOTERAPIA NO CÂNCER DE CABEÇA E PESCOÇO............................................................................................................... 282

10 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

INCIDÊNCIA DO TRANSTORNO DE ANSIEDADE EM DISCENTES DO ENSINO SUPERIOR NO BRASIL................................................................................ 283

TELESSAÚDE NO AMAZONAS: CONTRIBUIÇÕES DAS FERRAMENTAS UTILIZADAS PELAS EQUIPES DE SAÚDE NO ATENDIMENTO A INDÍGENAS.............. 284

ANÁLISE DA VULNERABILIDADE DAS ÁGUAS SUBTERRÂNEAS DO MUNICÍPIO DE URUARÁ UTILIZANDO O MÉTODO GOD.............................................. 285

ARTRITE REUMATÓIDE: DIAGNÓSTICO E TRATAMENTO................................................................................................................................................... 286

EDUCAÇÃO AMBIENTAL NA PREVENÇÃO DE ACIDENTES: LEVANTAMENTO DOS PRINCIPAIS ANIMAIS PEÇONHENTOS DE OCORRÊNCIA EM LIXOS E ENTU-
LHOS DA CIDADE DE SANTARÉM, PARÁ E AÇÕES DE EXTENSÃO EM ESCOLAS ............................................................................................................... 287

NÚMERO DE ATENDIMENTOS PERTINENTES A PERDAS SANGUÍNEAS EM UMA UNIDADE DE URGÊNCIA E EMERGÊNCIA EM SANTARÉM-PÁ..................... 288

GLOMERULOPATIA MEMBRANOSA IDIOPÁTICA NA AMAZÔNIA BRASILEIRA: UM RELATO DE CASO.................................................................................. 289

O SOFRIMENTO PSIQUICO DOS ACADÊMICOS EM PERÍODO DE GRADUAÇÃO: ESTUDO BIBLIOGRAFICO.................................................................... 290

MANICÔMIOS JUDICIÁRIOS: UM OLHAR DA PSICOLOGIA INSTITUCIONAL.................................................................................................................... 291

PACIENTES DIAGNOSTICADOS COM HIV NO INTERIOR DA AMAZÔNIA: PERFIL EPIDEMIOLÓGICO ANO DE 2017......................................................... 292

TESTAGEM RÁPIDA EM HIV, SÍFILIS, HEPATITES VIRAIS B E C: FORTALECENDO AS AÇÕES NA ATENÇÃO BÁSICA E ESPECIALIZADA NO INTERIOR DA AMAZÔ-
NIA................................................................................................................................................................................................................................. 293

ATUALIZAÇÃO DO CADASTRO E-SUS NA ESTRATÉGIA DE SAÚDE DA FAMÍLIA: A IMPORTÂNCIA E CONTRIBUIÇÃO EPIDEMIOLÓGICA PARA TODA A EQUI-
PE................................................................................................................................................................................................................................... 294

FISIOTERAPIA AQUÁTICA NA REDUÇÃO DA LOMBALGIA GESTACIONAL......................................................................................................................... 295

BENEFÍCIOS DA FISIOTERAPIA AQUÁTICA NO SISTEMA RESPIRATÓRIO: UMA REVISÃO DA LITERATURA............................................................................ 296

ATUAÇÃO DO PSICÓLOGO NO CONTEXTO DE INTERAÇÃO SOCIAL DA PESSOA COM TRANSTORNO DE ESPECTRO AUTISTA - TEA.............................. 297

AS CONSEQUÊNCIAS DO USO DO ÁLCOOL NA ADOLESCÊNCIA.................................................................................................................................. 298

INTERVENÇÃO EM SAÚDE SOBRE CRESCIMENTO E DESENVOLVIMENTO INFANTIL EM DUAS COMUNIDADES REMANESCENTES QUILOMBOLAS NO INTE-
RIOR DA AMAZÔNIA....................................................................................................................................................................................................... 299

TRANSTORNO DO ESPECTRO AUTISTA (TEA): DIAGNÓSTICO E INTERVENÇÃO PSICOPEDAGÓGICA............................................................................... 300

AVALIAÇÃO DA EXPOSIÇÃO DE UMA ESPÉCIE DE PEIXE DA REGIÃO AMAZÔNICA AO PESTICIDA CLORPIRIFÓS............................................................... 301

A PERCEPÇÃO DOS PAIS SOBRE A CONTRIBUIÇÃO DA MUSICALIZAÇÃO PARA O DESENVOLVIMENTO PSICOSSOCIAL DA PRIMEIRA INFÂNCIA.............. 302

A IMPORTÂNCIA DA FISIOTERAPIA NA SAÚDE DO TRABALHADOR................................................................................................................................... 303

OPINIÃO PUBLICA RELACIONADA AO CONSUMO DE ÁGUA EM BAIRROS COM E SEM A INSTALAÇÃO DE HIDRÔMETROS (RESIDENCIAL SALVAÇÃO E BAIR-
RO ALDEIA)..................................................................................................................................................................................................................... 304

APLICAÇÃO DO CUIDADO DE ENFERMAGEM˸ ESTUDO DE CASO COM PORTADOR DO VÍRUS DA HEPATITE C.............................................................. 305

A PRÁTICA DA INTERDISCIPLINARIDADE NO ESTÁGIO SUPERVISIONADO........................................................................................................................ 306

A IMPORTÂNCIA DO TRATAMENTO FISIOTERAPÊUTICO NA PREVENÇÃO DA INCONTINÊNCIA URINARIA........................................................................ 307

ATIVIDADE ANTIBACTERIANA DO ÓLEO ESSENCIAL DE PIPER MARGINATUM SOBRE PATÓGENOS DE INTERESSE CLÍNICO.............................................. 308

PSORÍASE: A DOENÇA DE PELE BASEADA NA QUEDA DE AUTOESTIMA E RODEADA DE PRECONCEITOS......................................................................... 309

AVALIAÇÃO FARMACOLÓGICA DE UM ÓLEO DE CYPERUS ARTICULATUS OBTIDO NO MUNICÍPIO DE SANTARÉM......................................................... 310

COMPROMETIMENTO ORGANIZACIONAL DE VENDEDORES DE CONSÓRCIO AUTOMOBILÍSTICO................................................................................. 311

A FISIOTERAPIA COMO UMA TERAPIA NA BUSCA DO BEM ESTAR FÍSICO DO PACIENTE ONCOLÓGICO INTERNADO NA UNIDADE DE TERAPIA INTENSIVA..
312

SAÚDE DA CRIANÇA: ATUAÇÃO DO PET-SAÚDE/GRADUASUS NO CENTRO DE REFERÊNCIA DA CRIANÇA EM SANTARÉM -PARÁ.................................... 313

A IMPORTÂNCIA DA INTERVENÇÃO FISIOTERAPÊUTICA A NÍVEL PRIMÁRIO NA LER/DORT............................................................................................... 314

PREVALENCIA DE DISTURBIOS OSTEOMIOARTICULARES RELACIONADAS AO TRABALHO EM FISIOTERAPEUTAS............................................................... 315

AVALIAÇÃO CLAREANCE DE CREATININA: UMA REVISÃO BIBLIOGRÁFICA....................................................................................................................... 316

A IMPORTÂNCIA DA ATUAÇÃO FISIOTERAPÊUTICA NA ESCLEROSE LATERAL AMIOTRÓFICA............................................................................................. 317

ASPECTO BIOPSICOSSOCIAL DE CRIANÇAS EM SITUAÇÃO DE RUA................................................................................................................................ 318

ADAPTAÇÃO DE PEIXES AMAZÔNICOS EM AMBIENTE CONTROLADO PARA SEREM UTILIZADOS EM ENSAIOS DE ECOTOXICOLOGIA............................. 319

A LIGA ACADÊMICA DE QUÍMICA DO OESTE DO PARÁ (LIQ) E A SUA ATUAÇÃO NA EDUCAÇÃO BÁSICA....................................................................... 320

A IMPORTÂCIA DA FISIOTERAPIA NO TRATAMENTO E PREVENÇÃO DA INCONTINÊCIA URINÁRIA.................................................................................... 321

11 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A PREVALÊNCIA DE FATORES DE RISCO EM POLICIAIS MILITARES PARA O DESENVOLVIMENTO DE HIPERTENSÃO ARTERIAL SISTÊMICA: UMA REVISÃO DE
LITERATURA..................................................................................................................................................................................................................... 322

AVALIAÇÃO DO CONSUMO DE CONTRACEPTIVOS DE EMERGÊNCIA ENTRE UNIVERSITÁRIAS DE ITAITUBA-PA................................................................ 323

EXPERIMENTO PARA O ENSINO DE CIÊNCIAS NATURAIS PARA AULAS NO ENSINO FUNDAMENTAL II.............................................................................. 324

LEITURA COM LUDICIDADE: ESCOLA ESPAÇO DE APRENDIZAGEM................................................................................................................................. 325

A IMPORTÂNCIA DAS ATIVIDADES LÚDICAS NO PROCESSO ENSINO APRENDIZAGEM.................................................................................................... 326

PERFIL EPIDEMIOLÓGICO DA MORTALIDADE NO MUNICÍPIO DE ALTAMIRA NO PERÍODO DE 2007 A 2016.................................................................... 327

PSICOLOGIA E EDUCAÇÃO EM SAÚDE: RELATO DE EXPERIÊNCIA EM UMA ESCOLA PÚBLICA DE SANTARÉM – PA............................................................ 328

A PESQUISA DE ENTEROPARASITOSES EM MANIPULADORES DE ALIMENTOS COMO INDICADOR HIGIÊNICO EM ESCOLAS DE ENSINO MUNICIPAL E ESTA-
DUAL DE SANTARÉM-PA.................................................................................................................................................................................................. 329

PERFIL EPIDEMIOLÓGICO DE CRIANÇAS VÍTIMAS DE ACIDENTES DOMÉSTICOS EM UMA UNIDADE DE PRONTO ATENDIMENTO 24 HORAS DO MUNICÍPIO
DE SANTARÉM-PA NO PERÍODO DE JANEIRO A MARÇO DE 2016.................................................................................................................................... 330

ANÁLISE DA INFLUÊNCIA DE IDADE EM RELAÇÃO A CONDIÇÃO DA PELE ATRAVÉS DO SKIN UP..................................................................................... 331

A IMPORTÂNCIA DA AVALIAÇÃO PSICOLÓGICA COMO DISCIPLINA CIENTÍFICA............................................................................................................ 332

AVALIAÇÃO DA CAPACIDADE INIBITÓRIA DE ENZIMAS DIGESTIVAS E DE RADICAIS LIVRES POR EXTRATOS DE MICRODESMIA RIGIDA E KALANCHOE PINNA-
TA................................................................................................................................................................................................................................... 333

DETERMINAÇÃO DO CONTEÚDO DE FENÓIS, FLAVONOIDES E CAPACIDADE ANTIOXIDANTE IN VITRO DO EXTRATO ETANÓLICO DE CASCAS DO CAULE
DE CEDRELA SP................................................................................................................................................................................................................ 334

A PERCEPÇÃO DE PACIENTES HIPERTENSOS ACERCA DA ADESÃO AO TRATAMENTO: UMA REVISÃO DA LITERATURA...................................................... 335

O SABER CONSCIENTE POR MEIO DA LIBERDADE........................................................................................................................................................... 336

EFEITOS DA FISIOTERAPIA NO TRATAMENTO DE LINFEDEMA EM PACIENTES SUBMETIDAS À MASTECTOMIA.................................................................... 337

OCORRÊNCIA DE PARASITOS GASTROINTESTINAIS EM LAUDOS COPROPARASITOLÓGICOS DE CÃES (CANIS FAMILIARIS) EM UMA CLÍNICA VETERINÁRIA DO
MUNICÍPIO DE SANTARÉM, PARÁ, BRASIL......................................................................................................................................................................... 338

EFEITOS DO GERADOR DE ALTA FREQUÊNCIA NO TRATAMENTO DE ÚLCERAS POR PRESSÃO – REVISÃO DE LITERATURA................................................ 339

EXTENSÃO UNIVERSITÁRIA: BIOMEDICINA NA COMUNIDADE......................................................................................................................................... 340

(COM) VIVER COM CÂNCER INFÂNTIL: UMA REVISÃO DA LITERATURA............................................................................................................................ 341

ABORDAGEM EXPERIMENTAL SOBRE COMPORTAMENTOS PÍSCEOS PARA ESTUDOS DE TOXICIDADE............................................................................... 342

RADIOLOGIA FORENSE: A UTILIZAÇÃO DE IMAGENS RADIOLÓGICAS NA IDENTIFICAÇÃO DE CADÁVERES.................................................................... 343

INVESTIGAÇÕES FORENSES VOLTADAS PARA O ESTUPRO............................................................................................................................................... 344

CONTRIBUIÇÕES DA TEORIA COGNITIVO COMPORTAMENTAL NO TRATAMENTO DA DEPENDÊNCIA TECNOLÓGICA: REVISÃO BIBLIOGRÁFICA........... 345

PERFIL EPIDEMIOLÓGICO DE PACIENTES COM DESORDENS NEUROLÓGICAS ATENDIDOS EM UM HOSPITAL NO INTERIOR DO PARÁ............................ 346

PERFIL CLÍNICO DE PACIENTES COM DIAGNÓSTICO NEUROLÓGICO SUBMETIDOS A UM PROTOCOLO DE FISIOTERAPIA NO HOSPITAL MUNICIPAL DE
SANTARÉM-PA................................................................................................................................................................................................................. 347

EFEITOS DO USO DE SOLUÇÃO SALINA NA ASPIRAÇÃO ENDOTRAQUEAL..................................................................................................................... 348

INTOXICAÇÃO RELACIONADO AO USO DE PARACETAMOL: REVISÃO DE LITERATURA..................................................................................................... 349

INFLUÊNCIA DE FENÔMENOS METEOROLÓGICOS NAS OPERAÇÕES AÉREAS NO AEROPORTO MUNICIPAL DE ITAITUBA............................................... 350

LER E DORT’S EM PROFISSIONAIS DE FISIOTERAPIA: UMA REVISÃO BIBLIOGRAFICA........................................................................................................ 351

OS EFEITOS DO TRATAMENTO FISIOTERAPÊUTICO EM PACIENTES COM DISTROFIA MUSCULAR DE DUCHENNE............................................................. 352

PERFIL DA QUALIDADE DE VIDA DOS DISCENTES DO BACHARELADO INTERDISCIPINAR EM SAÚDE (BIS), A PARTIR DO ÂMBITO FÍSICO........................... 353

ADIÇÃO DE CINZA DA CASCA DO ARROZ NO CONCRETO............................................................................................................................................ 354

ATUAÇÃO DO FISIOTERAPEUTA NA MOBILIZAÇÃO PRECOCE EM UTI E SEUS BENEFÍCIOS: REVISÃO DE LITERATURA....................................................... 355

ESTUDO DE CASO DAS DIMENSÕES EFETIVAS DOS BLOCOS CERÂMICOS FABRICADOS EM UMA OLARIA NA CIDADE DE SANTARÉM, PARÁ................... 356

DETERMINAÇÃO DE METABÓLITOS SECUNDÁRIOS E AVALIAÇÃO DA ATIVIDADE ANTIMICROBIANA DO EXTRATO DA ABUTA (PLANTA DE USO POPULAR).....
357

O CANTO ESPONTÂNEO DE BEBÊS PARTICIPANTES DE UM PROJETO DE MUSICALIZAÇÃO............................................................................................. 358

12 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

DOENÇA DE CHAGAS: INCIDÊNCIA NO PARÁ................................................................................................................................................................ 359

APPINVENTOR: UMA FERRAMENTA POTENCIAL PARA O ENSINO..................................................................................................................................... 360

LASERTERAPIA DE BAIXA POTÊNCIA NA REPARAÇÃO TECIDUAL EM LESÕES DE PELE OCASIONADAS POR ACIDENTE OFÍDICO........................................ 361

ANÁLISE DA SITUAÇÃO DOS SERVIÇOS DE SAÚDE PÚBLICA EM SANTARÉM-PA................................................................................................................ 362

INFLUENCIA DOS ANTICONCEPCIONAIS HORMONAIS PARA A OCORRÊNCIA DE ISQUEMIA CEREBRAL POR TROMBO: REVISÃO DE LITERATURA........... 363

ESTÁGIO CURRICULAR SUPERVISIONADO: EXPERIÊNCIAS, DESAFIOS E APRENDIZAGENS................................................................................................ 364

INTELIGÊNCIA EMOCIONAL DO ENFERMEIRO DIANTE CUIDADOS PALIATIVOS NA ONCOLOGIA PEDIÁTRICA................................................................ 365

ANÁLISE PRELIMINAR DOS IMPACTOS DE ORDEM SANITÁRIA E AMBIENTAL NO ENTORNO DO LAGO MAPIRI.................................................................. 366

CÂNCER DE CÉLULAS RENAIS EM PACIENTES IDOSOS: UMA REVISÃO DA LITERATURA..................................................................................................... 367

IMPORTÂNCIA DA LIGA ACADÊMICA PARA A FORMAÇÃO PROFISSIONAL: UM RELATO DE EXPERIÊNCIA DE MEMBROS DA LAPSA................................... 368

COBERTURA VACINAL E FATORES QUE A INFLUENCIAM EM PUÉRPERAS ASSISTIDAS EM UM HOSPITAL MUNICIPAL DO ESTADO DO PARÁ....................... 369

INFLUÊNCIA DA CERVICALGIA PERSISTENTE NO CONTROLE MOTOR CERVICAL E EM TESTES CLÍNICOS DE EQUILÍBRIO DE IDOSOS NÃO ATIVOS......... 370

EMPODERAMENTO FEMININO: UM RELATO DE EXPERIÊNCIA COM MULHERES CADASTRADAS NO “CENTRO DE APOIO CLUBE DAS MÃES” NA CIDADE DE
SANTARÉM/PA................................................................................................................................................................................................................. 371

A IMPORTÂNCIA DA FISIOTERAPIA EM PACIENTES COM HERNIA DISCAL LOMBAR: UMA REVISÃO DE LITERATURA........................................................... 372

PERFIL DE ESTILO DE VIDA INDIVIDUAL DE ESTUDANTES DO ENSINO MÉDIO DO PERÍODO NOTURNO MATRICULADOS EM UMA ESCOLA PÚBLICA NA
CIDADE DE SANTRAÉM-PARÁ........................................................................................................................................................................................... 373

ATUAÇÃO DA FISIOTERAPIA EM PACIENTES COM GUILLAIN-BARRÉ: UMA REVISÃO DE LITERATURA.................................................................................. 374

ROBÓTICA APLICADA À EDUCAÇÃO MATEMÁTICA EM ESCOLA DE TEMPO INTEGRAL.................................................................................................... 375

ESTATÍSTICA DE APREENSÕES DE CANNABIS SATIVA LINNEU (MACONHA) NA BR-163 ENTRE AS CIDADES DE SANTARÉM E RURÓPOLIS-PA NO ANO DE
2017.............................................................................................................................................................................................................................. 376

ESTUDO RETROSPECTIVO DAS CALCIFICAÇÕES VISUALIZADAS EM IMAGENS DE TOMOGRAFIA COMPUTADORIZADA DE FEIXE CÔNICO...................... 377

ASSISTÊNCIA PRESTADA NO PRÉ-HOSPITALAR E INTRA – HOSPITALAR AO PACIENTE COM TRAUMA CRÂNIO ENCEFÁLICO.............................................. 378

EDUCAÇÃO NO AMBIENTE ESCOLAR: PROJETO DE ENSINO Á ROBÓTICA UTILIZANDO A FERRAMENTA S4A (SCRATCH PARA ARDUINO)....................... 379

BUSCA ATIVA DE HANSENÍASE: DETECÇÃO DE NOVOS CASOS EM COMUNIDADES RURAIS DO MUNICÍPIO DE BELTERRA-PA, BRASIL............................ 380

ATUAÇÃO FISIOTERAPÊUTICA NOS CUIDADOS PALIATIVOS EM PEDIATRIA...................................................................................................................... 381

A IMPORTÂNCIA DA PROGRAMAÇÃO PARA O DESENVOLVIMENTO EDUCACIONAL........................................................................................................ 382

ABC BRINCANDO NO HRBA: ATENDIMENTO EDUCACIONAL ÀS CRIANÇAS HOSPITALIZADAS........................................................................................ 383

PERFIL EPIDEMIOLÓGICO DO BAIRRO ÁREA VERDE EM SANTARÉM/PARÁ NOS ANOS DE 2015/2016.............................................................................. 384

TUBERCULOSE: MOTIVOS QUE LEVAM AO ABANDONO DO TRATAMENTO..................................................................................................................... 385

ACIDENTES DE MOTO: CUIDADOS DE ENFERMAGEM NA URGÊNCIA EMERGÊNCIA........................................................................................................ 386

ACIDENTES COM PÉRFURO-CORTANTE: PREVALÊNCIA E CONDUTA PÓS ACIDENTES – REVISÃO DE LITERATURA............................................................ 387

FACILITAÇÃO DE CÍRCULOS DE DIÁLOGO: RELATO DE EXPERIÊNCIA.............................................................................................................................. 388

ANÁLISE E IDENTIFICAÇÃO DE INTERAÇÕES MEDICAMENTOSAS EM PRESCRIÇÕES DE PACIENTES DO GRUPO HIPERDIA EM UMA INSTITUIÇÃO DE ENSINO
EM SANTARÉM-PARÁ........................................................................................................................................................................................................ 389

ANALISE FITOQUÍMICA DO EXTRATO ETANÓLICO DO PNEUMUS BOLDUS (BOLDO)....................................................................................................... 390

ENFRENTAMENTO DE MULHERES QUILOMBOLAS DA AMAZÔNIA BRASILEIRA FRENTE À SUSCETIBILIDADE PARA INFECÇÕES SEXUALMENTE TRANSMISSÍVEIS/
HIV/AIDS......................................................................................................................................................................................................................... 391

O ARDUÍNO COMO FERRAMENTA DE ACESSIBILIDADE PARA DEFICIENTES VISUAIS......................................................................................................... 392

IMPORTÂNCIA DA ATIVIDADE FISICA HABITUAL PARA BEM ESTAR DE MULHERES IDOSAS QUE PARTICIPAM DO GRUPÃO DO HIPERDIA EM SANTARÉM-PARÁ..
393

AS TRANSFORMAÇÕES DO TRABALHO DO ENFERMEIRO: INTERFACE COM A GLOBALIZAÇÃO....................................................................................... 394

TOXICIDADE AGUDA DO ÓLEO ESSENCIAL DE CYPERUS ARTICULATUS (PIPRIOCA)......................................................................................................... 395

A RELEVÂNCIA DA ASSISTÊNCIA DE ENFERMAGEM NA PREVENÇÃO DA AUTOMEDICAÇÃO EM IDOSOS......................................................................... 396

MORTE E O PROCESSO DE INDIVIDUAÇÃO: CAMINHOS POSSÍVEIS PARA A AUTORREALIZAÇÃO PSÍQUICA.................................................................... 397

13 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A SÍNDROME DE BURNOUT E O TRABALHO DOCENTE: ANÁLISE DE UM GRUPO DE PROFESSORES................................................................................ 398

AVALIAÇÃO DA TAXA DE FILTRAÇÃO GLOMERULAR DE RIBEIRINHOS COM BASE NA EQUAÇÃO DE COCKCROFT-GAULT............................................... 399

ATIPIA DE CÉLULAS ESCAMOSAS DE SIGNIFICADO INDETERMINADO (ASC-US): REVISÃO LITERÁRIA................................................................................ 400

DIAGNÓSTICO VISUAL DA SITUAÇÃO DO IGARAPÉ URUMARÍ NA CIDADE DE SANTARÉM-PARÁ...................................................................................... 401

IMAGEM CORPORAL NA ADOLESCÊNCIA E SUA RELAÇÃO PARA O DESENCADEAR DE ALGUMAS PSICOPATOLOGIA...................................................... 402

ASSISTÊNCIA DE ENFERMAGEM AO PACIENTE PORTADOR DE LÚPUS ERITEMATOSO SISTÊMICO ACOMETIDO POR COMORBIDADES PULMONARES EM UM
HOSPITAL PÚBLICO NA AMAZÔNIA................................................................................................................................................................................ 403

ANTIDEPRESSIVOS E NEUROGÊNESE: UMA REVISÃO DE LITERATURA............................................................................................................................... 404

A (IN) CONSTITUCIONALIDADE DA EXECUÇÃO PROVISÓRIA DA PENA IMPOSTA AO CONDENADO APÓS O JULGAMENTO DA APELAÇÃO: ANÁLISE DA
CONFORMAÇÃO DO CARÁTER NORMATIVO DO ART. 5°, LVII, DA CF/ 1988 PELO ART. 637 DO CPP............................................................................... 405

ATENÇÃO À SAÚDE EM COMUNIDADES RIBEIRINHAS: AVALIAÇÃO BIOQUÍMICA DE MORADORES DO TAPARÁ GRANDE................................................ 406

APROPRIAÇÕES DO CONSUMO DA MÍDIA NA INFÂNCIA: ACESSO AO YOUTUBE E OS REFLEXOS NAS INTERAÇÕES SOCIAIS NO AMBIENTE ESCOLAR.407

RESSIGNIFICANDO MATERIAIS RECICLÁVEIS: A RELEITURA DA HISTORIA DA COMUNIDADE DE PAJUÇARA E O REUTILIZAR BRINCANDO......................... 408

VISITA TÉCNICA: UMA ANÁLISE DIFERENCIADA SOBRE A EDUCAÇÃO INCLUSIVA NA UNIDADE EDUCACIONAL ESPECIALIZADA DR. JOSÉ TADEU DUARTE
BASTOS - UEES................................................................................................................................................................................................................ 409

ANÁLISE FÍSICO-QUÍMICA E QUALIDADE DA ÁGUA NAS PRAIAS DA ILHA DE MOSQUEIRO: MURUBIRA, MARAÚ E FAROL EM BELÉM-PA.......................... 410

OLHAR ATENTO SOBRE A MORTALIDADE MATERNA: REVISÃO INTEGRATIVA DA LITERATURA............................................................................................ 411

QUEIMADURAS FACIAIS: IDENTIFICAÇÃO DE ALTERAÇÕES OROFACIAIS E EMOCIONAIS............................................................................................... 412

PET-SAÚDE/GRADUASUS: UMA PROPOSTA DE EDUCAÇÃO EM SAÚDE COM O TEMA DE SAÚDE DA MULHER................................................................. 413

REGISTRO BRASILEIRO DE ENSAIOS CLÍNICOS................................................................................................................................................................ 414

EDUCAÇÃO AMBIENTAL E CIDADANIA: UM OLHAR SOBRE O ESPAÇO VIVIDO................................................................................................................ 415

O USO DE FANTOCHES COMO FERRAMENTA DE ENSINO:INCENTIVANDO A LEITURA E FALANDO DE INCLUSÃO......................................................... 416

PREPARAÇÃO DE FORMULAÇÕES CASEIRAS.................................................................................................................................................................... 417

AVALIAR A CORRELAÇÃO DA INGESTA DE ÁGUA COM OS PARÂMETROS DO ANALISADOR COM IMPEDÂNCIA BIOELÉTRICA DA MARCA SKIN UP.......... 418

PERCEPÇÃO DOS PORTADORES DE HIPERTENSÃO ACERCA DO PROGRAMA HIPERDIA NO MUNICÍPIO DE SANTARÉM, PA.............................................. 419

A INFLUÊNCIA DO RÁDIO NO PROCESSO DE URBANIZAÇÃO NO MUNICÍPIO DE SANTARÉM........................................................................................ 420

PROSPECÇÃO DE ACTINOBACTÉRIAS EM SEDIMENTO DE ÁGUA DOCE DO LAGO VERDE, AQUÍFERO ALTER-DO-CHÃO, SANTARÉM-PA......................... 421

LESÕES OSTEOMUSCULARES E A PRÁTICA DE ATIVIDADE FÍSICA: UMA INVESTIGAÇÃO COM PROFESSORES NO MUNICÍPIO DE SANTARÉM................... 422

AÇÃO DE SAÚDE COM MULHERES GESTANTES EM UMA UNIDADE BÁSICA DE SAÚDE NO MUNICÍPIO DE SANTARÉM: UM RELATO DE EXPERIÊNCIA...... 423

A UTILIZAÇÃO DO MÉTODO WATSU NO TRATAMENTO DA FIBROMIALGIA: REVISÃO LITERÁRIA...................................................................................... 424

CARACTERIZAÇÃO DOS PROCEDIMENTOS ANESTÉSICOS MAIS USADAS EM CIRURGIAS VASCULARES............................................................................ 425

VISITA DOMICILIAR A UM PORTADOR DE INCAPACIDADE FÍSICA DECORRENTE DE UM AVE: ESTUDO DE CASO.............................................................. 426

AVALIAÇÃO DA PERCEPÇAO AMBIENTAL DOS DISCENTES DE 6° ANO DO ENSINO FUNDAMENTAL DE DUAS ESCOLAS PÚBLICAS DO MUNICIPIO DE SAN-
TARÉM-PA........................................................................................................................................................................................................................ 427

BIOPROSPECÇÃO DE LIPASES MICROBIANAS PRODUZIDAS POR ACTINOBACTÉRIAS ENDOFÍTICAS DE ESPÉCIES ARBÓREAS DA FLORESTA AMAZÔNICA.428

HABILIDADES SOCIAIS: UMA PROPOSTA PARA O MELHORAMENTO DOS ÍNDICES DE SUCESSO ESCOLAR NO INTERIOR DA AMAZÔNIA........................ 429

VALIDAÇÃO DA FERRAMENTA MOLECULAR “DNA BARCODING” PARA A IDENTIFICAÇÃO DE PEIXES ORNAMENTAIS DA BACIA DO RIO TAPAJÓS............ 430

A IMPORTÂNCIA DO ESTÁGIO CURRICULAR DA LICENCIATURA EM PEDAGOGIA DO IESPES: NA EJA E 4° E 5° NÃO SÓ ENSINO FUNDAMENTAL........... 431

REABILITAÇÃO FISIOTERAPÊUTICA DE ATLETA DE FUTEBOL PROFISSIONAL COM DIAGNÓSTICO CLÍNICO DE LESÃO GRAU II EM ADUTOR LONGO: RELATO
DE CASO........................................................................................................................................................................................................................ 432

DOENÇA EPILÉPTICA COMO FATOR DE RISCO GESTACIONAL: RELATO DE CASO........................................................................................................... 433

HUMANIZAÇÃO PARA O PARTO NORMAL NO INTERIOR DA AMAZÔNIA: PERSPECTIVA E PREPARAÇÃO FISIOTERAPÊUTICA DAS GRÁVIDAS DE ALTER DO
CHÃO-PA........................................................................................................................................................................................................................ 434

ANÁLISE DOS PARÂMETROS CLÍNICOS DE PACIENTES IDOSOS, DIABÉTICOS E HIPERTENSOS ATENDIDOS EM UM LABORATÓRIO ESCOLA DE SANTARÉM –
PARÁ............................................................................................................................................................................................................................... 435

14 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ATIVIDADE FÍSICA PRÉVIA REDUZ O RISCO DE DIÁSTASE DOS MÚSCULOS RETO-ABDOMINAIS (DMRA) ENTRE GESTANTES ATENDIDAS NO CENTRO DE RE-
FERÊNCIA EM SAÚDE DA MULHER EM SANTARÉM-PA?..................................................................................................................................................... 436

ASSISTÊNCIA A GESTANTE DE ALTO RISCO COM DIABETES TIPO II: UM OLHAR DIFERENCIADO NO CUIDADO MATERNO FETAL.................................... 437

EDUCAÇÃO AMBIENTAL PARA PRESERVAÇÃO DE MANANCIAIS URBANOS: AÇÕES DO COMITÊ EM DEFESA DO IGARAPÉ DO URUMARI......................... 438

ANÁLISE DA QUALIDADE DE VIDA DOS DISCENTES DO BACHARELADO INTERDISCIPINAR EM SAÚDE (BIS) A PARTIR DO SUBSTRATO PSICOLÓGICO...... 439

FATORES DE RISCO PARA DOENÇAS CARDIOVASCULARES EM UMA COMUNIDADE RIBEIRINHA DO MUNICÍPIO DE SANTARÉM-PA................................. 440

O CONSELHO ESCOLAR COMO UMA ESTRATÉGIA DE GESTÃO DEMOCRÁTICA............................................................................................................. 441

CLASSIFICAÇÃO DOS RESÍDUOS DO SERVIÇO DE SAÚDE: UMA REVISÃO BIBLIOGRÁFICA.............................................................................................. 442

DIAGNÓSTICO DA QUALIDADE DE VIDA DOS DISCENTES DO BACHARELADO INTERDISCIPINAR EM SAÚDE (BIS) A PARTIR DAS DIMENSÕES SOCIAL E AM-
BIENTAL.......................................................................................................................................................................................................................... 443

RELATO DE EXPERIÊNCIA: PALESTRA SOBRE AUTOESTIMA, BULLYING E AUTOMUTILAÇÃO............................................................................................... 444

PERFIL EPIDEMIOLÓGICO DA LEPTOSPIROSE NO MUNICÍPIO DE SANTARÉM, PARÁ, NO PERÍODO DE 2013 A 2014........................................................ 445

PERFIL CLÍNICO DE ATENÇÃ FARMACÊUTICA: UMA PROPOSTA DE ACOMPANHAMENTO FARMACÊUTICO À BEIRA LEITO EM HOSPITAL PUBLICO NO OESTE
DO PARÁ......................................................................................................................................................................................................................... 446

A EXPERIÊNCIA INSTITUCIONAL DO NÚCLEO DE ACESSIBILIDADE DA UNIVERSIDADE FEDERAL DO OESTE DO PARÁ...................................................... 447

TABAGISMO, DANOS A SAÚDE: REVISAO BIBLIOGRÁFICA............................................................................................................................................... 448

ASPECTOS GERAIS SOBRE O USO E OCUPAÇÃO DO SOLO DO BAIRRO NOVA REPÚBLICA, SANTARÉM-PA..................................................................... 449

ATENÇÃO FARMACÊUTICA: UMA ABORDAGEM SOBRE SEUS CONCEITOS...................................................................................................................... 450

ANÁLISE DE CASOS DE INTERNAÇÕES POR DOENÇAS RESPIRATÓRIAS EM CRIANÇAS DE 0 A 4 ANOS NAS ESTAÇÕES CHUVOSA E MENOS CHUVOSA EM
SANTARÉM – PA, PERÍODO DE 2008 A 2017.................................................................................................................................................................... 451

IMPLANTAÇÃO DO PLANO DE GERENCIAMENTO DE RESÍDUOS DE SERVIÇOS DE SAÚDE EM DUAS FARMACIAS COMERCIAS NA CIDADE DE SANTARÉM-PA-
RÁ................................................................................................................................................................................................................................... 452

TRATAMENTO DA ALOPECIA ANDROGENÉTICA ATRAVÉS DO PEELING CAPILAR Á BASE DE ÁCIDO GLICÓLICO E ASSOCIAÇÕES.................................... 453

O USO DO EPI NO PROCESSO DO CUIDADO COM O PROFISSIONAL DA SAÚDE NO AMBIENTE HOSPITALAR............................................................... 454

CARACTERÍSTICAS EPIDEMIOLÓGICAS DOS PACIENTES HIV POSITIVO ATENDIDOS NO CTA/SAE DE SANTARÉM-PA........................................................ 455

FISIOTERAPIA NO MAL DE PARKINSON............................................................................................................................................................................ 456

EFEITOS FISIOLÓGICOS DO BANHO DE OFURÔ EM NEONATOS PREMATUROS.............................................................................................................. 457

DROGAS DE ABUSO: PRIMEIROS PASSOS DE AÇÕES EXTENSIONISTAS PREVENTIVAS EM UMA ESCOLA DE ENSINO FUNDAMENTAL................................ 458

A FISIOTERAPIA NO TRATAMENTO DE DORES CRÔNICAS................................................................................................................................................ 459

VULNERABILIDADES SOCIAIS DE GRÁVIDAS ADOLESCENTES ATENDIDAS EM UM SERVIÇO DE PRÉ-NATAL DE ALTO RISCO.............................................. 460

DOAÇÃO DE ÓRGÃOS E TECIDOS PARA TRANSPLANTE: PERCEPÇÕES NEGATIVAS DE FAMILIARES QUANTO AO PROCESSO.......................................... 461

ATUAÇÃO DA FISIOTERAPIA NA ENCEFALOPATIA CRÔNICA NÃO-PROGRESSIVA DA INFÂNCIA ATRAVÉS DA FACILITAÇÃO NEUROMUSCULAR PROPRIOCEP-
TIVA................................................................................................................................................................................................................................ 462

CRISES HIPERTENSIVAS: O NÍVEL DE CONHECIMENTO DOS ENFERMEIROS E TÉCNICOS DE ENFERMAGEM QUE ATUAM NA UPA - UNIDADE DE PRONTO
ATENDIMENTO 24 – HORAS............................................................................................................................................................................................ 463

SOCIEDADE E EDUCAÇÃO: UMA RELAÇÃO INTRÍNSECA................................................................................................................................................ 464

PERCEPÇÕES DE ACADÊMICOS DE ENFERMAGEM NO ATENDIMENTO À GESTANTE PRIMIGESTA ACIMA DE 40 ANOS.................................................... 465

ATIVIDADE ANTIMALÁRICA DA KALANCHOE PINNATA SOBRE O PLASMODIUM BERGHI EM MODELO EXPERIMENTAL IN VIVO.......................................... 466

ABORDAGEM FISIOTERAPÊUTICA EM MULHERES PORTADORAS DE VAGINISMO.............................................................................................................. 467

“SITUAÇÃO CONJUGAL”, “OCUPACIONAL” “CARATERÍSTIZAÇÃO DAS RELAÇÕES SEXUAIS” E O HIV NO MUNICIPIO DE SANTARÉM.............................. 468

OS DESAFIOS DA VIDA ACADÊMICA: O PERFIL DOS ACADÊMICOS INGRESSANTES NA EDUCAÇÃO SUPERIOR EM CURSOS DO INSTITUTO ESPERANÇA DE
ENSINO SUPERIOR (IESPES)............................................................................................................................................................................................. 469

ENSINO ATRAVÉS DE TEMAS REGIONAIS: UMA PROPOSTA DE ENSINO DE FÍSICA SOB A CULTURA DO AÇAÍ.................................................................. 470

A EDUCAÇÃO FÍSICA ESCOLAR E ADOÇÃO DE HÁBITOS DE VIDA ATIVA PARA A PREVENÇÃO E NA REDUÇÃO DE FATORES DE RISCO PARA DOENÇAS CAR-
DIOVASCULARES............................................................................................................................................................................................................. 471

PROSPECÇÃO DE ACTINOBACTÉRIAS ENDOFÍTICAS DE PSEUDOBOMBAX MUNGUBA (MART. & ZUCC.) DUGAND, PRODUTORAS DE PROTEASES DE APLICA-
ÇÃO FARMACÊUTICA...................................................................................................................................................................................................... 472

15 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ATENÇÃO FARMACÊUTICA - TEORIA E PRÁTICA: UM DIÁLOGO POSSÍVEL? UMA REVISÃO BIBLIOGRÁFICA...................................................................... 473

ACHADOS AVALIATIVOS SOBRE QUALIDADE DE VIDA INFANTIL...................................................................................................................................... 474

PERFIL EPIDEMIOLÓGICO DA MALÁRIA NO MUNICÍPIO DE ITAITUBA - PARÁ, NO PERÍODO DE 2010 A 2017.................................................................. 475

ASSISTÊNCIA AO PRÉ-NATAL E PREPARO PARA O PARTO: GARANTIA DE DESFECHO FAVORÁVEL?.................................................................................... 476

CARACTERIZAÇÃO DO PERFIL DA MORTALIDADE POR CAUSAS EXTERNAS NO MUNICÍPIO DE ALTAMIRA NO PERÍODO DE 2007 A 2016........................ 477

A LUTA POR DIREITOS NO BAIXO AMAZONAS: RELATO DE EXPERIÊNCIAS EM EDUCAÇÃO POPULAR EM DIREITOS HUMANOS EM JURUTI/PA.................. 478

QUALIDADE MICROBIOLÓGICA DE ÁGUAS MINERAIS: UMA REVISÃO............................................................................................................................. 479

ATENDIMENTO PRESTADO A CRIANÇA COM OVACE (OBSTRUÇÃO DAS VIAS AÉREAS POR CORPO ESTRANHO) NO CENTRO CIRÚRGICO DE HOSPITAL
PÚBLICO DE SANTARÉM-PA............................................................................................................................................................................................. 480

INCIDENCIA DA MÁLARIA............................................................................................................................................................................................... 481

DESENVOLVIMENTO DE UM APLICATIVO PARA APRIMORAR A APRENDIZAGEM DE SEMIOLOGIA MÉDICA NA UNIVERSIDADE DO ESTADO DO PARÁ........ 482

MÉTODO DE PADRONIZAÇÃO DE FOTOGRAFIAS DE LESÃO POR PRESSÃO..................................................................................................................... 483

CIÊNCIA DE DADOS E BIG DATA: UMA ABORDAGEM INTRODUTÓRIA............................................................................................................................. 484

HIDROTERAPIA EM PACIENTES QUE SOFRERAM ACIDENTE VASCULAR CEREBRAL: REVISÃO DE LITERATURA..................................................................... 485

PROPOSTA PARA SUSBSTITUIÇÃO DAS CAPAS DE PASSE ESTUDANTIL POR UM PRODUTO ECOLOGICAMENTE SUSTENTÁVEL A BASE DE FIBRAS DE TUCUMÃ
(ASTROCARYUM VULGARE MART).................................................................................................................................................................................... 486

COMPARTILHAMENTO DE CAPAS DE CARTERINHA E CRACHÁS ATRAVÉS DE REDES SOCIAIS: SOLUCIONANDO UMA PARTE DOS PROBLEMAS DO ACÚMULO
DE PLÁSTICOS NO LIXÃO DO MUNICÍPIO DE SANATRÉM, PARÁ...................................................................................................................................... 487

CRIAÇÃO DE UM FRAMEWORK PARA ANÁLISE DE CICLO DE VIDA DE USINAS FOTOVOLTAICAS...................................................................................... 488

REPRESENTAÇÕES SOCIAIS DE USUÁRIOS DE EQUIPAMENTOS DE ESPORTE E LAZER....................................................................................................... 489

RESUMOS
PREVALÊNCIA DE DESESPERANÇA EM RENAIS CRÔNICOS SUBMETIDOS À HEMODIÁLISE................................................................................................ 490

ATUAÇÃO DO PSICÓLOGO DA SAÚDE NO OESTE DO PARÁ: DESAFIOS E POSSIBILIDADES............................................................................................ 491

ATUAÇÃO DO PSICÓLOGO NA SAÚDE MENTAL DO IDOSO: UM RELATO DE EXPERIÊNCIA DO PROJETO ‘ENVELHE SER’ EM SANTARÉM-PA.................... 492

CLÍNICA ESCOLA DE PSICOLOGIA E A IMPRESCINDÍVEL ATUAÇÃO DO ACADÊMICO NO ESTÁGIO PROFISSIONAL: UM RELATO DE EXPERIÊNCIA DE ACADÊ-
MICOS DA CIDADE DE SANTARÉM-PA............................................................................................................................................................................. 493

SAÚDE DO IDOSO: INTERVENÇÕES DA PSICOLOGIA HOSPITALAR NA CLÍNICA CIRÚRGICA........................................................................................... 494

SEXUALIDADE, GÊNERO, CIDADANIA E A PSICOLOGIA: IMPORTÂNCIA DE ABORDAR A TEMÁTICA EM ESCOLAS DO MUNICÍPIO DE SANTARÉM-PA........ 495

O USO DO IMPERATIVO NO PORTUGUÊS FALADO SANTARENO: ANÁLISE DE NARRATIVAS DE EXPERIÊNCIA PESSOAL.................................................... 496

PSICOLOGIA AMBIENTAL: UM RELATO DE EXPERIÊNCIA COM CRIANÇAS DO PROJETO SEMENTES MUSICAIS NO MUNICÍPIO DE SANTARÉM-PA............. 497

TRANSTORNO DO PÂNICO: CAUSA, SINTOMATOLOGIA E TRATAMENTO........................................................................................................................ 498

ESTUDO FARMACOECONÔMICO COM PACIENTES ORTOPÉDICOS DA CLÍNICA MÉDICA DO HOSPITAL REGIONAL DO BAIXO AMAZONAS................... 499

A IMPORTANCIA DO PROGRAMA NACIONAL DE IMUNIZAÇÃO PARA EQUIPE DE ENFERMAGEM NA SALA DE VACINAÇÃO............................................. 500

TOXOPLASMOSE: TRANSTORNOS FÍSICOS E MENTAIS EM GESTANTES E CRIANÇAS RECÉM NASCIDAS............................................................................ 501

AS INFLUÊNCIAS DO PADRÃO DE MASCULINIDADE IMPOSTO PELA SOCIEDADE NA DINÂMICA PSÍQUICA DOS HOMENS: UM PANORAMA COGNITIVO-
-COMPORTAMENTAL COM CONTRIBUIÇÕES DA PSICOLOGIA DO DESENVOLVIMENTO A PARTIR DA TERCEIRA INFÂNCIA............................................. 502

O PROVIMENTO DA AUTOCOMPAIXÃO NO AUXÍLIO DO TRATAMENTO DO TRANSTORNO DE ANSIEDADE GENERALIZADA: UMA PERSPECTIVA DA TERAPIA
COGNITIVO-COMPORTAMENTAL................................................................................................................................................................................... 503

NEOPLASIA NA TIREÓIDE: MALEFÍCIOS CAUSADOS AOS FAMILIARES DE PACIENTES EM TRATAMENTO COM IODOTERAPIA............................................ 504

O PERCENTUAL E OS PRINCIPAIS ERROS ANALÍTICOS NO COTIDIANO LABORATORIAL................................................................................................... 505

PERFIL DOS SURDOS ACADÊMICOS DOS CURSOS DE GRADUAÇÃO DAS INSTITUIÇÕES DE ENSINO SUPERIOR DE SANTARÉM – PARÁ........................... 506

MUCOSITE ORAL INDUZIDA POR TRATAMENTO ANTINEOPLÁSICO E O USO DE LASER PARA O SEU TRATAMENTO - REVISÃO DA LITERATURA................. 507

INCIDÊNCIA DE CASOS DE SÍFILIS NO BRASIL................................................................................................................................................................. 508

ANÁLISE DO NÚMERO DE ÓBITOS POR CÂNCER DE MAMA NA REGIÃO NORTE DO BRASIL NO PERÍODO DE 2012 A 2015 E A EXPECTATIVA PARA 2018.....
509

16 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A TAXA DE MORTALIDADE POR CÂNCER DE PULMÕES E BRÔNQUIOS NA REGIÃO NORTE DO BRASIL NO PERÍODO DE 2012 A 2015 E SUA ESTIMATIVA PARA
2018.............................................................................................................................................................................................................................. 510

PSICOLOGIA SOCIAL: A IMPRESCINDÍVEL ATUAÇÃO DO PSICÓLOGO EM CENTROS ESPECIALIZADOS ASSISTÊNCIA SOCIAL - CREAS............................ 511

METAPLASIA: UMA ABORDAGEM HISTOLÓGICA.............................................................................................................................................................. 512

MONITORIA EM PSICOLOGIA: UMA EXPERIÊNCIA ACADÊMICA NO LABORATÓRIO DE PSICOLOGIA EXPERIMENTAL........................................................ 514

DO JOGO DA VELHA A REALIDADE VIRTUAL NOS GAMES: COMO A TECNOLOGIA TEM AUXILIADO NA EDUCAÇÃO..................................................... 515

ATUAÇÃO DO PSICOLOGO NA UNIDADE BÁSICA DE SAÚDE: UM RELATO DE EXPERIÊNCIA DE ESTÁGIO CURRICULAR EM SANTARÉM – PARÁ................ 516

RELAÇÃO HOMEM X CELULAR: DO ADEQUADO AO PATOLÓGICO................................................................................................................................ 517

A IMPORTÂNCIA DO LÚDICO NA RECUPERAÇÃO DE CRIANÇAS HOSPITALIZADAS......................................................................................................... 518

REDES SOCIAIS: UM NOVO JEITO DE COMUNICAÇÃO NA SOCIEDADE ATUAL.............................................................................................................. 519

PERFIL SOCIODEMOGRÁFICO DE PACIENTES INTERNADAS EM UTI MATERNA POR COMPLICAÇÕES OBSTÉTRICAS EM UMA MATERNIDADE PÚBLICA NO
AMAZONAS.................................................................................................................................................................................................................... 520

PREVALÊNCIA DE RETINOBLASTOMA NO MUNICÍPIO DE SANTARÉM-PARÁ NO ANO DE 2017......................................................................................... 521

AS VANTAGENS DA ESTRATÉGIA SAÚDE DA FAMÍLIA NA ATENÇÃO PRIMÁRIA À SAÚDE.................................................................................................... 522

PSICOLOGIA HOSPITALAR: O LUTO ENFRENTADO PELO PSICÓLOGO DIANTE A MORTE DE UM PACIENTE..................................................................... 523

A IMPORTÂNCIA DA ICTIOFAUNA AMAZÔNICA.............................................................................................................................................................. 524

VIVÊNCIAS E EXPERIÊNCIAS NO ESTÁGIO: CAMPO EDUCACIONAL DO ENSINO FUNDAMENTAL E EJA COMO APRENDIZAGEM PARA O FUTURO PEDAGO-
GO................................................................................................................................................................................................................................. 525

O DESPERDÍCIO DA PRODUÇÃO AGRÍCOLA NA ASSOCIAÇÃO DOS PRODUTORES RURAIS DE SANTARÉM – APRUSAN, MERCADÃO 2000..................... 526

A IMPORTÂNCIA DE AÇÕES SOCIAIS EM ASILOS PARA PROPORCIONAR AFETO.............................................................................................................. 527

O PAPEL DA METODOLOGIA CIENTÍFICA PARA O DESENVOLVIMENTO CRÍTICO-CONSTRUTIVO DO ACADÊMICO NO ENSINO SUPERIOR..................... 528

VIOLÊNCIA DOMÉSTICA: UM ESTUDO ACERCA DA PREVALÊNCIA DA VIOLÊNCIA EM MULHERES NEGRAS...................................................................... 529

SALA DE AULA COMO RECURSO DIDÁTICO................................................................................................................................................................... 530

FALANDO DE INCLUSÃO PARA CRIANÇAS: USO DE FANTOCHES COMO FERRAMENTA DE ENSINO................................................................................ 531

BIOMEDICINA E A SAÚDE ALIMENTAR............................................................................................................................................................................. 532

GRAVIDEZ NA ADOLESCÊNCIA: UM RELATO DE EXPERIÊNCIA ATRAVÉS DE UMA AÇÃO DO CRAS VOLANTE NO OESTE DO PARÁ................................... 533

GINÁSTICA LABORAL NA PREVENÇÃO E MELHORA DAS LER/DORT................................................................................................................................. 534

FISIOTERAPIA NO LÚPUS ERITEMATOSO SISTÊMICO........................................................................................................................................................ 535

AS CONSEQUÊNCIAS PSICOLÓGICAS DO ABUSO SEXUAL INFANTIL.............................................................................................................................. 536

POVOS TRADICIONAIS DA AMAZÔNIA: UM RELATO DE EXPERIÊNCIA DA CASA DE SAÚDE INDÍGENA – CASAI NO MUNICÍPIO DE SANTARÉM-PA........... 537

O DESCARTE CORRETO DAS PELÍCULAS RADIOGRÁFICAS.............................................................................................................................................. 538

A CONTRIBUIÇÃO DOS TEÓRICOS DA ANTIGUIDADE: OS SOFISTAS NO CURSO DE PEDAGOGIA.¹............................................................................... 539

A FORMAÇÃO DA CARTEIRA DE INVESTIMENTOS DO INVESTIDOR PRIVADO................................................................................................................... 540

REAÇÃO HANSÊNICA À POLIQUIMIOTERAPIA PAUCIBACILAR (PQT/PB): ESTUDO DE CASO EM PACIENTE DE UM MUNICIPIO DO TAPAJÓS, BRASIL........ 541

MEDIAÇÃO COMUNITÁRIA E A CONEXÃO COM O SERVIÇO SOCIAL: A INTERVENÇÃO PROFISSIONAL PARA O EMPODERAMENTO SOCIAL.................. 542

COMPARAÇÃO ENTRE A MAGNETOENCEFALOGRAFIA E ELETROENCEFALOGRAFIA DUAS FORMAS DE NEUROIMAGEM CAPAZ DE MEDIR A ATIVIDADE CE-
REBRAL: UMA REVISÃO LITERÁRIA.................................................................................................................................................................................... 543

AVALIAÇÃO DOS MÉTODOS DE DIAGNÓSTICO DA NEFROLITÍASE: REVISÃO DA LITERATURA.......................................................................................... 544

LUTO DO FILHO PERFEITO: ASPECTOS PSÍQUICOS DOS PAIS AO NASCIMENTO DE UM FILHO DEFICIENTE.................................................................... 545

ESTÁGIO CURRICULAR SUPERVISIONADO: A RELAÇÃO TEORIA E PRÁTICA NO “CHÃO DA ESCOLA”............................................................................... 546

LUDICIDADE APLICADA À EDUCAÇÃO DE CRIANÇAS COM NECESSIDADES EDUCACIONAIS ESPECIAIS.......................................................................... 547

A CATEQUESE E A EDUCAÇÃO JESUÍTICA NO GRÃO-PARÁ............................................................................................................................................. 548

NEUROTRAUMA E PLASTICIDADE CEREBRAL.................................................................................................................................................................... 549

CARACTERIZAÇÃO MORFOMÉTRICA DA CABEÇA DE BOTHROPS ATROX: ASPECTOS COMPARATIVOS ENTRE ESPÉCIMES DE VÁRZEA E TERRA FIRME........ 550

17 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

SAÚDE DA MULHER NO BRASIL: ANÁLISE DA MORTALIDADE MATERNA POR DOENÇAS HIPERTENSIVAS ESPECÍFICAS DA GRAVIDEZ EM 2015.................. 551

O USO DE PRAGUICIDAS DOMISSANITÁRIOS: RISCOS A SAUDE..................................................................................................................................... 552

FORMAÇÃO ACADÊMICA EM EDUCAÇÃO FÍSICA PARA ATUAÇÃO PROFISSIONAL NO CAMPO DA SAÚDE...................................................................... 553

EDUCAÇÃO PARA A VIDA: NOÇÕES SOBRE A EDUCAÇÃO AMBIENTAL (EA) COM ALUNOS EM SANTARÉM-PA................................................................ 554

EDUCAÇÃO E MEIO AMBIENTE: A IMPORTÂNCIA DA EDUCAÇÃO AMBIENTAL COMO TEMA TRANSVERSAL NA SALA DE AULA........................................ 555

VINCULO MÃE E FILHO: UM OLHAR PSICANALÍTICO DAS CONSEQUÊNCIAS DA GRAVIDEZ CONTURBADA NAS PRIMEIRAS FASES DO DESENVOLVIMENTO
DA CRIANÇA................................................................................................................................................................................................................... 556

INCIDÊNCIA DE LEISHMANIOSE TEGUMENTAR AMERICANA NO MUNICÍPIO DE SANTARÉM-PARÁ NO PERÍODO DE 2013 A 2015.................................. 557

A CONSTRUÇÃO DA PERSONALIDADE: UMA ANÁLISE A PARTIR DA VISÃO DE D. W. WINNICOTT.................................................................................... 558

HANSENÍASE E SUA FORMA DE CONTÁGIO.................................................................................................................................................................... 559

ECTOPARASITAS (ACARI: IXODIDAE) DE BOTHROPS TAENIATUS: DESCRIÇÃO DE CASO.................................................................................................. 560

CORRELAÇÃO CRUZADA ENTRE MALÁRIA E PRECIPITAÇÃO PLUVIAL EM SANTARÉM - PA, NO PERÍODO DE 2000 A 2017................................................ 561

OCORRÊNCIA DE STRONGYLOIDES SPP. (NEMATODA, STRONGYLOIDIDAE) EM SERPENTES DE CATIVEIRO...................................................................... 562

NÍVEIS DE CARGA PROVIRAL EM PORTADORES DE HTLV-1 COM DIFERENTES CONDIÇÕES DE COMPROMETIMENTO NEUROLÓGICO........................... 563

ROBOTICA EDUCACIONAL: O USO DE TECNOLOGIAS ALIADAS AO ENSINO-APRENDIZAGEM....................................................................................... 564

PERFIL DE PACIENTES RENAIS CRÔNICOS ATENDIDOS NA CLÍNICA DE HEMODIÁLISE DO HOSPITAL MUNICIPAL DE SANTARÉM..................................... 565

DISLIPIDEMIAS EM PACIENTES ATENDIDOS EM UMA UNIDADE DE SAÚDE DE SANTARÉM, PARÁ, BRASIL........................................................................... 566

SETAS: SENSOR DE TEMPERATURA PARA AMBIENTES DE SERVIDORES............................................................................................................................... 567

RESUMO SOBRE AULA DE PSICOMOTRICIDADE: 4º SEMESTRE DE PEDAGOGIA-INSTITUTO ESPERANÇA DE ENSINO SUPERIOR-IESPES............................. 568

O IMPACTO DA DOENÇA CELÍACA NA SAÚDE E NA QUALIDADE DE VIDA DE ADULTOS................................................................................................. 569

O TRAJETO DO INDIVÍDUO AMPUTADO DO PÓS-CIRÚRGICO À REABILITAÇÃO............................................................................................................. 570

IMPORTANCIA DA TOMOGRAFIA COMPUTADORIZADA NA RADIOTERAPIA...................................................................................................................... 571

RESSONÂNCIA MAGNÉTICA FETAL COMO EXAME COMPLEMENTAR NA OBSTETRÍCIA: REVISÃO BIBLIOGRÁFICA............................................................ 572

ATUAÇÃO E FORMAÇÃO DO TRADUTOR & INTERPRETE DE LIBRAS: CONCEPÇÃO DOS ALUNOS DO CURSO DE LIBRAS BÁSICO DO IFPA – CAMPUS SANTA-
RÉM................................................................................................................................................................................................................................ 573

MEIOS DE CONTRASTES IODADOS USADOS EM TOMOGRAFIA COMPUTADORIZADA: REVISÃO BIBLIOGRÁFICA............................................................ 574

PERFIL E ATUAÇÃO PROFISSIONAL DOS SURDOS EGRESSOS DO ENSINO SUPERIOR DE SANTARÉM-PA........................................................................... 575

AS PRÁTICAS RESTAURATIVAS EM INTERFACE COM O SERVIÇO SOCIAL: O USO DE NOVAS FERRAMENTAS NA INTERVENÇÃO PROFISSIONAL................ 576

TIPOS DE STENTS CORONÁRIOS..................................................................................................................................................................................... 577

O SUPORTE FAMILIAR AO ENVELHECIMENTO E A CONEXÃO COM O SERVIÇO SOCIAL: A MEDIAÇÃO PROFISSIONAL PARA GARANTIA DE DIREITOS..... 578

PRECEPTORIA DE ENFERMAGEM EM SAÚDE MENTAL E A INTEGRAÇÃO EM ENSINO EM SERVIÇO: RELATO DE EXPERIÊNCIA............................................ 579

EMPREENDEDORAS DO FUTURO - UMA EXPERIENCIA EXTENSIONISTA............................................................................................................................ 580

IMPLANTAÇÃO DE SOFTWARE DE GERENCIAMENTO DE PROCESSOS DOS REGISTROS DE ANIMAIS DO LABORATÓRIO DE PESQUISAS ZOOLÓGICAS DA
UNAMA - FACULDADE DA AMAZÔNIA............................................................................................................................................................................ 581

ESTUDOS DE MICROORGANISMOS NAS ESTRUTURAS INTERNAS DO PRÉDIO DA FACULDADE DE ITAITUBA – FAI, EM 2017............................................ 582

A INFOINCLUSÃO DE ALUNOS SURDOS NA EDUCAÇÃO DE JOVENS E ADULTOS DO CENTRO ESTADUAL DE EDUCAÇÃO BÁSICA PARA JOVENS E ADULTOS
(CEEBJA)......................................................................................................................................................................................................................... 583

CRIANÇAS/ADOLESCENTES E A PRÁTICA DE ARTES MARCIAIS/LUTAS............................................................................................................................... 584

REGISTRO DE PREDAÇÃO DE HEROS NOTATUS (PERCIFORMES: CICHLIDAE) POR EUNECTES MURINUS: RELATO DE CASO.............................................. 585

OS ASPECTOS PSICOLÓGICOS PRESENTES NAS FAMÍLIAS DE DEPENDENTES QUÍMICOS................................................................................................ 586

INCIDÊNCIA DA SÍNDROME DE BURNOUT EM DOCENTES DO ENSINO SUPERIOR NO BRASIL........................................................................................ 587

FATORES GERADORES DE RESULTADOS FALSO-POSITIVOS EM EXAMES DE HIV E SUAS COMPLICAÇÕES JUDICIAIS......................................................... 588

DIABETES MELLITUS: COMPLICAÇÕES QUE ACOMETEM PACIENTES DIABÉTICOS ACOMPANHADOS NO PROGRAMA HIPERDIA DA ESTRATÉGIA SAÚDE DA
FAMÍLIA DO BAIRRO SANTARENZINHO............................................................................................................................................................................ 589

18 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AS CONTRIBUIÇÕES DA CANTIGA DE RODA NO PROCESSO DE ENSINO NA EDUCAÇÃO INFANTIL.............................................................................. 590

A HUMANIZAÇÃO NA ASSISTÊNCIA DE ENFERMAGEM EM UM HOSPITAL PÚBLICO NO OESTE DO PARÁ: RELATO DE EXPERIÊNCIA................................. 591

HIDROTERAPIA NA PREVENÇÃO DE QUEDAS EM IDOSOS............................................................................................................................................... 592

TRATAMENTO FISIOTERAPÊUTICO NA DOR LOMBAR CRÔNICA....................................................................................................................................... 593

MUSICOTERAPIA APLICADA À REABILITAÇÃO DE ENCEFALOPATIA CRÔNICA NÃO PROGRESSIVA DA INFÂNCIA............................................................... 594

TRATAMENTO HIDROTERÁPICO EM CRIANÇAS PORTADORAS DE SÍNDROME DE DOWN................................................................................................. 595

SÍNDROME DE MOEBIUS: RELATO DE CASO CLÍNICO..................................................................................................................................................... 596

O ESTÁGIO NA FORMAÇÃO ACADÊMICA: UMA AÇÃO NECESSÁRIA E UMA BUSCA CONSTANTE DE CONHECIMENTOS................................................ 597

ATUAÇÃO FISIOTERAPÊUTICA NO TRABALHO DE PARTO................................................................................................................................................. 598

A IMPORTÂNCIA DA INTERVENÇÃO FISIOTERAPÊUTICA EM PACIENTES COM ENCEFALOPATIA CRÔNICA NÃO PROGRESSIVA DA INFÂNCIA DO TIPO ESPÁS-
TICA............................................................................................................................................................................................................................... 599

LASETERAPIA NO PROCESSO DA CICATRIZAÇÃO DE ULCERAS POR PRESSÃO.................................................................................................................. 600

O USO DA FACILITAÇÃO NEUROMUSCULAR PROPRIOCEPTIVA NO TRATAMENTO DE PACIENTES COM AVC................................................................... 601

SÍNDROME DE BURNOUT: ASPECTOS CLÍNICOS E PSICOSSOCIAIS................................................................................................................................. 602

O ESTÁGIO CURRICULAR SUPERVISIONADO NA CONSTRUÇÃO PROFISSIONAL DO ACADÊMICO DE PEDAGOGIA........................................................ 603

TRANSTORNO DE ANSIEDADE GENERALIZADA: ASPECTOS CLÍNICOS, FÍSICOS E PSICOLÓGICOS.................................................................................. 604

EMPREENDEDORISMO: UM ESTUDO NA EMPRESA “TERA” NA PERCEPÇÃO DO PROPRIETÁRIO........................................................................................ 605

QUALIDADE NO ATENDIMENTO: UM ESTUDO NA EMPRESA M.E.M. LDTA EM SANTARÉM-PA NA VISÃO DOS CLIENTES EXTERNOS.................................. 606

INTERFERÊNCIAS PRÉ-ANALÍTICAS DOS EXAMES DE UROCULTURAS REALIZADOS NUM LABORATÓRIO DE ANÁLISES CLÍNICAS EM SANTARÉM-PA........... 607

AVALIAÇÃO DOS EFEITOS HIPOGLICÊMICOS E HIPOLIPÊMICOS DE IPOMOEA BATATAS (L.) LAM EM RATOS DA LINHAGEM WISTAR TRATADOS COM DIETA DE
CAFETERIA...................................................................................................................................................................................................................... 608

A IMPORTÂNCIA DO TEATRO NA ESCOLA....................................................................................................................................................................... 609

A ATUAÇÃO DA FISIOTERAPIA RESPIRATÓRIA EM PACIENTES COM ESCLEROSE LATERAL AMIOTRÓFICA........................................................................... 610

ANÁLISE SOBRE O ACUMULO DO LIXO URBANO, EM DECORRÊNCIA DO AUMENTO DA POPULAÇÃO........................................................................... 611

A IMPORTÂNCIA DA DISCIPLINA DE METODOLOGIA CIENTÍFICA NO ENSINO SUPERIOR................................................................................................ 612

O ESTÁGIO CURRICULAR SUPERVISIONADO E DUAS REALIDADES DE ESCOLAS MUNICIPAL E ESTADUAL EM SANTARÉM-PA............................................ 613

ESCOLA INCLUSIVA: VENCENDO OS DESAFIOS NO ENSINO E APRENDIZAGEM DOS ALUNOS DA EJA (EDUCAÇÃO DE JOVENS E ADULTOS)................ 614

OCS – UMA SOLUÇÃO PARA GERENCIAMENTO DE T.I. EM MICRO E PEQUENAS EMPRESAS............................................................................................ 615

A PERCEPÇÃO DOS ACOMPANHANTES DAS CRIANÇAS A RESPEITO DO PROGRAMA DE CRESCIMENTO E DESENVOLVIMENTO...................................... 616

DESAFIOS DA DOCÊNCIA NA EDUCAÇÃO DE JOVENS E ADULTOS COM ALUNOS INCLUSOS: EXPERIÊNCIAS EM ESTÁGIO CURRICULAR SUPERVISIONA-
DO................................................................................................................................................................................................................................. 617

UNIDADE DE TERAPIA INTENSIVA NEONATAL: A IMPORTÂNCIA DO VÍNCULO FAMILIAR PARA A RECUPERAÇÃO DA SAÚDE DO RECÉM........................... 618

BIOSSEGURANÇA: SUA IMPORTÂNCIA CONTRA OS RISCOS BIOLÓGICOS..................................................................................................................... 619

A ATUAÇÃO DA FISIOTERAPIA DESPORTIVA NA PREVENÇÃO DE LESÕES QUE OCORREM NO FUTEBOL.......................................................................... 620

LER É IMPORTANTE, APRENDER É ESSENCIAL, MAS SABER INTERPRETAR É FUNDAMENTAL................................................................................................ 621

A IMPORTÂNCIA DO PROFISSIONAL ADMINISTRADOR NAS EMPRESAS............................................................................................................................ 622

PRIVACIDADE NA ERA DAS REDES SOCIAIS: O ESCÂNDALO ENVOLVENDO O FACEBOOK.............................................................................................. 623

ASPECTOS DA PRODUÇÃO CIENTÍFICA – QUESTIONAMENTO E INDAGAÇÃO – E A CONVICÇÃO DO PESQUISADOR COMO EQUÍVOCO DA PESQUISA....
624

APRENDER BRINCANDO: PRÁTICA NECESSÁRIA À EDUCAÇÃO INFANTIL......................................................................................................................... 625

A TAXA DE MORTALIDADE POR LEUCEMIA ENTRE 2012 E 2015 E SUA ESTIMATIVA PARA O ANO DE 2018 NA REGIÃO NORTE......................................... 626

A ATUAÇÃO DO FISIOTERAPEUTA NA REDUÇÃO DOS AGRAVOS DA DOENÇA PULMONAR OBSTRUTICA CRÔNICA (DPOC): REVISÃO DE LITERATURA.627

ASSOCIAÇÃO DE PLANTA MEDICINAL HIPOGLIGEMIANTE COM ANTIDIABÉTICO ORAL SOBRE OS NÍVEIS GLICÊMICOS: UMA REVISÃO LITERÁRIA......... 628

19 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO DE ÁCIDO TARTÁRICO EM VINHO PRODUZIDO NO LABORATÓRIO DE FARMACOGNOSIA DO IESPES......................................................... 629

ANÁLISE DA EFICÁCIA DOS MÉTODOS DE APLICAÇÃO DA BANDAGEM GESSADA NA REDUÇÃO DE MEDIDAS CORPORAIS............................................ 630

A IMPORTÂNCIA DA LEITURA NO PROCESSO DE HUMANIZAÇÃO PARA PACIENTES DO HRBA......................................................................................... 631

A ATUAÇÃO DO FISIOTERAPEUTA DERMATOFUNCIONAL EM PACIENTE QUEIMADOS..................................................................................................... 632

FORMAÇÃO E PRÁTICAS PEDAGÓGICAS DE PROFESSORAS EXPERIENTES DE UMA ESCOLA DA REDE MUNICIPAL DE SANTARÉM..................................... 633

EVENTOS ADVERSOS ADQUIRIDOS EM TRANSOPERATÓRIO RESULTANTES DO INADEQUADO POSICIONAMENTO CIRÚRGICO: UMA REVISÃO DA LITERATU-
RA................................................................................................................................................................................................................................... 634

FATORES QUE COLABORAM AO NÃO USO DO PRESERVATIVO FEMININO...................................................................................................................... 635

A IMAGINAÇÃO E A CRIATIVIDADE DA CRIANÇA ATRAVÉS DA ARTE................................................................................................................................. 636

ATIVIDADE LÚDICA UM ENCONTRO AO AR LIVRE: RELATO DE EXPERIÊNCIA.................................................................................................................... 637

..................................................................................................................................................................................................................................... 637

METODOLOGIA DA PROBLEMATIZAÇÃO: DIÁLOGO ATIVO COM O ARCO DE MAGUEREZ NO CURSO DE PEDAGOGIA – SANTARÉM/BRASIL................. 638

A EDUCAÇÃO DE CRIANÇAS, JOVENS E ADULTOS NO MUNICÍPIO DE SANTARÉM – PARÁ: VIVÊNCIAS NO ESTÁGIO CURRICULAR SUPERVISIONADO DO
CURSO DE PEDAGOGIA DO IESPES................................................................................................................................................................................ 639

AÇÕES DE SAÚDE DIRECIONADAS A IDOSAS PARTICIPANTES DE GRUPÃO DE HIPERTENSOS E DIABÉTICOS: UM RELATO DE EXPERIÊNCIA...................... 640

ESCOLA TÉCNICA DO SUS DO PARÁ – ETSUS: OLHAR ATENTO A INTERIORIZAÇÃO DA FORMAÇÃO PROFISSIONAL NA AMAZÔNIA.............................. 641

PERFIL DOS FATORES DE RISCO PARA DOENÇAS CRÔNICAS NÃO-TRANSMISSÍVEIS EM ESCOLARES DA ZONA URBANA E RURAL NA CIDADE DE SANTARÉM,
PARÁ............................................................................................................................................................................................................................... 642

FUNDO DE MANUTENÇÃO E DESENVOLVIMENTO DA EDUCAÇÃO BÁSICA E DE VALORIZAÇÃO DOS PROFISSIONAIS DA EDUCAÇÃO- FUNDEB........... 643

AÇÕES DE ENFERMAGEM NO DESMAME DA VENTILAÇÃO MECÂNICA INVASIVA NA UTI: UMA REVISÃO INTEGRATIVA DA LITERATURA........................... 644

EQUIPE MULTIPROFISSIONAL DA UNIDADE DE TERAPIA INTENSIVA PEDIÁTRICA DE UM HOSPITAL DO OESTE DO PARÁ: PERFIL SOCIODEMOGRÁFICO E
QUALIFICAÇÃO PROFISSIONAL...................................................................................................................................................................................... 645

A ETIOLOGIA DO CANCER DA CAVIDADE ORAL NA REGIÃO NORTE.............................................................................................................................. 646

A CORRELAÇÃO ENTRE HIPOTIREOIDISMO E A DEPRESSÃO............................................................................................................................................ 647

ESTIMATIVAS DE NOVOS CASOS DE CÂNCER NO ESÔFAGO EM 2018........................................................................................................................... 648

LIGAS ACADÊMICAS EM SAÚDE: O ELO UNIVERSIDADE-COMUNIDADE-EDUCAÇÃO INFANTIL....................................................................................... 649

PROTOCOLO DE MANCHESTER: RELATO DE EXPERIÊNCIA DA SUA IMPLEMENTAÇÃO NO SETOR DE URGÊNCIA E EMERGÊNCIA DE EM UM HOSPITAL PÚBLI-
CO DO OESTE DO PARÁ................................................................................................................................................................................................. 650

REPERCUSÕES ANATÔMICAS DECORRENTES DAS ALTERAÇÕES DO ARCO PLANTAR....................................................................................................... 651

AVALIAÇÃO DO GRAU DE OLEOSIDADE CUTÂNEA POR MEIO DA IMPEDÂNCIA BIOELÉTRICA EM ADOLESCENTES......................................................... 652

LUDICIDADE NA CONSTRUÇÃO DE HÁBITOS ALIMENTARES SAUDÁVEIS: RELATO DE EXPERIÊNCIA NA EDUCAÇÃO INFANTIL.......................................... 653

OBESIDADE E FAIXA ETÁRIA COMO FATORES DE RISCO PARA A DOENÇA HIPERTENSIVA ESPECÍFICA DA GESTAÇÃO (DHEG), UMA REVISÃO DE LITERATU-
RA.................................................................................................................................................................................................................................. 654

PROJETO EDUCAÇÃO AMBIENTAL E O EXERCÍCIO PARA CIDADANIA: RESPONSABILDADE SOCIAL EM AÇÃO.................................................................. 655

EFEITOS ADVERSOS DA RADIOTERAPIA............................................................................................................................................................................ 656

O MANEJO DO PRÉ-NATAL NA PREVENÇÃO E CONTROLE DA DHEG.............................................................................................................................. 657

TUBERCULOSE NAS POPULAÇÕES INDÍGENAS DA AMAZÔNIA: UMA REVISÃO DE LITERATURA....................................................................................... 658

ANGIOGRAFIA TORÁCICA.............................................................................................................................................................................................. 659

OCORRÊNCIA DE CURETAGEM UTERINA EM UM HOSPITAL PÚBLICO DE SANTARÉM....................................................................................................... 660

EFEITOS DA FISIOTERAPIA NA DIMINUIÇÃO DA ESPASTICIDADE E AUMENTO DA FLEXIBILIDADE NO TRAUMATISMO RAQUIMEDULAR: ESTUDO DE CASO.....
661

ESCRITORES NEGROS: ENFRENTAMENTOS E DESAFIOS NA BUSCA POR ESPAÇOS NA LITERATURA BRASILEIRA................................................................ 663

FORMAÇÃO PROFISSIONAL E CONTINUADA DE CUIDADORES DE ABRIGOS.................................................................................................................. 664

ALEITAMENTO MATERNO: A IMPORTÂNCIA DO PROCESSO DE AMAMENTAÇÃO NA FORMAÇÃO PSÍQUICA DA CRIANÇA.............................................. 666

MEGAÊSOFAGO: UMA REVISÃO...................................................................................................................................................................................... 667

20 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

EDUCAÇÃO EM SAÚDE: PROMOVENDO QUALIDADE DE VIDA NA COMUNIDADE.......................................................................................................... 668

IMPLANTAÇÃO DE BANDA LARGA PARA PEQUENOS MUNICÍPIOS ATRAVÉS DE ENLACES PONTO A PONTO VIA RÁDIOS DIGITAIS................................... 669

PREVALÊNCIA DO CÂNCER DE PROSTATA NO BRASIL...................................................................................................................................................... 670

TRANSTORNOS PSIQUIÁTRICOS E ATIVIDADE FÍSICA NA PERSPECTIVA DA SAÚDE COLETIVA........................................................................................... 671

ESTUDO RETROSPECTIVO DE CASOS DE ESCORPIONISMO EM UM HOSPITAL DE REFERÊNCIA NO OESTE DO PARÁ....................................................... 672

LUTO DO FILHO IDEALIZADO: A INESPERADA DEFICIÊNCIA FÍSICA................................................................................................................................. 673

DESAFIOS E POSSIBILIDADES: INCLUSÃO DE PESSOAS COM BAIXA VISÃO NO CURSO DE FISIOTERAPIA......................................................................... 674

OS DESAFIOS DA SAÚDE BUCAL NO INTERIOR DA AMAZÔNIA: EXTENSÃO UNIVERSITÁRIA NA FORMAÇÃO DE PROFISSIONAIS DE SAÚDE.................... 675

EFICÁCIA DO TRATAMENTO NÃO-INVASIVO PARA LIPODISTROFIA LOCALIZADA............................................................................................................. 676

ENFERMAGEM OCUPACIONAL: UM RELATO DE EXPERIÊNCIA NO SETOR DE RADIOTERAPIA............................................................................................ 677

ANÁLISE DOS HÁBITOS DE VIDA SAÚDAVEIS ENTRE HOMENS E MULHERES..................................................................................................................... 678

NASCER EM SANTARÉM: VIOLÊNCIA OBSTÉTRICA E O DIREITO DAS MULHERES............................................................................................................... 679

21 SUMÁRIO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

RASTREAMENTO GENÉTICO DE TAMBAQUI PRODUZIDOS EM ESTAÇÕES DE REPRO-


DUÇÃO

Jonas Aguiar, Paola Fazzi-Gomes, Igor Hamoy, Sidney Santos, Horacio Schneider e Iracilda Sampaio
Universidade Federal do Pará - UFPA1, Universidade Federal do Pará - , UFPA2, Universidade Federal
Rural da Amazônia - , UFRA3, Universidade Federal do Pará - , UFPA4, Universidade Federal do Pará - ,
UFPA5 e Universidade Federal do Pará - e UFPA6
jonaspaguiar@gmail.com

Resumo: A necessidade do rastreamento tem sido cada vez maior, principalmente, em razão dos recentes ca-
sos de gripe aviária e encefalopatia espongiforme bovina ocorridos na Ásia e Europa. Conceitualmente pode
ser definido como a habilidade para manter a identificação dos alimentos, produtos de origem animal e ingre-
dientes em todas as fases da cadeia produtiva incluindo a produção, o processamento e a venda ao consumidor
final. No Brasil o tambaqui constitui um exemplo desta necessidade. Marcadores moleculares tem sido avalia-
dos para o rastreamento de indivíduos produzidos em cativeiro. Neste trabalho avaliamos a capacidade da uti-
lização de marcadores moleculares para o rastreamento de Colossoma macropomum produzidos em cativeiro.
Para as análises também foram utilizadas amostras de matrizes das regiões Norte, Nordeste, Centro-Oeste e
Sudeste do país. A extração do DNA foi feita utilizado o Kit Wizard® Genomic DNA Purification (Promega,
USA). Doze microssatélites e sequencias da região controle do DNA mitocondrial foram utilizadas. A ampli-
ficação dos microssatélites e da região controle do DNA mitocondrial seguiu o descrito por Hamoy e Santos
(2012) e Brígida et al. (2007) respectivamente. A genotipagem foi realizada no ABI 3130 Genetic Analyzer
(Applied Biosystems Inc.). O método de verossimilhança plena implementado no programa Colony 2.0.6.4
(JONES; WANG, 2010) foi adotado para o teste de paternidade. A região controle do DNA mitocondrial foi
altamente variável para o plantel da estação de reprodução da SEDAP não sendo possível a formulação de
um método determinístico para o rastreamento populacional dos lotes amostrados. A paternidade de todos os
indivíduos amostrados na estação de reprodução da SEDAP foram identificados corretamente através dos 12
microssatélites e do método de verossimilhança plena com probabilidade de identificação acima de 99%. O
DNA mitocondrial não é eficiente para rastreamento populacional através do método determinístico em razão
da alta variabilidade genética. A utilização de microssatélites foi eficaz para o rastreamento individual e po-
dem ser aplicados para o rastreamento da espécie em estações de reprodução com alta variabilidade genética.
Palavras-chave: rastreamento,Colossoma macropomum,marcadores moleculares.

Introdução
O rastreamento pode ser definido como a habilidade para manter a identificação dos alimentos, pro-
dutos de origem animal e ingredientes em todas as fases da cadeia produtiva incluindo a produção, o processa-
mento e a venda ao consumidor final (DALVIT; MARCHI; CASSANDRO, 2007). A necessidade do rastrea-
mento tem sido cada vez maior, principalmente, em razão dos recentes casos de gripe aviária e encefalopatia
espongiforme bovina ocorridos na Ásia e Europa (FELMER et al., 2006; MATEUS; RUSSO-ALMEIDA,
2015). Além disso, razões econômicas, culturais, sociais e ecológicas também tem motivado o desenvolvi-
mento de sistemas de rastreamento que possam manter a confiança dos consumidores (DALVIT; MARCHI;
CASSANDRO, 2007). No Brasil, o Colossoma macropomum (CUVIER, 1918) também conhecido como
tambaqui tem sido a espécie nativa mais cultivada no país (PPM, 2017). No ambiente selvagem está espécie
é marcada pelo declínio populacional em razão da grande exploração pesqueira que levaram a redução popu-
lacional e a restrição no tamanho e no período que os indivíduos podem ser capturados (IBAMA; 1996). Por
outro lado, indivíduos cultivados nem sempre são bem aceitos pelos consumidores que priorizam o consumo
de indivíduos selvagens (DAVIDSON et al., 2012). A incapacidade de distinguir os indivíduos oriundos do
ambiente selvagem e das pisciculturas por critérios morfológicos tornam necessário o rastreamento dos indiví-
22 JOVEM PESQUISADOR - PÓS GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

duos para manter a confiança dos consumidores e atender as normas regulatórias. A utilização de marcadores
moleculares para o rastreamento tem sido constantemente avaliada (FONTANESI, 2009). Entre os marcado-
res, os microssatélites são os mais utilizados por serem altamente polimórficos, informativos e poderem ser
encontrados em quase todo o genoma (FERNÁNDEZ et al., 2013).
Objetivo
Este trabalho teve como objetivo avaliar a capacidade de rastreamento dos indivíduos cultivados de
C. macropomum.

Metodologia
Para isso, foram utilizados três lotes de indivíduos de tambaqui produzidos na Estação de Repro-
dução da Secretaria de Desenvolvimento Agropecuário e da Pesca - SEDAP de Santarém – Pará. Para as
análises também foram utilizadas amostras de matrizes das regiões Norte, Nordeste, Centro-Oeste e Sudeste
do país. A extração do DNA foi feita utilizado o Kit Wizard® Genomic DNA Purification (Promega, USA).
Doze microssatélites e sequencias da região controle do DNA mitocondrial foram utilizadas. A amplificação
dos microssatélites e da região controle do DNA mitocondrial seguiu o descrito por Hamoy e Santos (2012)
e Brígida et al. (2007) respectivamente. A genotipagem foi realizada no ABI 3130 Genetic Analyzer (Applied
Biosystems Inc.). O método de verossimilhança plena implementado no programa Colony 2.0.6.4 (JONES;
WANG, 2010) foi adotado para o teste de paternidade.

Resultados e Discussão
A região controle do DNA mitocondrial foi altamente variável para o plantel da estação de reprodução
da SEDAP não sendo possível a formulação de um método determinístico para o rastreamento populacional
dos lotes amostrados. A paternidade de todos os indivíduos amostrados na estação de reprodução da SEDAP
foram identificados corretamente através dos 12 microssatélites e do método de verossimilhança plena com
probabilidade de identificação acima de 99%. A utilização do método determinístico para o rastreamento gené-
tico populacional utilizando as sequencias da região controle do DNA mitocondrial não se mostrou eficaz em
razão da alta variabilidade genética dos indivíduos utilizados para reprodução no plantel, provavelmente, em
virtude da origem selvagem das matrizes já indicada em outros trabalhos para o plantel da SEDAP (AGUIAR
et al., 2013). Por outro lado, a utilização dos microssatélites foi eficaz na identificação da paternidade podendo
ser uma alternativa para o rastreamento genético de indivíduos cultivados de tambaqui produzidos na SEDAP.
Resultados semelhantes foram encontrados por Sahoo et al. (2016) para a eficácia na identificação dos indiví-
duos utilizando o método de verossimilhança e implementada no programa Colony 2.0.6.4.

Considerações Finais
A região controle do DNA mitocondrial não é eficiente para rastreamento populacional pelo método
determinístico em razão da alta variabilidade genética. A utilização de microssatélites associado com a apli-
cação de testes probabilísticos pode ser usados para o rastreamento genético em estações de reprodução de
tambaqui que possuem alta variabilidade genética como analisada neste estudo. A utilização destes microssa-
télites em outras estações de reprodução dependem de um estudo prévio para análise da variabilidade genética.

Referências

AGUIAR, Jonas et al. Genetic variation in native and farmed populations of Tambaqui (Colossoma macropo-
mum) in the Brazilian Amazon: regional discrepancies in farming systems. Anais da Academia Brasileira de
Ciências, [s.l.], v. 85, n. 4, p.1439-1447, 21 out. 2013.
FapUNIFESP (SciELO). BRÍGIDA, El. Santa et al. Population analysis of Scomberomorus cavalla (Cuvier,
1829) (Perciformes, Scombridae) from the Northern and Northeastern coast of Brazil. Brazilian Journal Of
Biology, [s.l.], v. 67, n. 4, p.919-924, dez. 2007.
FapUNIFESP (SciELO). DALVIT, C.; MARCHI, M. de; CASSANDRO, M. Genetic traceability of livestock
products: A review. Meat Science, [s.l.], v. 77, n. 4, p.437-449, dez. 2007.

23 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

Elsevier BV. DAVIDSON, Kelly et al. Consumers' willingness to pay for aquaculture fish products vs. wild-
-caught seafood – a case study in Hawaii. Aquaculture Economics & Management, [s.l.], v. 16, n. 2, p.136-
154, abr. 2012.

FELMER, R et al. Tecnologías actuales y emergentes para la identificación animal y su aplicación en la tra-
zabilidad animal. Archivos de Medicina Veterinaria, [s.l.], v. 38, n. 3, p.197-206, 2006. SciELO Comision
Nacional de Investigacion Cientifica Y Tecnologica (CONICYT).
FERNÁNDEZ, María E. et al. Comparison of the effectiveness of microsatellites and SNP panels for genetic
identification, traceability and assessment of parentage in an inbred Angus herd. Genetics And Molecular Bio-
logy, [s.l.], v. 36, n. 2, p.185-191, 2013. FapUNIFESP (SciELO).
FONTANESI, Luca. Genetic authentication and traceability of food products of animal origin: new develo-
pments and perspectives. Italian Journal Of Animal Science, [s.l.], v. 8, n. 2, p.9-18, jan. 2009. Informa UK
Limited.
HAMOY, I.g.; SANTOS, S.. Short Communication Multiplex PCR panel of microsatellite markers for the
tambaqui, Colossoma macropomum, developed as a tool for use in conservation and broodstock management.
Genetics And Molecular Research, [s.l.], v. 11, n. 1, p.141-146, 2012. Genetics and Molecular Research.
IBAMA - Instituto Brasileiro do Meio Ambiente e dos Recursos Renováveis. Portaria Nº 8, 2 de Fevereiro de
1996. In: Diário Oficial da União, 5 de Fevereiro de 1996. Imprensa Nacional. 1006-1007. 1996.
JONES, Owen R.; WANG, Jinliang. COLONY: a program for parentage and sibship inference from multilo-
cus genotype data. Molecular Ecology Resources, [s.l.], v. 10, n. 3, p.551-555, maio 2010.
MATEUS, J. C.; RUSSO-ALMEIDA, P.A. Traceability of 9 Portuguese cattle breeds with PDO products in
the market using microsatellites. Food Control, [s.l.], v. 47, p.487-492, jan. 2015.
Elsevier BV. Produção da Pecuária Municipal (PPM) 2016. Rio de Janeiro: IBGE, v. 44, 2017. Anual.
SAHOO, L. et al. A molecular tool for parentage analysis in Indian major carp, Labeo rohita (Hamilton, 1822).
Aquaculture International, [s.l.], v. 25, n. 3, p.1159-1166, 24 dez. 2016. Springer Nature.

24 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

CONTROLE DA DIABETES MELLITUS: DESAFIO DE UMA EQUIPE DA ESTRATÉGIA


SAÚDE DA FAMÍLIA DO MUNICÍPIO EM SANTARÉM-PARÁ

Domingas Machado da Silva, Eloane Hadassa de Sousa Nascimento e Gisele Pinto de Oliveira
UNIVERSIDADE FEDERALDO OESTE DO PARÁ - UFOPA1, UNIVERSIDADE DA AMAZONIA - , UNA-
MA2 e Universidade Federal do Rio de Janeiro - e UFRJ3, Fundação Oswaldo Cruz - , FIOCRUZ3
enfadomingassilva@gmail.com

Resumo: A Diabetes Mellitus é uma síndrome de etiologia múltipla decorrente da falta de insulina e/ou da
incapacidade desta em exercer adequadamente seus efeitos, representa um importante problema de saúde pú-
blica. A Atenção integral e longitudinal à Saúde dos pacientes com Diabetes Mellitus é realizada na maioria
das vezes na Atenção Primária a Saúde por meio da Equipe de Estratégia Saúde da Família da Área adiscrita.
Objetivo: Reduzir o percentual de pacientes com glicemia descontrolada. Metodologia: O presente trabalho
foi realizado como proposta de intervenção à uma equipe de Estratégia Saúde da Família do município de
Santarém – PA. O tipo de estudo é de intervenção, realizado por meio de pesquisa-ação, pois além de com-
preender, visa intervir na situação, com o objetivo de modificá-la. Resultados e Discussão: O conhecimento
almejado articula-se a uma finalidade intencional de alteração da situação pesquisada objetivando a redução
do alto percentual de pacientes com glicemia descontrolada. Sendo as causas críticas elencadas como situa-
ção-problema: o acompanhamento do cuidado insuficiente pela equipe de saúde; e pouco conhecimento sobre
o processo saúde-doença por pacientes, familiares e profissionais Agentes Comunitários de Saúde. Fora estru-
turada 02 matrizes de ações. Sendo que cada matriz foi composta por duas causas críticas: O acompanhamento
do cuidado insuficiente da equipe de saúde; Usuários, familiares e profissionais de saúde tem pouco conheci-
mento sobre o processo saúde-doença. Resultados:Diminuição do percentual dos pacientes que não realizam
o monitoramento rotineiramente da glicemia, aumento da participação desses usuários nos acompanhamentos
mensais dos grupões e das consultas médicas e de enfermagem, com níveis ideais de glicemia e diminuição
das complicações. E redução do desconhecimento sobre o processo saúde doença dos pacientes, familiares
e profissionais, para melhor controle das taxas de glicemia, promoção do autocuidado, melhor qualidade de
vida, e melhora no acompanhamento desses pacientes pelos profissionais. Conclui-se que o empenho/cola-
boração de cada um (equipe de saúde, pacientes e familiares), durante as dinâmicas/ações intervencionistas,
foram essenciais para que os objetivos fossem alcançados, o conhecimento do processo saúde doença da dia-
betes mellitus pelos pacientes, familiares e profissionais de saúde, reflete na melhor qualidade de vida, preve-
nindo possíveis complicações, proporciona autonomia, melhor compreensão do processo saúde-doença pelos
usuários, familiares e profissionais de saúde. Pequenas mudanças ou adaptações que estão ao nosso alcance
são grandiosamente transformadoras e se constitui de um processo mútuo de aprendizagem na saúde pública.

Palavras-chave: Atenção Primária a Saúde,Diabetes Mellitus,Estratégia Saúde da Família.

Introdução
O presente trabalho foi requisito essencial para conclusão do Curso de Especialização em Gestão em
Saúde promovido pela Escola Nacional de Saúde Pública da Fundação Oswaldo Cruz (ENSP/FIOCRUZ). Ao
qual o objeto de estudo foi o alto percentual de glicemia descompensada dos pacientes com Diabetes Melli-
tus acompanhados por uma equipe de Estratégia Saúde da Família do Município de Santarém-PA, diante do
acompanhamento do cuidado insuficiente da equipe de saúde e também do desconhecimento do processo saú-
de doença pelos pacientes, familiares e profissionais de saúde. A Diabetes Mellitus representa um importante
problema de saúde pública, e quando descontrolada pode ocasionar inúmeras consequências para os pacientes,
além de onerar o sistema de saúde, visto que uma internação representa muito mais financeiramente do que as
ações da Atenção Primária, o que é passível de intervenção (BARROS, 2015). Estimular as práticas de auto-
cuidado, melhorar o estilo de vida, e a adesão ao tratamento, são medidas importantes a serem consideradas
que proporcionarão aos pacientes melhor qualidade de vida, diminuem as incapacitações, as complicações

25 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

tais como retinopatia, neuropatias, amputações e a mortalidade prematura. Por meio da Estratégia Saúde da
Família (ESF) a atenção à saúde é feita por uma equipe composta por profissionais de diferentes categorias
(multidisciplinar) trabalhando de forma articulada (interdisciplinar), que considera as pessoas como um todo
(BRASIL,2009).

Objetivo
Reduzir o percentual de pacientes com glicemia descontrolada; Realizar busca ativa dos pacientes
faltosos nos grupões e nas consultas médica e de enfermagem; Estabelecer cronograma de visitas comparti-
lhadas; Realizar visitas compartilhadas para os casos mais graves com a equipe multidisciplinar ; Orientar
sobre a importância da adesão ao tratamento da diabetes; Promover o autocuidado por meio de educação em
saúde; Melhorar o grau de conhecimento dos pacientes, familiares e profissionais de saúde, sobre o processo
saúde-doença da diabetes.

Metodologia
O tipo de estudo é de intervenção, realizado por meio de pesquisa-ação, pois além de compreender,
visa intervir na situação, com o objetivo de modificá-la. O conhecimento almejado articula-se a uma finalidade
intencional de alteração da situação pesquisada. Desta forma ao mesmo tempo em que realiza um diagnóstico
e a análise de uma determinada situação, propõe ao conjunto de sujeitos envolvidos mudanças que levem a um
aprimoramento das práticas analisadas (SEVERINO, 2007). O tema foi escolhido durante reunião operacional
de planejamento e avaliação das atividades da ESF pesquisada, em que se verificou a fragilidade do acompa-
nhamento dos pacientes diabéticos evidenciado pelo alto percentual de glicemia descompensada, e discutido
o tema em reuniões posteriores. Para o embasamento teórico científico utilizou-se o site de busca acadêmica:
Google acadêmico, Manuais Técnicos da Biblioteca Virtual em Saúde do Ministério da Saúde, livros e pe-
riódicos. Para o alcance dos objetivos propostos, com vistas ao enfrentamento da problemática aqui descrita,
fora estruturada 02 matrizes de ações, para nortear o desenvolvimento do projeto. Sendo que cada matriz foi
composta por duas causas críticas: O acompanhamento do cuidado insuficiente da equipe de saúde; Usuários,
familiares e profissionais de saúde tem pouco conhecimento sobre o processo saúde-doença.

Resultados e Discussão
Na Estratégia Saúde da Família do estudo, estão cadastrados no programa de acompanhamento do
diabetes mellitus 124 clientes diabéticos 69 (56%) possuem somente o diabetes e 55 (44%) além do diabetes
mellitus são também hipertensos. Todos os meses são realizados grupões para interação entre equipe e entre
pacientes, assim como são realizadas atividades de educação em saúde, teste de glicemia capilar, medidas
antropométricas, dispensação de medicações (todos esses pacientes estão em tratamento medicamentoso),
consultas médicas (conforme a programação) e de enfermagem e café da manhã compartilhado. Dentre esses
124 clientes com Diabetes mellitus 18 são insulinodependentes. Para estimar a magnitude do problema nesse
grupo de usuários, foram coletados dados do índice de glicemia no período de novembro de 2016 à junho
de 2017. Como resultado 124 pacientes diabéticos apenas 50,8% tem mensuração regular de glicemia e dos
que tem mensuração regular, 73% tem glicemia acima de 150 mg/dl. Sendo as possíveis causas: a falha no
tratamento e acompanhamento longitudinal desses pacientes pela equipe de saúde e pelo paciente/ desconhe-
cimento dos profissionais de saúde; Carência do reconhecimento da importância do controle e manutenção das
taxas de glicemia de 70 mg/dl à 110 mg/dl, e o impacto que a diabetes mellitus descompensada pode acarretar
prejuízos na autonomia e qualidade de vida desses usuários/ desconhecimento do paciente, falta de medicação
ou quantidade insuficiente. Diante do exposto, percebeu-se que o paciente com diabetes mellitus fica vulnerá-
vel ao descontrole da glicemia, o que poderá em curto ou longo prazo ter severas complicações. O alcance dos
objetivos propostos será observado por meio da redução das taxas de glicemia nos acompanhamentos e rotina
à médio e longo prazo, com níveis ideais de glicemia, conhecimento do processo saúde doença pelos pacien-
tes, familiares e profissionais de saúde. Resultados/Impacto 1: Diminuição dos pacientes que não realizam o
monitoramento rotineiramente da glicemia, aumento da participação desses usuários nos acompanhamentos
mensais dos grupões e das consultas médicas e de enfermagem, com níveis ideais de glicemia e diminuição
das complicações. Resultados/Impacto 2: Redução do desconhecimento sobre o processo saúde doença dos
pacientes, familiares e profissionais, para melhor controle das taxas de glicemia, promoção do autocuidado,
melhor qualidade de vida, e melhora no acompanhamento desses pacientes pelos profissionais.
26 JOVEM PESQUISADOR - PÓS GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

Considerações Finais
Conclui-se que o empenho/colaboração de cada um durante (equipe de saúde, pacientes e familiares),
durante as dinâmicas/ações intervencionistas, foram essenciais para que os objetivos fossem alcançados, o co-
nhecimento do processo saúde doença da diabetes mellitus pelos pacientes, familiares e profissionais de saúde,
reflete na melhor qualidade de vida, prevenindo possíveis complicações, autonomia, melhor compreensão
do processo saúde-doença pelos usuários, familiares e profissionais de saúde. Este trabalho nos tornou mais
sensíveis na observação do contexto das práticas de saúde, de que forma estamos realizando nossas ações, se
estamos contribuindo eficazmente para o fortalecimento da Atenção Primária. Pequenas mudanças ou adapta-
ções que estão ao nosso alcance são grandiosamente transformadoras e se constitui de um processo mútuo de
aprendizagem na saúde pública.

Referências
BARROS, Márcio Rosa. Controle de Hipertensos e Diabéticos: Estratégias para Atenção Básica. Trabalho de
Conclusão de Curso - TCC. Especialização em Atenção Básica em Saúde da Família. Universidade Federal
de Minas Gerais. Governador Valadares/ MG, 2015. Disponível em: <https://www.nescon.medicina.ufmg.br/
biblioteca/imagem/4805.pdf> Acesso em 20 de Agosto de 2017.
BRASIL, Ministério da Saúde. O trabalho do Agente Comunitário de Saúde. Secretaria de Atenção à Saúde.
Departamento de Atenção Básica. Brasília, 2009. Disponível em: <http://189.28.128.100/dab/docs/publica-
coes/geral/manual_acs.pdf>. Acesso em 21 de Agosto de 2017.
SEVERINO, Antônio Joaquim. Metodologia do Trabalho Científico. 23. Ed. São Paulo: Cortez, 2007.

27 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

LEVANTAMENTO DE CASOS DE ACIDENTE VASCULAR ENCEFÁLICO EM UM HOSPI-


TAL PÚBLICO DE SANTARÉM – PA NOS ANOS DE 2011 A 2016.

Isabela Natilde Costa Góes, Jéssica Pinto Trindade Leal e Mirna Brito Malcher Pedroso
Instituto Esperança de Ensino Superior - IESPES1, Instituto Singular 2 e Instituto Esperança de Ensino Su-
perior - e IESPES3, Universidade Federal do Oeste do Pará - , UFOPA3
bela-goes@hotmail.com

Resumo: O Acidente Vascular Encefálico (AVE) é uma síndrome neurológica de inicio súbito, provocado por
uma paralisia da área cerebral que ficou sem circulação sanguínea, o mesmo pode ser ocasionado por trombo,
apontando como Acidente Vascular Encefálico Isquêmico (AVEi), ou extravasamento sanguíneo, caracteriza-
do pelo Acidente Vascular Encefálico Hemorrágico (AVCh) (CARVALHO, et al., 2015). O objetivo do estudo
é identificar a prevalência do Acidente Vascular Encefálico (AVE) em um hospital público de Santarém – PA
nos anos de 2011 a 2016. Utilizou-se como metodologia a pesquisa documental, com abordagem quantitativa,
de caráter descritivo e as coletas foram realizadas através dos arquivos digitais do Serviço de Arquivo Médico
Hospitalar (SAME) após autorização da Secretaria de Saúde de Santarém e o processo de análise dos docu-
mentos foi formulado mediante um Termo de Consentimento de Uso de Dados (TCUD). Foram realizadas
pesquisas bibliográficas para o embasamento do estudo. Coletaram-se as informações de dados registrados dos
anos de 2011 a 2016 de pacientes diagnosticados com Acidente Vascular Encefálico em um hospital público de
Santarém - PA,onde se realizou a tabulação dos dados obtidos por meio do programa Microsoft Office Excel
2010. Foram identificados 1.725 casos de internação de pacientes diagnosticados com AVE, seja isquêmico
ou hemorrágico, referenteao período investigado. Destaca-se que de 2011 a 2016 a faixa etária predominante
foi acima de 61 anos de idade, correspondendo ao total de 1.198 pacientes diagnosticados com AVE. Identifi-
cou-se que no ano de 2016 houve crescimento no número de casos na faixa etária de 41 a 50 anos de idade em
relação aos anos anteriores, fato este que chama atenção por afetar uma faixa etária considerada plenamente
ativa em relação ao trabalho e convívio social, impactando diretamente nas atividades destes indivíduos. Ob-
servou-se nesta pesquisa que até o ano de 2015 houve aumento das internações dos pacientes diagnosticados
com AVE, já no ano seguinte houve um declínio. Notou-se neste estudo que a ocorrência de AVE acometeu
maior parte em homens e que o aumento de óbitos decorrente do AVE, obteve maior índice em 2015. Através
deste estudo percebe-se que o Acidente Vascular Encefálico (AVE) gera muitas internações, com ocorrência
predominantemente no gênero masculino e apontando o idoso o mais propenso a esta patologia. Porém, o
estudo mostrou também que a cada ano aumenta o número de casos de AVE em adultos jovens e que todos os
anos há altos índices de mortalidade decorrente desta patologia.

Palavras-chave: Acidente Vascular Encefálico, Emergência, Mortalidade.

Introdução
O Acidente Vascular Encefálico (AVE) é uma síndrome neurológica de inicio súbito, provocado por
uma paralisia da área cerebral que ficou sem circulação sanguínea, o mesmo pode ser ocasionado por trombo,
apontando como Acidente Vascular Encefálico Isquêmico (AVEi), ou extravasamento sanguíneo, caracteriza-
do pelo Acidente Vascular Encefálico Hemorrágico (AVCh) (CARVALHO, et al., 2015). O Acidente Vascular
Encefálico Isquêmico (AVEi) ocorre pela obstrução das principais artérias que levam o sangue ao encéfalo,
fazendo com que as áreas afetadas deixem de receber sangue oxigenado. Por outro lado, o Acidente Vascular
Encefálico Hemorrágico (AVEh) é um rompimento de uma ou mais artérias do encéfalo, ocasionando sangra-
mento intraencefálico. O AVE isquêmico é o mais comum, em comparação com o AVE hemorrágico, ocor-
rendo em 15 a 20% dos casos (LEITE; NUNES; CORRÊA, 2009). O AVE é considerado como uma afecção
grave, onde no Brasil, segundo dados do DATASUS, é a principal causa de óbito e de sequelas incapacitantes
em adultos. Em outros Países, é apontado como primeira e terceira causa de morte, e em geral é a principal

28 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

causa de sequelas em adultos (GAGLIARDI, 2015). Dados da Organização Mundial da Saúde (OMS), mos-
tram que 15 milhões de pessoas sofrem de AVE ao ano, 5 milhões não resistem e morrem, e a maior parte
apresenta deficiência física e mental (RANGEL; BELASCO; DICCINI, 2013). Os fatores de risco para o AVE
são divididos em não modificáveis, quando não se consegue intervir, tratar ou modificar, tais como: idade,
sexo, raça/cor e genética/história familiar, e modificáveis quando pode-se mudar, tratar ou prevenir. Dentre
estes fatores estão: hipertensão arterial, doenças cardiovasculares, dislipidemias, obesidade, diabetes mellitus,
tabagismo, alcoolismo, uso de contraceptivo oral, abuso de droga, entre outros (CARVALHO; DEODATO,
2016). O AVE é um problema de saúde pública que afeta milhares de pessoas, contribuindo assim para a mor-
talidade e morbidade, ocasionando múltiplos danos ao paciente e a sua família, limitando-se a prática de suas
atividades diárias e aumentando custos financeiros de hospitais e reabilitação. É necessário alertar a sociedade
e buscar meios de prevenção para minimizar esta situação.

Objetivo
O objetivo do estudo é identificar a prevalência do Acidente Vascular Encefálico (AVE) em um hos-
pital público de Santarém – PA nos anos de 2011 a 2016.

Metodologia
Utilizou-se como metodologia a pesquisa documental, com abordagem quantitativa, de caráter des-
critivo. As coletas foram realizadas através dos arquivos digitais do Serviço de Arquivo Médico Hospitalar
(SAME) após autorização da Secretaria de Saúde de Santarém e o processo de análise dos documentos foi
formulado mediante um Termo de Consentimento de Uso de Dados (TCUD). Foram realizadas pesquisas
bibliográficas para o embasamento do estudo. Coletaram-se as informações de dados registrados dos anos
de 2011 a 2016 de pacientes diagnosticados com Acidente Vascular Encefálico em um hospital público de
Santarém - PA, onde se realizou a tabulação dos dados obtidos por meio do programa Microsoft Office Excel
2010. Foram identificados 1.725 casos de internação de pacientes diagnosticados com AVE, seja isquêmico ou
hemorrágico, referente ao período investigado. Foram analisados de modo retrospectivo os processos clínicos
de internamento de todos os doentes abordando parâmetros como: número de casos diagnosticados por ano,
gênero, faixa etária, alta, óbitos e remoções (transferências para outros hospitais).

Resultados e Discussão
Em 2011, foram identificados 148 pacientes com diagnóstico de AVE, destes, 52% (148/77) são
do gênero masculino e 48% (148/71) são do gênero feminino. Destes, 73% (148/108) receberam alta, 22%
(148/32) foram a óbito e 5% (148/8) removidos. No ano de 2012, registrou-se 258 pacientes com esta patolo-
gia, sendo 52% (258/135) referente ao gênero masculino e 48% (258/123) ao gênero feminino. Desses pacien-
tes, 69% (258/178) receberam alta, 27% (258/70) foram a óbito e 4% (258/10) removidos. No seguinte ano,
em 2013, verificou-se que 313 pacientes foram acometidos por AVE, sendo 53% (313/167) homens e 47%
(313/47%) mulheres. A alta foi concedida a 68% (313/213) desses pacientes, 29% (313/91) foram a óbito e 3%
(313/9) transferidos. Em 2014, destacou-se 306 pacientes diagnosticados com AVE, destes, 54% (306/166)
são homens e 46% (306/140) são mulheres. Apenas 63% (306/193) receberam alta, 33% (306/100) foram a
óbito e 4% (306/13) transferidos. No ano de 2015 registrou-se 369 casos de AVE, sendo 53% (369/196) no
gênero masculino e 47% (369/173) no gênero feminino. A alta foi concedida a 60% (369/221) dos pacientes,
35% (369/129) foram a óbito e 5% (369/19) removidos. E por fim, no ano de 2016, identificou-se 331 pacien-
tes diagnosticados com esta patologia, sendo 57% (331/188) homens e 43% (331/143) mulheres. Destes, 65%
(331/214) receberam alta, 32% (331/106) foram a óbito e 3% (331/11) transferidos. Destaca-se que de 2011
a 2016 a faixa etária predominante foi acima de 61 anos de idade, correspondendo ao total de 1.198 pacien-
tes diagnosticados com AVE. Em um estudo realizado por Botelho et al. (2016), verificou que o número de
internações de casos com AVE aumentou gradativamente de acordo com a faixa etária e mostrou que pessoas
idosas tem maiores chances de desenvolver a patologia. Identificou-se que no ano de 2016 houve crescimento
no número de casos na faixa etária de 41 a 50 anos de idade em relação aos anos anteriores, fato este que cha-
ma atenção por afetar uma faixa etária considerada plenamente ativa em relação ao trabalho e convívio social,
impactando diretamente nas atividades destes indivíduos. Observou-se nesta pesquisa que até o ano de 2015
29 JOVEM PESQUISADOR - PÓS GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

houve aumento das internações dos pacientes diagnosticados com AVE, já no ano seguinte houve um declínio.
Araújo (2008) enfatiza que os fatores de riscos contribuem diretamente para o aumento de internações pelo
AVE, tais como hipertensão arterial, diabetes mellitus, doenças cardíacas, obesidade, entre outros fatores.
Notou-se neste estudo que a ocorrência de AVE acomete maior parte em homens, circunstância esta observa-
da em um estudo realizado por Rangel, Belasco e Diccini (2013), onde mostram que o AVE tem predomínio
maior em pessoas do sexo masculino, porém, a qualidade de vida é pior em mulheres, devido a limitação das
atividades domésticas quando há o comprometimento funcional. Destaca-se o aumento de óbitos decorrente
do AVE, com maior índice em 2015. Outros estudos mostram que o AVE é a segunda maior causa de morte no
mundo, apontando por 6,7 milhões de óbitos em 2012 e no Brasil está entre as principais causas de mortes, e
encontra-se em primeiro lugar nas doenças cerebrovasculares (ARAÚJO et al., 2017). O ministério da saúde
afirma que são registrados aproximadamente 68 mil mortes por AVE anualmente e que a patologia é a princi-
pal causa de óbito e incapacidade no país (BRASIL, 2014).

Considerações Finais
Através deste estudo percebe-se que o Acidente Vascular Encefálico (AVE) gera muitas internações,
com ocorrência predominantemente no gênero masculino e apontando o idoso o mais propenso a esta patolo-
gia. Porém, o estudo mostrou também que a cada ano aumenta o número de casos de AVE em adultos jovens
e que todos os anos há altos índices de mortalidade decorrente de AVE. Diante desses resultados obtidos, é
necessário conscientizar e estabelecer a prevenção como ação prioritária para reduzir a incidência desta pa-
tologia. Isso pode se dá pela mudança do estilo de vida como, a alimentação saudável, práticas regulares de
atividades físicas e o diagnóstico precoce para a redução das sequelas, evitando assim alto custo no tratamento
e possíveis internações.

Referências
ARAÚJO, A. P. S. et al. Prevalência dos fatores de risco em pacientes com acidente vascular encefálico aten-
didos no setor de neurologia da clínica de fisioterapia da UNIPAR, campus sede.Arquivo. Ciência. Saúde
Unipar, Umuarama, v. 12, n. 1, p. 35-42, 2008.
ARAÚJO, J. P. Tendência da mortalidade por acidente vascular cerebral no município de Maringá, Paraná en-
tre os ano de 2005 a 2015. Int J CardiovascSci, Rio de Janeiro, v. 31, n. 1, p. 56-62, jul, 2017. Disponível em:
http://www.scielo.br/scielo.php?script=sci_arttext&pid=S2359 56472018000100056&lng=pt&nrm=iso&tln-
g=pt. Acesso em: 28 mar 2018.
BOTELHO, T. S. et al. Epidemiologia do acidente vascular cerebral no Brasil. Temas em saúde, João Pessoa,
v. 16, n. 2, p. 361-377, 2016. Disponível em:http://temasemsaude.com/wp-content/uploads/2016/08/16221.
pdf. Acesso em: 28 mar 2018.
BRASIL. Ministério da Saúde. Acidente Vascular Cerebral (AVC). 2014. Disponível em http://www.brasil.
gov.br/saude/2012/04/acidente-vascular-cerebral-avc. Acesso em: 28 mar 2018.
CARVALHO, I. A.; DEODATO, L. F. F. Fatores de risco do acidente vascular encefálico. Revista cientifica
da FASETE, 2016. Disponível em: http://www.fasete.edu.br/revistarios/media/revistas/2016/fatores_de_ris-
co_do_acidente_vascular_encefalico.pdf. Acesso em: 29 mar 2018.
CARVALHO, M. A. et al. Epidemiologia dos acidentes vasculares encefálicos atendidos por meio do serviço
de atendimento móvel de urgência. Revenferm UFPE online, Recife, v. 9, n. 3, p. 1015-21, mar., 2015. Dispo-
nível em: https://periodicos.ufpe.br/revistas/revistaenfermagem/article/download/10429/11224. Acesso em:
28 mar 2018.
GAGLIARDI, R. J. Prevenção primária da doença cerebrovascular. Diagn tratamento, São Paulo, v. 20, n. 3,
p. 88-94, mar, 2015. Disponível em: <http://files.bvs.br/upload/S/1413-9979/2015/v20n3/a4894.pdf>. Acesso
em: 28 mar 2018.
LEITE, H. R.; NUNES, A. P. N., CORRÊA, C. L. Perfil epidemiológico de pacientes acometidos por aciden-

30 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

te vascular encefálico cadastrados na estratégia de saúde da família em Diamantina, MG. Fisioter Pesq. São
Paulo, v. 16, n. 1, p. 34-9, jan/mar, 2009. Disponível em:<https://www.revistas.usp.br/fpusp/article/viewFi-
le/12122/13899>. Acesso em: 28 mar 2018.
RANGEL, E. S. S.; BELASCO, A. G. S., DICCINI, S. Qualidade de vida de pacientes com acidente vascu-
lar cerebral em reabilitação. Acta Paul Enferm, São Paulo, v. 26, n. 2, p. 205-12, fev, 2013. Disponível em:
<http://www.scielo.br/scielo.php?pid=S0103-21002013000200016&script=sci_abstract&tlng=pt>. Acesso
em: 28 mar 2018.

31 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A PREVALÊNCIA DE MICRONÚCLEOS EM CÉLULAS ESFOLIATIVAS DA MUCOSA


ORAL EM FRENTISTAS DE SANTARÉM, PARÁ

Luan Aércio Melo Maciel, Thais Sena Trolly, Samaroni Brelaz Feitosa e Albino Luciano Portela de Sousa
Universidade Federal do Oeste do Pará - UFOPA1, Universidade Federal do Oeste do Pará - , UFOPA2,
centro educacional espernça - , CEPES3 e Instituto Esperança de ensino superior - e IESPES4
luanaercio@hotmail.com

Resumo: Profissionais frentistas encontram-se em situação de risco tóxico pela exposição constante aos vapo-
res dos combustíveis. O benzeno presente na gasolina é considerado cancerígeno e prejudicial à saúde destes
trabalhadores. Objetivou-se avaliar a prevalência de micronúcleos em células esfoliativas da mucosa oral em
frentistas relacionando a influência do tempo de trabalho, hábito etílico e uso de antisséptico bucal e determi-
nar o emprego de equipamentos de proteção nestes colaboradores. Fizeram parte do estudo 147 voluntários,
distribuídos em 7 grupos contendo indivíduos expostos e não expostos foram comparados utilizando a técnica
do ensaio de micronúcleos em células da mucosa oral de profissionais frentistas do município de Santarém-
-PA. As células examinadas foram coradas com as técnicas de Feulgen/Fast-green. Os frentistas apresentaram
maior frequência de micronúcleos em relação ao grupo não expostos ao benzeno (p= 0,0001). Os hábitos de
etilismo e uso continuo de antisséptico bucal potencializam o aparecimento de micronúcleos em frentistas (p=
0,0001). 100% dos profissionais entrevistados não fazem uso dos equipamentos de proteção. Constatou-se um
aumento na presença de micronúcleos em células esfoliativas de frentistas em comparação ao grupo controle,
este aumento é ainda maior quando o frentista ingere frequentemente bebidas alcoólicas ou faz uso de antis-
séptico bucal.

Palavras-chave: frentistas, genotoxicidade, benzeno, micronúcleos, DNA.

Introdução
Profissionais frentistas encontram-se em situação de risco tóxico pela exposição constante aos va-
pores dos combustíveis que manipulam continuamente (CERQUEIRA et al., 2013). Tais combustíveis são
líquidos inflamáveis e possuem em sua composição substâncias tóxicas, como os hidrocarbonetos, dentre eles
o benzeno, que são prejudiciais à saúde por serem cancerígenos (JARDIM, 2011). Os hidrocarbonetos pene-
tram facilmente as membranas biológicas, e possuem grande afinidade de interagir com as bases nitrogenadas
do DNA fragilizando as ligações entre elas, o que pode gerar mutações no genoma (HEDLE et al., 1991;
ROTH et al.,2002). Entre os frentistas, a principal rota de exposição ocupacional com estes contaminantes é
através da inalação de vapores durante o abastecimento ou contato direto com o líquido no momento de sua
manipulação (JARDIM, 2011). Diante do referido, é necessário o monitoramento de populações expostas a
estes contaminantes químicos, empregando-se parâmetros biológicos como em testes citogenéticos para au-
xiliar na identificação de danos e compreensão dos efeitos mutagênicos resultantes da exposição (LACERDA
et al,.2015). O teste do micronúcleo traduz-se num importante marcador intermediário para avaliar o grau
de exposição da mucosa bucal a carcinógenos onde pode-se monitorar o efeito de exposições constantes
(ANDRADE et al., 2005). Micronúcleos são estruturas visíveis no citoplasma com um terço do tamanho
do núcleo sem manter qualquer ligação estrutural com o mesmo, e contém em si fragmentos cromossômi-
cos ou cromossomos inteiros (HEDLE et al., 1991; ROTH et al.,2002). A presença de micronúcleos nas
células esfoliativas serve como dosímetro interno, principalmente na avaliação da extensão em que deter-
minado agente ambiental está associado à instabilidade genômica das células (MARTINS e FILHO, 2003).

Objetivo
Avaliar a prevalência de micronúcleos em células esfoliativas da mucosa oral em frentistas traba-
lhadores de postos de gasolina na cidade de Santarém-PA, assim como determinar a taxa de adesão ao uso de
equipamentos de proteção individual nestes colaboradores.

32 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

Metodologia
Fizeram parte do estudo 147 voluntários, destes 126 são frentistas de 11 postos de combustíveis do
município de Santarém-PA e 21 do grupo controle. A amostra foi dividida em 7 grupos contendo 21 indiví-
duos cada, os grupos G1 a G3 são frentistas com tempo de serviço de 0 a 5 anos, os grupos G4 a G6 frentistas
com tempo de serviço de 6 a 10 anos, com idade entre 18 a 36 anos, reunidos nas seguintes categoriais: G1,
frentistas abstêmios de 0 a 5 anos de serviço prestados como frentista; G2, frentistas etilistas; G3, frentistas
usuários de antisséptico bucal; G4, frentistas abstêmios de 6 a 10 anos de serviços prestados como frentistas;
G5, frentistas etilistas; G6, frentistas usuários de antisséptico bucal; G7, grupo controle. A pesquisa foi rea-
lizada de acordo com a resolução 466/12 do Conselho Nacional de Saúde aprovado pelo comitê de ética em
pesquisa (CEP) da UEPA campus XII conforme parecer nº 1.827.532. Coletou-se células epiteliais da mucosa
oral dos participantes com auxílio de uma escova citológica do tipo citobrush, as células raspadas foram espa-
lhadas sobre lâminas de microscopia e fixadas com fixador citológico spray. Em seguida, as lâminas sofreram
hidrólise ácida do DNA com solução de ácido clorídrico (HCl) 10% por 2 minutos e deixadas por 6 minutos
no banho-maria à 60°C. As lâminas foram coradas com solução de fucsina básica por 12 minutos, posterior-
mente contra coradas com a solução de Fast Green por 1 minuto, e enxaguadas em álcool 70%. Analisou-se
2000 células por indivíduo, em microscópio óptico mediante objetiva de imersão com lente de aumento 100x.
A análise estatística da frequência de distribuição dos micronúcleos foi realizado através do teste ANOVA e
Teste de Tukey, as diferenças foram consideradas significativas quando p<0,05.

Resultados e Discussão
Dos profissionais investigados 119 (95%) eram do gênero masculino. Dos frentistas pesquisados
100% relataram não utilizar equipamentos de proteção individual em suas práticas cotidianas nos postos de
combustíveis. Estes profissionais apontaram como um possível obstáculo para o uso destes equipamentos o
desconforto que os mesmos causam durante a realização de suas tarefas. Em uma investigação realizada por
Portela et al. (2011) com 32 frentistas do município de Santarém-PA, constatou-se que o uso de luvas, óculos
e máscaras não são utilizadas de forma rotineira, estes somente são empregados em situações específicas no
trabalho, como o descarregamento para os reservatórios internos de combustíveis. As botas e uniformes são os
únicos EPI’s que esses funcionários mais utilizam. Lacerda et al. (2015) investigou a exposição ocupacional a
gasolina em 20 frentistas de um município do nordeste brasileiro, observou que 100% dos profissionais inves-
tigados não utilizavam os equipamentos de proteção, corroborando com os resultados encontrados neste estu-
do. A frequência de micronúcleos nos grupos expostos G1, G2, G3, G4, G5 e G6 foi significativamente maior
(p= 0,0001) quando comparados ao grupo controle. Estudos sobre mutagenicidade em profissionais expostos a
gasolina vêm demonstrando de forma similar o aumento da frequência de micronúcleos nos grupos expostos,
com nível de significância (p<0.001) conforme ao encontrado nesta pesquisa (LACERDA et al,2015). Notou-
-se ainda que a associação entre hábitos de etilismo e uso continuo de antisséptico bucal potencializa de forma
significativa o aumento da frequência de micronúcleos quando comparado ao grupo não exposto. Verificou-se
que a variável etilismo é a maior causadora do aparecimento de micronúcleo quando comparado as demais
variáveis. Campos et al. (2017) enfatiza que a exposição ocupacional ao benzeno está associada a um risco au-
mentado de dano genotóxico entre indivíduos expostos à gasolina. A frequência de micronúcleos elevada nos
frentistas pode ser causada pela exposição continua aos agentes genotóxicos dos combustíveis, destacando-se
o Benzeno, que possui um alto nível de genotoxidade, sendo classificado no grupo A de substâncias carcino-
gênicas pela Agência Internacional de Estudos de Câncer (IARC), em uma escala que vai de A à E, sendo o
grupo A reconhecidas como carcinogênicas e o grupo E não carcinogênicas. Para Costa (2002) o benzeno se
torna tóxico ao organismo devido à ação de seus produtos derivados da biotransformação, primeiramente o
benzeno epóxido, uma substância altamente reativa e instável, e a 1,4–benzoquinona, prováveis responsáveis
pela mielotoxicidade do benzeno. No presente estudo, quando comparados o grupo de frentistas etilistas com
o grupo de frentistas não etilistas pode-se observar maior ocorrência de mutagenicidade no grupo de frentistas
etilistas. Reis et al. (2002) pondera que maiores danos são notados em frentistas com hábito etílico pois as
células da mucosa oral respondem aos efeitos genotóxicos do álcool, e de forma isolada este agente também
provoca aumento na frequência de micronúcleos em células esfoliadas. Encontrou-se micronúcleos em maio-
res quantidades nas amostras dos frentistas dos grupos expostos às substâncias genotóxicas, mostrando que o
teste de micronúcleo é bastante eficaz e sensível para mensurar alterações genéticas em indivíduos expostos
a carcinógenos.
33 JOVEM PESQUISADOR - PÓS GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

Considerações Finais
As exposições aos combustíveis aumentaram significativamente a frequência de micronúcleos nas
células epiteliais da mucosa oral dos frentistas, a associação dos hábitos de etilismo e uso de antisséptico bu-
cal, somado à exposição aos combustíveis, potencializam o aparecimento de micronúcleos e os profissionais
frentistas entrevistados não usam equipamentos de proteção individual.

Referências
ANDRADE, M.G.S et al. Micronúcleo: um importante marcador biológico intermediário na prevenção do
câncer bucal. Revista Odonto Ciencia 2005;20(48):p.137-141.
CAMPOS, M.A.A; FERNANDES, A.P.S.M.; ANDRÉ, L.C. Avaliação da exposição ocupacional ao benzeno
em trabalhadores frentistas e analistas de combustíveis utilizando o Teste Cometa como biomarcador de geno-
toxicidade. Rev Bras Saude Ocup 2017;42(1):1-9.
CERQUEIRA, G.S et al. Exposição Ocupacional a Gasolina: Um Estudo Transversal. RevInter Revista Inter-
tox de Toxicologia, Risco Ambiental e Sociedade 2013;6(1):05-14.
COSTA, M.A.F; COSTA, M.F.B. Benzeno: uma questão de saúde pública. Interciência 2002;27(4):201-204.
HEDDLE, J. A et al. Micronuclei as na index of cytogenetic demage: past, presente, and future. Environ Mol
Mut 1991;18: 277-291.
JARDIM, F.H.C Análise dos riscos ambientais em posto de revenda de combustíveis. Colloquium Exactarum
2011;4: 124-131.
LACERDA L.P et al. Estudo de toxicologia ocupacional com ênfase na atividade citotóxica e mutagênica em
trabalhadores com exposição à gasolina. Revista Biotemas 2015;28(3):135-141.
MARTINS K.F; FILHO J.B. Determinação da frequência de micronúcleos e outras alterações nucleares em
células da mucosa bucal de indivíduosnão-fumantes e fumantes. Revista da Faculdade de Ciências Médica
2003;5(1):43-53.
PORTELA C.H et al. Proteção e qualidade de vida para trabalhadores frentistas de postos de combustíveis no
município de Santarém, PA. Revista Digital 2011; 16(160).
REIS S.R.A et al. Efeito genotóxico do etanol em células da mucosa bucal. Pesqui Odontol Bras 2002;16(3):221-
225.
ROTH D.M et al. Avaliação da genotoxicidade em Cirurgiões Dentistas da cidade de Pelotas-RS Através do
teste de micronúcleos em células esfoliadas da mucosa bucal. Revista Faculdade Odontologia 2002;10(4):
209-214.

34 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

CARACTERIZAÇÃO QUÍMICA DOS CONSTITUINTES DA PRIPRIOCA CYPERUS ARTI-


CULATUS

Andrew Mairom Pereira, Daisy Lima Santos, Danielly Lima Santos, Éden Bruno Sousa da Silva, Waldiney
Pires Moraes, Arimar Chagas Almeida e Cassiano Júnior Saatkamp
FACULDADE DA AMAZÔNIA - UNAMA1, INSTITUTO ESPERANÇA DE ENSINO SUPERIOR - , IESPES2,
FACULDADE DA AMAZÔNIA - , UNAMA3, UNIVERSIDADE FEDERALDO OESTE DO PARÀ - , UFO-
PA4, UNIVERSIDADE FEDERAL DO OESTE DO PARÀ - , UFOPA5, INSTITUTO ESPERANÇA DE ENSI-
NO SUPERIOR - , IESPES6 e INSTITUTO ESPERANÇA DE ENSINO SUPERIOR - IESPES7
andrewmayron@yahoo.com.br

Resumo: A medicina tradicional é uma prática cultural, caracterizada pelo uso de plantas medicinais para
profilaxia, tratamento e cura de diversas doenças. Atualmente muitos grupos de pesquisa estão trabalhando na
busca de novos fármacos de origem vegetal oriundos de metabólitos secundários, pois se ligam a enzimas e
receptores em outros organismos sendo capaz de produzir efeitos farmacológicos. Entre as plantas medicinais
está a Cyperus articulatus L., conhecida popularmente como Priprioca, é uma espécie de capim alto, com
flores miúdas em sua extremidade. Os talos de capim alto escondem sob a terra raízes de fragrância incomum
na forma de pequenos tubérculos que exalam um perfume fresco, amadeirado e picante. Levando em conta
a importância do reconhecimento botânico e químico da planta, a análise da composição química da espécie
é uma etapa crucial da pesquisa cientifica, e nessa perspectiva a presente pesquisa teve como objetivo estu-
dar a caracterização química do óleo essencial de Cyperus articulatus. Foram utilizados rizomas da espécie
Cyperus articulatus coletados na comunidade de Tabocal/Santarém-PA (-54°43’00,10”W e -02°37’41,10”S),
Km 23. A espécie foi identificada pelo botânico Msc. Antônio Elielson Sousa da Rocha, do Museu Paraense
Emilio Goeldi. A amostra de óleo essencial foi cedida pelo Laboratório de de pesquisa de produtos naturais
da Universidade Federal do Oeste do Pará UFOPA. A análise da composição química foi realizada no Cen-
tro pluridisciplinar de Pesquisa Químicas, Biológicas e Agrícolas da Universidade Estadual de Campinas
(UNICAMP), o equipamento utilizado foi o cromatógrafo a gás Agilent, modelo HP-6890 equipado com um
detetor seletivo de massas Agilent, modelo HP-5975. Portanto, a análise do óleo essencial de C. articulatus
mostra que 84,19% dos constituintes analisadosforam identificados. Nove componentes foram encontrados
em maior concentração considerados como majoritários, são eles 4,85% de α-pineno; 3,08% de trans-pinocar-
veol; 4,21% de mirtenol; 6,57% de α-copaeno; 3,29 % de cipereno; 8,45% de β-selineno; 10,65 de mustacona;
3,44% de cis-tujopseno; 6,99% de ciclocolorenona.

Palavras-chave: Cyperus articulatus, óleo essencial, composição química.

Introdução
A medicina tradicional é uma prática cultural, caracterizada pelo uso de plantas medicinais para
profilaxia, tratamento e cura de diversas doenças. As plantas medicinais aumentam a opção terapêutica da
população sem substituir os medicamentos já comercializados (PIMM et al., 2014). Nessa perspectiva, as
plantas medicinais constituem uma fonte promissora para descoberta de novos medicamentos. Atualmente
muitos grupos de pesquisa estão trabalhando na busca de novos fármacos de origem vegetal, principalmente
oriundos de metabolitos secundários, que possuem diversas funções nos vegetais, como defesa contra pre-
dadores, atração de polinizadores e outras. Os metabólitos secundários possuem moléculas que se ligam a
enzimas e receptores em outros organismos sendo capaz de produzir efeitos farmacológicos (DE LA CRUZ
et al., 2014). Dentre as plantas medicinais encontrada na Amazônia destaca-se a Cyperus articulatus perten-
cente à família Cyperaceae descrita por Davidse et al., (1995). É uma família cosmopolita com cerca de 9
gêneros e 4.000 espécies, das quais 845 ocorrem nos neotrópicos, em solos úmidos. A Cyperus articulatus L.,
conhecida popularmente como Priprioca é uma espécie de capim alto, com flores miúdas em sua extremidade.
Os talos de capim alto escondem sob a terra raízes de fragrância incomum na forma de pequenos tubérculos,
quando cortados, exalam um perfume fresco, amadeirado e picante. No Brasil, sobretudo no estado do Pará
são conhecidas como priprioca três espécies pertencentes à família Cyperaceae: A priprioca Cyperus articu-
35 JOVEM PESQUISADOR - PÓS GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

latus. L. var. nodosus, a priprioquinha Cyperus articulatus L. var. articulatus e o Pripriocão Cyperus Prolixus
(CASTELLANI et al., 2011; ZOGHBI et al., 2006). A partir de estudos etnobotânicos surgiu o interesse de
estudar a Cyperus articulatus L. tais estudos apontam o uso desta espécie como anti-inflamatório, sedativo e
anticonvulsivo (CASTELLANI et al., 2011; ZOGHBI et al.,2006). Muito utilizada também como contracep-
tiva, analgésica, no tratamento de diarréias, sedativo e anticonvulsivo (BUM et al., 2003; FORERO-DORIA
et al., 2014; RAKOTONIRINA et al., 2001). Levando em conta a importância do reconhecimento botânico
e químico da planta, a análise da composição química da espécie em estudo é uma etapa crucial da pesquisa
cientifica (YAU et al., 2015). A biodiversidade de plantas na Amazônia faz dela uma potente fonte de recursos
para descoberta de novos fármacos.

Objetivo
Com base no potencial das espécies vegetais encontrada em nossa região e relativamente poucos
estudos que comprovem eficácia e segurança farmacológica, a presente pesquisa teve como objetivo a carac-
terização química do óleo essencial de Cyperus articulatus.

Metodologia
METODOLOGIA Obtenção da amostra vegetal Foram utilizados rizomas da espécie Cyperus ar-
ticulatus coletados na comunidade de Tabocal/Santarém-PA (-54°43’00,10”W e -02°37’41,10”S), Km 23.
A espécie foi identificada pelo botânico Msc. Antônio Elielson Sousa da Rocha, do Museu Paraense Emilio
Goeldi. A amostra de óleo essencial foi cedida pelo Laboratório de produtos naturais da Universidade Federal
do Oeste do Pará UFOPA. Foram coletados 5 kg de rizomas de C. articulatus L. Após a coleta os rizomas fo-
ram submetidos à limpeza, secos por um período de três dias consecutivos e moídos em moinho de facas em
ambiente aberto. Após o período de secagem o material triturado foi submetido à hidrodestilação por arraste a
vapor, em uma dorna de 150 L, com duração de 4 h. Análise cromatográfica A análise da composição química
foi realizada no Centro pluridisciplinar de Pesquisa Químicas, Biológicas e Agrícolas da Universidade Esta-
dual de Campinas (UNICAMP), o equipamento utilizado foi o cromatógrafo a gás Agilent, modelo HP-6890
equipado com um detetor seletivo de massas Agilent, modelo HP-5975. A análise da composição química do
OECA foi realizada em um cromatógrafo a gás Agilent, modelo HP-6890 equipado com um detector seletivo
de massas Agilent, modelo HP-5975 utilizando uma coluna capilar HP-5MS (30m x 0,25mm x 0,25µm) nas
seguintes condições: temperatura do injetor = 250°C, coluna = 80°C, taxa de aquecimento de 5°C/min até
280°C (20 min) e detector = 300°C. Foi utilizado hélio como gás de arraste numa vazão de 1mL/min e detector
seletivo de massas operando a 70 eV, m/z =30 a 500 u.m.a. A identificação dos compostos foi realizada através
da comparação com a biblioteca eletrônica do equipamento (NIST-11).

Resultados e Discussão
RESULTADOS E DISCUSSÃO Um total de 84,19% dos constituintes do óleo essencial de C. articu-
latus foram identificados, a análise da composição química revelou a presença de compostos terpênicos. sendo
50,6% de sesquiterpenos oxigenados, 18,60 % de sesquiterpenos não oxigenados, 9,95% monoterpenos não
oxigenados e 5,04% de monoterpenos oxigenados. Dentre as substâncias identificadas, nove são majoritárias,
apresentando percentuais de concentração maiores que 3% (α-pineno, trans-pinocarveol, α-copaeno, β-seli-
neno, mustacona, cis-tujopseno, cipereno, mirtenol e ciclocolorenona). Em outro estudo realizado com o óleo
essencial, mostra uma composição por terpenos do tipo monoterpenos (α e β-pineno, o monoterpeno aldeídico
α-mirtenal), além dos sesquiterpênicos (α-copaeno, cipereno, β-selineno e (Z)-calameno, α-calacoreno, a ce-
tona sequiterpênica α-ciperona, limoneno, cineol, miternal, espatulenol e óxido-cariofileno) (SOUSA et al.,
2012; ZOGHBI et al., 2006). Nessa perspectiva, os composto presente no óleo essencial exercem propriedades
terapêuticas como antimicrobiano, hepatoprotetora, anticonvulsivante, antitumoral, anti-inflamatório e ansio-
lítica (ALMEIDA et al., 2011; HUANG et al., 2012; KREUGER et al., 2012).

Considerações Finais
CONSIDERAÇÕES FINAIS Portanto, a análise do óleo essencial de C. articulatus mostra que
84,19% dos constituintes analisados foram identificados. Nove componentes foram encontrados em maior
concentração considerados como majoritários, são eles 4,85% de α-pineno; 3,08% de trans-pinocarveol;
4,21% de mirtenol; 6,57% de α-copaeno; 3,29 % de cipereno; 8,45% de β-selineno; 10,65 de mustacona;
36 JOVEM PESQUISADOR - PÓS GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

3,44% de cis-tujopseno; 6,99% de ciclocolorenona.

Referências
REFERÊNCIAS 1. BUM, E. N., RAKOTONIRINA, A., RAKOTONIRINA, S. V., HERRLING, P. Effects
of Cyperus articulatusL compared to effects of anticonvulsant compounds on the cortical wedge, Journal of
Ethnopharmacology, 87, p. 28, 27-34, 2003.
CASTELLANI D. C. et al. Coeficientes técnicos de produção da priprioca (Cyperus articulatus L.) em sistema
orgânico na região de Belém (PA). Rev. Bras. Pl. Med., Botucatu, v.13, especial, p.606-611, 2011.
DAVIDSE, G. SOUZA M.S; CHATER A.O. Flora Mesoamericana 6-Alismataceae a Cyperaceae. Nordic
Journal of Botany, v. 15, n. 5, p. 512-512, 1995.
DE LA CRUZ, M.G.,MALPARTIDA, S.B., SANTIAGO, H.B., JULLIAN, V., BOURDY, G. Hot and cold:
medicinal plant uses in Quechua speaking communities in the high Andes (Callejón de Huaylas, Ancash,
Perú). J. Ethnopharmacol. 155:1093–1117. , 2014.http://dx.doi.org/10. 1016/j.jep.2014.06.042.
FORERO-DORIA, O., ASTUDILLO, L., CASTRO, R. I., LOZANO, R., DÍAZ, O., GUZMÁN-JOFRE, L.,
GUTIERREZ, M. Antioxidant activity of bioactive extracts obtained from rhizomes of Cyperus digitatus
Roxb.Boletín Latinoamericano y del Caribe de Plantas Medicinales y Aromáticas 13(4) 344-350, 2014.
PIMM et al.. The biodiversity of species and their rates of extinction, distribution, and protection. Science 344,
987-996, 2014.
RAKOTONIRINA, S. V., NGO BUM, E., RAKOTONIRINA, A., BOPELET, M., Sedatives properties of the
decoction of the rhizome of Cyperus articulatus. Fitoterapia, 72, 22–29, 2001.
YAU, W., GOH, C. H., KOH, H. L. Quality control and quality assurance of phytomedicines: Key considera-
tions, methods, and analytical challenges. Phytotherapies: efficacy, safety, and regulation, v. 18, 2015.
ZOGHBI, M.G., ANDRADE, E.H., OLIVEIRA, J., CARREIRA, L.M., GUILHON, G.M.S.P. Yield and che-
mical composition of the essential oil of the stems and rhizomes of Cyperus articulatus L. cultivated in the
state of Pará, Brazil. Journal of Essential Oil Research, 18: 10-12, 2006.

37 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

TEOR E IDENTIFICAÇÃO DOS CONSTITUINTES QUIMICOS DO ÓLEO ESSENCIAL


(OE) DE LIPPIA ORIGANOIDES KUNTH (VERBENACEAE)

Vanessa Vinente De Oliveira, Rosa Helena Veras Mourão, Laboratório de Bioprospecção e Biologia Experi-
mental e Gabriel Castelo Branco Lauffer
Universidade Federal do Oeste do Pará - UFOPA1 , Universidade Federal do Oeste do Pará - , UFOPA2,
Universidade Federal do Oeste do Pará - , UFOPA3 e Universidade do Estado do Pará - e UEPA4
vanessavinente@gmail.com

Resumo: Lippia origanoides Kunth (Verbenaceae), conhecida popularmente como salva-de-Marajó ou ale-
crim d’angola é uma planta que possui grande importância medicinal devido aos componentes químicos pre-
sentes no óleo essencial. Estudos anteriores do nosso grupo têm demostrado o seu potencial antimicrobiano e
antioxidante. Visando contribuir para um maior controle da composição química volátil desta espécie devido
as diferentes variáveis que influenciam direta e indiretamente em sua produção, o objetivo deste trabalho foi
avaliar o teor e caracterização química do óleo essencial de L. origanoides. Partes aéreas (folhas e ramos finos)
de plantas adultas de L. origanoides foram coletadas no município de Oriximiná-PA de setembro a dezembro
de 2017. O óleo essencial foi obtido por hidrodestilação com rendimento médio de 3,5%, sendo posterior-
mente analisado por cromatografia gasosa acoplada a espectrometria de massas. De um total 108 componen-
tes identificados, os terpenóides Carvacrol (33,03%) e o Timol (9,81%) destacaram-se como constituintes
majoritários correspondendo como os mesmos constituintes identificados na composição química da espécie
coletada em Santarém. Estes resultados estimulam a continuidade dos estudos bem como o desenvolvimento
de formulações com potencial antimicrobiano ou antioxidantes.

Palavras-chave: Verbenaceae,óleos essenciais,produtos naturais.

Introdução
Durante séculos as informações sobre as virtudes terapêuticas das plantas foram acumuladas e disse-
minadas entre gerações de comunidades tradicionais e grupos étnicos em todo o mundo, inclusive no território
brasileiro, especialmente na região amazônica. Ribeiro et al. (2009) ressaltam a existência de uma imensurável
diversidade vegetal com propriedades medicinais que durante milênios são utilizadas em sociedades nativas
da Amazônia. Partindo da necessidade de amparar a saúde das populações a fitoterapia intrinsecamente asso-
ciada à medicina surge como alternativa de baixo custo econômico e fácil acesso. Santos (2010) ressalta que o
estreitamento da relação entre a (bio)química e a medicina, estabelecido a partir de conhecimentos tradicionais
relacionados à manipulação de plantas consagradas pelo uso popular, possibilitou a introdução de inúmeras
espécies de plantas nativas como opção terapêutica para uma parcela crescente da população – rural e urbana.
A Organização Mundial da Saúde – OMS (2013) afirma que aproximadamente 4 bilhões de pessoas, ou seja,
80% da população mundial utiliza preparações à base de plantas como forma de preservação primária da saú-
de. Em alguns países industrializados, como Canadá, França, Alemanha e Itália, 70% a 90% de sua população
também utilizam recursos da medicina tradicional de forma significativa, segundo a WHO (2011). O Brasil
dispõe de uma diversidade imensurável em sua flora e exige, no cenário hodierno, maiores investigações acer-
ca do potencial terapêutico de suas espécies. O mercado de fitofármacos tem-se mostrado promissor devido a
grande abrangência de produtos constituídos a partir dos vegetais. Os estudos realizados por Queires & Rodri-
gues (1998); Aherne & O’Brien (1999); Djuric et al. (2001); Johann et al. (2010) corroboram ao demonstrar
que os vegetais são capazes de produzir uma extensa variedade de compostos químicos: terpenos, lectinas, sa-
poninas, compostos fenólicos, flavonóides e alcaloides, onde seus princípios ativos expressam relevante atua-
ção em atividades biológicas de ação anticarcinogênica, antibacteriana, antiviral, antifúngica, antinflamatória,
antiulcerogênica, anti-hipertensiva e hipolipidêmica. Os óleos essenciais de plantas medicinais, por exemplo,
têm sido utilizados de forma ampla, com multifuncionalidades. Segundo Rocha (2016), são empregados na
perfumaria, na produção de cosméticos, na indústria farmacêutica, na odontologia, na agricultura orgânica e
na medicina, a partir de estudos acerca de seus componentes químicos e identificação do potencial de suas pro-

38 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

priedades. Vicuña et al. (2010), Oliveira et al. (2014), Guimarães et al. (2014), Queiroz et al. (2014) e Andrade
et al. (2014) ressaltam as potencialidades - principalmente antimicrobiana e antisséptica - do óleo essencial de
um arbusto aromático utilizado na medicina tradicional brasileira: a Lippia origanoides Kunth (Verbenaceae).
De acordo com Rocha (2016), o óleo essencial da Lippia origanoides Kunth apresenta timol e carvacrol como
compostos majoritários, principais responsáveis pelas propriedades antifúngica, antibacteriana, acaricida, in-
seticida e anti-inflamatória, também expressadas pela sinergia entre os inúmeros componentes químicos que a
planta é capaz de produzir. A identificação da capacidade antimicrobiana do óleo essencial de Lippia origanoi-
des representa impacto positivo para o desenvolvimento de novas alternativas de produtos terapêuticos com
aplicabilidade na saúde humana, haja vista que o uso de drogas antimicrobianas como barreiras adicionais,
tem suportado cada vez menos o efetivo controle de agentes patogênicos. Bajpai et al. (2012) ressaltam que
a resistência conferida a esses agentes antimicrobianos tem levado à busca por novas alternativas no controle
de microrganismos. À luz de Da Cunha (2015), compreende-se que apesar dos inúmeros efeitos benéficos
expressados pela prática fitoterápica, para a grande maioria das plantas medicinais conhecidas e manipuladas,
inexistem evidências laboratoriais e clínicas comprobatórias de eficácia e segurança. Ademais, Tomazzoni et
al., (2006) acrescenta que o emprego dessas plantas - sem orientação adequada - torna-se um fator de preocu-
pação a ser considerado por profissionais do setor de saúde, devido a dificuldade de (re)conhecer, apenas por
senso comum, a toxicidade e contraindicações da terapêutica. Dessarte, contribuindo para o preenchimento de
lacunas no conhecimento acerca do potencial terapêutico de plantas medicinais da região Norte do Brasil e,
considerando a crescente necessidade de substituição de agentes microbianos convencionais, perquirir sobre o
potencial antimicrobiano expressado pelo óleo essencial (OE) de Lippia origanoides Kunth, conhecida popu-
larmente como “sálvia do Marajó” ou “alecrim d’angola”, ¬ faz-se cada vez mais necessário, o que pode levar
à proposição de uma cadeia produtiva baseada no cultivo ou manejo sustentável da espécie; maior estímulo a
identificação da composição química e da atividade terapêutica das plantas utilizadas na medicina popular da
Amazônia. Ademais, estimula a bioprospecção de novas substâncias, a partir de fontes naturais, em particular
da Lippia origanoides Kunth.

Objetivo
Avaliar o teor e caracterização química do óleo essencial de L. origanoides Kunth.

Metodologia
As partes aéreas (folhas e ramos finos) de plantas adultas de L. origanoides foram coletadas no
município de Oriximiná-PA nos meses de setembro a dezembro de 2017, no período da manhã, em dia seco,
evitando danos mecânicos e lesões. A extração do óleo essencial ocorreuno Laboratório de Bioprospecção e
Biologia Experimental – LabBBEx, localizado no Campus Tapajós da Universidade Federal do Oeste do Pará
(UFOPA). Após a secagem em temperatura ambiente, o material vegetal foi submetido à hidrodestilação em
aparelho tipo Clevenger, sob a temperatura de 150°C por 2:40 horas, método recomendado pela Farmacopeia
Brasileira (Brasil, 2010). O óleo essencial obtido foi acondicionado em recipiente de vidro livre de impurezas.
Para dessecar as possíveis gotas de água presente no óleo, será utilizado Na2SO4 (sulfato de sódio anidrido)
e submetido à centrifugação (SIGMA3-18K). Posteriormente, serão descritas as características organolépticas
e o rendimento do OE obtido. A análise química do óleo essencial será realizada em cromatógrafo gasoso
(CG-EM-6890 Plus Series) equipado com detector seletivo de massa (Agilent, MSD 5973) e um amostrador
automático (Agilent, 7863). Os componentes químicos dos óleos essenciais serão identificados por compa-
ração dos espectros de massas e índices de retenção com os relatados na literatura para os componentes mais
comuns de óleos essenciais (Adams, 2007).

Resultados e Discussão
As características medicinais e/ou aromáticas associadas às espécies de Verbenaceae decorrem da sín-
tese e do acúmulo de metabólitos devido a abundante presença de tricomas glandulares em órgãos vegetativos
e reprodutivos das plantas. (Pascual et al., 2001; Judd et al., 2009; Souza, 2015) O gênero Lippia, por exemplo,
representa cerca de 200 espécies entre ervas, arbustos e árvores de pequeno porte distribuídas na América do
Norte, América Central, América do Sul, regiões tropicais da África e na Austrália (Pascual et al., 2001; Lin-
de et al., 2010; Gomes, Nogueira e Moraes, 2011). A composição química de óleos essenciais de Lippia spp.
além de ser determinada por fatores genéticos, a exposição dessas plantas em fatores como a disponibilidade
39 JOVEM PESQUISADOR - PÓS GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

de água, a luminosidade, a temperatura, o estágio de desenvolvimento da planta e o seu estado nutricional,


pode acarretar alterações significativas na produção de seus metabólitos secundários (Souza, 2015). Partindo
deste pressuposto, é válido inferir que o número de compostos químicos identificados na amostra utilizada
neste estudo pode estar associado às condições ambientais a que a planta esta exposta. Entre as espécies de Li-
ppia, os principais componentes voláteis encontrados, com maior frequência são: timol, carvacrol, 1,8-cineol,
limoneno, p-cimeno, linalol, α-pineno, β-cariofileno. Entretanto, a composição química dos óleos essenciais
produzidos entre as espécies podem sofrer variações. A Lippia origanoides Kunth, por exemplo, apresentam
como constituintes majoritários o p-cimeno, α-e γ-terpineno, timol, carvacrol, β-cariofileno, α-felandreno e
δ-careno (Oliveira et al., 2007; Stashenko et al., 2008; Soares, 2016). Corroborando com estudos já realizados,
foram identificados 108 compostos constitutivos do óleo essencial de Lippia origanoides. Dentre os quais há
maior concentração dos terpenóides: Carvacrol (33,03%) e Timol (9,81%). Nostro et al. (2004), Ramirez et al.
(2009) e Sarrazin et al. (2015a, 2015b) descrevem resultados semelhantes e associam o efeito antimicrobiano,
expressado pelo OE de l. origanoides, à presença dos compostos químicos, timol e carvacrol. A ação antimi-
crobiana atribuída aos óleos essenciais de l. origanoides pode ser superior à de fármacos-controles utilizados
em protocolos in vitro (Oliveira et al., 2006; Oliveira et al., 2007; Nogueira et al., 2007; RAMIREZ et al.,
2009; Sarrazin et al., 2012; Zare et al., 2012; Fontenelle et al., 2007), representando um potencial candidato a
agente antimicrobiano frente a microrganismos que desenvolvem mecanismos de resistência. Quanto ao valor
médio do teor de óleo essencial obtido de partes aérea desidratada de Lippia origanoides, pode-se considerar
que o OE expressa alto rendimento (3,5 ± 0,5%). Sendo este, determinado pela razão entre o volume obtido na
hidrodestilação por sua respectiva massa empregada no processo, multiplicada por 100.

Considerações Finais
Os resultados, deste estudo, representem uma expressiva contribuição para a caracterização da ati-
vidade antimicrobiana das plantas utilizadas na medicina popular da Amazônia, em particular da Lippia ori-
ganoides Kunth, a fim de colaborar com a bioprospecção de novas substâncias, a partir de fontes naturais.
Representa, ainda, relevância diante da população - que passar a ter maior valorização e representatividade
no que diz respeito à medicina popular - e da comunidade científica ao contribuir para o preenchimento de
lacunas no conhecimento acerca do potencial terapêutico de plantas medicinais da região Norte do Brasil, em
especial, às potencialidade da Lippia origanoides Kunth.

Referências
AHERNE, S.A. & O’BRIEN, N.M. The flavonoids, myricetin, quercetin and rutin, protect against choles-
tan-3β,5α,6β-triol – induced toxicity in chinese hamster ovary cells in vitro. Nutr. Res., v.19, n.5, p.749-760,
1999.
ANDRADE, V.A.; ALMEIDA, A.C.; SOUZA, D.S.; COLEN, K.G.F.; MACÊDO, A.A.; MARTINS, E.R.;
FONSECA, F.S.A. & SANTOS, R.L. Antimicrobial activity and acute and chronic toxicity of the essential oil
of Lippia origanoides. Pesq. Vet. Bras. 34(12):1153-1161, 2014.
BAJPAI, V.K.; BAEK K-H.; KANG, S.C. Control of Salmonella in foods by using essential oils: A review.
Food Research International, 45: 722-734, 2012.
DA CUNHA, M.L.D.M.; Silva, M.S.F.; Marçal. Q. P.; Dellacqua, M.N.; Diniz, M.F.F.M. Ensaio toxicológico
clínico fase i com o antiviral tópico celodenina no tratamento de herpes labial recorrente. Rev. Ciênc. Saúde
Nova Esperança.13(1):4-12, 2015
DJURIC. Z., CHEN, G., DOERGE, D.R., HEILBRUN, L.K., KUCUK, O. Effect of soy isoflavone supple-
mentation on markers of oxidative stress in men and women. Canc. Letters, v.172, p.1-6, 2001.
FONTENELLE, R. O. S.; MORAIS, S. M.; BRITO, E. H. S.; KERNTOPF, M. R.; BRILHANTE, R. S. N.;
CORDEIRO, R. A.; TOMÉ, A. R.; QUEIROZ, M. G. R.; NASCIMENTO, N. R. F.; SIDRIM, J. J. C.; RO-
CHA, M. F. G. Chemical composition, toxicological aspects and antifungal activity of essential oil from Lip-
pia sidoides Cham. Journal of Antimicrobial Chemotherapy, v. 59, p. 934-940, 2007.
GOMES, S. V. F.; NOGUEIRA, P. C. L.; MORAES, V. R. S. Aspectos químicos e biológicos do gênero Lippia
enfatizando Lippia gracilis Schauer. Eclética Química, São Paulo, v. 36, n. 1, p.64-77, 2011. Disponível em:

40 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

<http://www.scielo.br/pdf/eq/v36n1/a05v36n1.pdf>. Acesso em: 12 de Maio de 2017.


GUIMARÃES, L.G.L.; CARDOSO, M.G.; SOUZA, R.M.; ZACARONI, A.B. & SANTOS, G.R. Óleo essen-
cial de Lippia sidoides nativas de Minas Gerais: composição, estruturas secretoras e atividade antibacteriana.
Revta Ciênc. Agron. Centro Ciênc. Agrárias 45(2):267-275, 2014
JOHANN, S.; SÁ, N.P.; LIMA, L. A.; CISALPINO, P.; COTA, B.B.; ALVES, T.M.A.; SIQUEIRA, E.P.;
ZANI, C.L. Antifungal activity of schinol and a new biphenyl compound isolated from Schinus terebinthifo-
lius against the pathogenic fungus Paracoccidioides brasiliensis. Annals of Clin. Microbiol. Antimicrob., v.9,
n.30, p.01-06, 2010.
JUDD, W.S.; CAMPBELL, C.S.; KELOGG, E.A.; STEVENS, P.F.; DONOGHUE, M.J. Sistemática Vegetal:
um enfoque filogenético. 3ª ed. Porto Alegre: Artmed, p.612, 2009.
NOSTRO, A.; BLANCO, A.R.; CANNATELLI, M.A.; ENEA, V.; FLAMINI, G.; MORELLI, I.; ROCCARO,
A.S.; ALONZO, V. Susceptibility of methicillin-resistant staphylococci to oregano essential oil, carvacrol and
thymol. FEMS Microbiology Letters, 230,191–195, 2004.
OLIVEIRA, D. R., G. G. LEITÃO, S. S. SANTOS, H. R. BIZZO, D. LOPES, C. S. ALVIANO, D. S. AL-
VIANO, S. G. LEITÃO, J. Ethnopharmacological study of two Lippia species from Oriximiná, Brazil. Eth-
nopharmacol. p. 103-108. 2006. Disponível em: <ftp://www.ufv.br/DBG/Filogenia_molecular/usuarios/karla/
Lyderson/2010/artigos/quimica/Oliveira2006.pdf> Acesso em:23 de Março de 2017.
OLIVEIRA, D.R.; LEITÃO, G.G.; BIZZO, H.R.; LOPES, D.; ALVIANO, D.S.; ALVIANO, C.S.; LEITÃO,
S.G. Chemical and antimicrobial analyses of essential oil of Lippia origanoides H.B.K. Food Chemistry, 101:
236-240, 2007.
OLIVEIRA, M.L.M.; BEZERRA, B.M.O.; LEITE, L.O.; GIRÃO, V.C.C. & NUNES-PINHEIRO, D.C.S.
Topical continuous use of Lippia sidoides Cham. essential oil induces cutaneous inflammatory response, but
does not delay wound healing process. J. Ethn. 153(1):283-289, 2014. OMS. Novas diretrizes da OMS para
promover o uso adequado de medicamentos tradicionais, 2013. Disponível em: http://www.who.int/medica-
centre/news/releases/2004/Pr44/en/ Acesso em: 22 de março de 2017.
PASCUAL, M.E.; SLOWING, K.; CARRETERO, E.; MATA, D. S.; VILLAR, A. Lippia: traditional uses,
chemistry and pharmacology: a review. Journal of Ethnopharmacology, 76: 201- 214, 2001.
QUEIRES, L.C.S. & RODRIGUES, L.E.A. Quantificação das substâncias fenólicas totais em órgãos da aroei-
ra Schinus terebenthifolius (Raddi). Braz. Arch. Biol. Technol., v.41,n.2, p.247-253,1998
QUEIROZ, M.R.A.; ALMEIDA, A.C.; ANDRADE, V.A.; LIMA, T.S.; MARTINS, E.R.; FIGUEIREDO, L.S.
& CARELI, R.T. Avaliação da atividade antibacteriana do óleo essencial de Lippia organoides frente à Sta-
phylococcus sp. isolados de alimentos de origem animal. Revta Bras. Plantas Medic. 16(3):737- 743, 2014.
RAMIREZ, L. S.; ISAZA, J. H.; VELOZA, L. Á.; STASHENKO, E.; MARIN, D. Actividad anti-
bacteriana de aceites esenciales de Lippia origanoides de diferentes orígenes de Colombia. Cien-
cia., vol.17, n.4, 2009. Disponível em: <http://www2.scielo.org.ve/scielo.php?script=sci_arttext&pi-
d=S1315-20762009000400006&lng=es&nrm=i>. Acesso em: 03 maio. 2017.
RIBEIRO, C.M.; SOUZA, K.G.S.; RIBEIRO, T.A.C.; VIEIRA, A.B.R.; MENDONCA, L.C.V.; BA RBOSA,
W.L.R.; VIEIRA, J.M.S. Avaliação da atividade antimicrobiana de plantas utilizadas na medicina popular da
Amazônia. Infarma, v.21, nº 1/2, 2009.
ROCHA, NORMA MORAES DA SILVA. Extração e análise do óleo essencial do Alecrim-Pimenta (Lippia
sidoides - origanoides Kunth) com fins de uso em cultivo orgânico. [Monografia] Universidade de Rio Verde
– UniRV. Rio Verde-GO, 2016.
SANTOS C. V. C. Avaliação do efeito dos extratos aquoso e metanólico da Schninus terebinthifolius, Raddi
(Aroeira) sobre culturas de esplenócitos murinos e sobre a bactéria Corynebacterium pseudotuberculosis. Tese
[Doutorado]. Salvador, 2010.
SARRAZIN, S.L.F.; OLIVEIRA, R.B.; BARATA, L.E.S.; MOURÃO, R.H.V. Chemical composition and
antimicrobial activity of the essential oil of Lippia grandis Schauer (Verbenaceae) from the western Amazon.
41 JOVEM PESQUISADOR - PÓS GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

Food Chemistry, 134: 1474-1478, 2012.


SARRAZIN, S.L.; DA SILVA, L.A.; DE ASSUNÇÃO, A.P.; OLIVEIRA, R.B.; CALAO, V.Y.; DA SILVA,
R.; STASHENKO, E.E.; MAIA, J.G.; MOURÃO, R.H. Antimicrobial and seasonal evaluation of the carva-
crol-chemotype oil from Lippia origanoides Kunth. Molecules. v.2, p.1860-71. 2015. Disponível em: <http://
www.ncbi.nlm.nih.gov/pubmed/25625681> Acesso em: 29 Março de 2017.
SARRAZIN, S.L., SILVA, L.A., OLIVEIRA, R.B., RAPOSO, J.D.A., SILVA, J.K.R., SALIMENA, F.R.G.,
MAIA, J.G.S., MOURÃO, R.H.V. Antibacterial action against food-borne microorganisms and antioxidant
activity of carvacrol-rich oil from Lippia origanoides Kunth. Health and Disease, 14:145, 2015. SOARES,
B. V. Efeitos antiparasitários e fisiológicos de Lippia spp. (Verbenaceae) em Colossoma macropomum e uso
dessas plantas na medicina veterinária e aquicultura, 137f. [Tese Doutorado] - Fundação Universidade Federal
do Amapá. Macapá, AP, 2016. Disponível em: <http://www2.unifap.br/ppgbio/files/2016/07/TESE-BRUNA-
-VIANASOARES-PPGBIO-2012-A-2016.pdf>. Acesso em: 13 maio de 2017.
SOUZA, L. M. Flavonoides totais, atividade antioxidante e variação sazonal da composição química do óleo
essencial de alecrim-pimenta (Lippia origanoides Kunth.). [Dissertação Mestrado] Universidade Federal de
Minas Gerais. Montes Claros, MG: ICA/UFMG, 2015.
STASHENKO, E.; RUIZ, C.; MUNOZ, A.; CASTANEDA, M.; MARTINEZ, J. Composition and antioxidant
activity of essential oils of Lippia origanoides H. B. K. grown in Colombia. Natural Product Communications
3: 563-566., 2008.
TOMAZZONI MI, NEGRELLE RRB, CENTA ML. Fitoterapia popular: a busca instrumental enquanto prá-
tica terapêutica. Texto & Contexto Enferm. Florianópolis 2006; 15(1):115-21.
VICUÑA, G.C.; STASHENKO, E.E.; FUENTES, J.L. Chemical composition of the Lippia origanoides essen-
tial oils and their antigenotoxicity against bleomycin-induced DNA damage. Fitoterapia, 81: 343-349, 2010.
WORLD HEALTH ORGANIZATION (WHO). Regional office for the Western Pacific. The world medicines
situation 2011: traditional medicines: global situation, issues and challenges. Geneva: WHO, 2011. 12p.
ZARE, Z.; MAJD, A.; SATTARI, T. N.; IRANBAKHSH, A.; MEHRABIAN, S. Antimicrobial activity of leaf
and flower extracts of Lippia nodiflora L. (Verbenacea). Journal of Plant Protection Research, v. 52, n. 4, p.
401-403, 2012.

42 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO QUALITATIVA DOS PRINCIPAIS SOFTWARES UTILIZADOS EM FOTO-


GRAMETRIA COMPUTADORIZADA

Rodrigo Luis Ferreira da Silva e Cassius Cley Xabregas Xabregas


Universidade do Estado do Pará - UEPA1 e HOSPITAL REGIONAL DO BAIXO AMAZONAS - e HRBA2
rodrigolfs@uepa.br

Resumo: Introdução: A fotogrametria computadorizada é um processo prático, confiável e que vem tornan-
do-se bastante popular na prática avaliativa fisioterapêutica. No entanto a maioria dos softwares empregados
para a análise fotogramétrica não foram desenvolvidos especificamente para este fim. Objetivo: Identificar
as principais vantagens e desvantagens de softwares de análise fotogramétrica e propor parâmetros objetivos
para a construção de um software específico para esta aplicação. Metodologia: Um treinamento teórico-prá-
tico prévio foi realizado com intuito de capacitar voluntários quanto à avaliação angular por fotogrametria
computadorizada. Após este treinamento um grupo de seis indivíduos foi selecionado para compor o grupo
de examinadores. Primeiramente o grupo de examinadores foi solicitado a realizar análises fotogramétricas
(utilizando os softwares CorelDraw®, AutoCAD® e ImageJ®) para obter os valores angulares do cotovelo,
de imagens de um modelo que foi fotografado com seu cotovelo em diferentes posições. Foram três dias, não
consecutivos, de análise destas imagens e ao final do terceiro dia procedeu-se a entrega de um questionário
com perguntas abertas quanto ao uso dos softwares, onde os examinadores expressavam sua opinião quanto
aos aspectos positivos e negativos de cada software. A análise qualitativa das opiniões dos examinadores en-
volveu a técnica da análise de conteúdo e “categorização”. Resultados: O CorelDraw® destacou-se por: prati-
cidade; permitir comandos através de atalhos; ser “preciso” ao localizar o centro dos marcadores de superfície.
O AutoCAD® teve como vantagens: simplicidade ao selecionar as linhas para a angulação; disponibilizar o
resultado em números inteiros. O ImageJ® impressionou devido: praticidade; rapidez nas análises; permitir
selecionar várias imagens sem perder sua ordem. O CorelDraw® recebeu avaliações negativas por: ocupar
grande quantidade de bytes de memória; excesso de ícones/ferramentas. O AutoCAD® não foi bem avalia-
do por: ocupar grande quantidade de bytes de memória; não aceitar comandos por atalhos no teclado; não
permitir a seleção de várias imagens para análise. O ImageJ® recebeu considerações negativas por: ter uma
ferramenta zoom de pouca qualidade; trabalhar com a janela de exibição da imagem separada das janelas de
ferramenta e de resultados. Conclusões: Os relatos dos examinadores definiram que um software para análise
fotogramétrica deve possuir: “barra de ferramentas” simples e de fácil acesso; ferramenta que marque e encon-
tre o centro de marcadores; zoom que possa ser movido com a barra de rolagem; mecanismo de mensuração
do ângulo de forma simples e precisa; janela de apresentação de resultados sobre à imagem analisada; e não
ocupar grande espaço de memória digital.

Palavras-chave: Fotogrametria, Processamento de imagem assistida por computador, software.

Introdução
A fotogrametria computadorizada é uma tecnologia que permite a análise métrica digital de imagens
fotográficas, obtidas de forma padronizada, e sobre as quais se realiza a identificação de pontos para a mensu-
ração de comprimentos, ângulos e áreas (BARAÚNA; RICIERI, 2002). É considerado um processo prático,
confiável e que necessita basicamente de computador com software que permita a análise métrica de imagens
digitais, câmera fotográfica, tripé e marcadores de superfície, para o seu emprego. O uso desta técnica pode
ser aplicado nas mais variadas áreas do conhecimento, desde a engenharia aeroespacial até mesmo a medicina,
e vem se tornando cada vez mais popular na prática avaliativa fisioterapêutica, onde a análise das imagens é
realizada por meio de variados softwares, dentre os quais se destacam CorelDraw®, AutoCAD® e ImageJ®,
como os mais empregados em pesquisas científicas. No entanto a maioria dos softwares empregados para a
análise fotogramétrica não foram desenvolvidos especificamente para este fim, sendo esta a situação problema
que motivou a realização desta pesquisa.

43 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

Objetivo
A partir desta percepção decidiu-se por realizar uma investigação qualitativa para constatar a usa-
bilidade dos principais softwares utilizados em fotogrametria computadorizada, a fim de enumerar as prin-
cipais vantagens e desvantagens de cada um destes softwares e assim propor parâmetros objetivos para a
construção de um software específico para esta aplicação.

Metodologia
Após sua aprovação por um comitê de ética (Parecer no: 2.124.527), o estudo foi desenvolvido no
campus XII da Universidade do Estado do Pará, no período de março a outubro de 2017. Um treinamento
teórico-prático prévio sobre fotogrametria computadorizada foi realizado para acadêmicos dos últimos anos
do curso de Fisioterapia desta instituição, com intuito de capacitá-los quanto à aplicação das técnicas de
avaliação angular por fotogrametria computadorizada e quanto ao uso adequado dos softwares CorelDraw®,
AutoCAD® e ImageJ®, para esta análise. Após o período de treinamento um grupo de seis acadêmicos que
participaram desta capacitação, foi selecionado para compor o grupo de examinadores desta pesquisa. Vale
ressaltar que todos estes seis participantes concordaram em colaborar com esta pesquisa de forma voluntária
e assinaram a um termo de consentimento livre e esclarecido. Na primeira etapa da pesquisa o grupo de exa-
minadores foi solicitado a realizar análises fotogramétricas de várias imagens obtidas de um modelo que teve
o seu cotovelo fotografado em diferentes posições angulares. Foram três dias, não consecutivos de análise fo-
togramétrica das imagens (intervalos de 5 dias entre os mesmos), em que os examinadores, utilizando os seus
próprios computadores pessoais, obtinham os valores de amplitude articular do cotovelo, das várias imagens
fotográficas que foram disponibilizadas. Vale ressaltar que todas as imagens disponibilizadas para os examina-
dores eram analisadas com cada dos softwares de interesse para esta investigação (CorelDraw®, AutoCAD®
e ImageJ®). Ao final do terceiro dia de análises fotogramétricas, com os três diferentes softwares, procedeu-
-se a entrega aos examinadores de um questionário com perguntas abertas quanto ao uso dos softwares. As
perguntas deste questionário requisitavam aos examinadores que expressassem sua opinião sincera e honesta
quanto aos aspectos positivos e negativos de cada um dos softwares investigados. Vale ressaltar que, durante
a aplicação do questionário, houve a orientação para que os examinadores não dialogassem entre si. A análise
qualitativa das opiniões dos examinadores envolveu a técnica da análise de conteúdo e “categorização”, reco-
mendada por Oliveira (2016). Neste processo os pesquisadores primeiramente selecionaram os trechos mais
significativos de cada uma das respostas de cada examinador. Em seguida estes trechos foram agrupados de
acordo com os seus significados, ou seja, buscando identificar trechos com significados similares. Por fim os
pesquisadores passaram a construir um quadro no qual cada grupo de trechos com conteúdos ou significados
similares foram categorizados de acordo com os pressupostos teóricos conhecidos.

Resultados e Discussão
Com relação às vantagens de cada software, o CorelDraw® se destacou entre os examinadores pelo
seu fácil manuseio, por permitir comandos através de atalhos e principalmente por ser “preciso” ao localizar
o centro dos marcadores de superfície ao traçar linhas com o uso da ferramenta “linha de dois pontos”. O uso
desta ferramenta na análise fotogramétrica com o CorelDraw® já vem sendo destacada em diversos estudos
como de Ferreira da Silva et al (2009), Coelho et al (2006) e Faber (2005). Já o AutoCAD®, teve como vanta-
gens destacadas, a sua simplicidade ao selecionar as linhas para a angulação e a capacidade de disponibilizar o
valor angular em números inteiros. O software ImageJ®, por sua vez, impressionou os examinadores pela sua
interface simples e praticidade, pela sua rapidez nas análises, assim como também por permitir selecionar vá-
rias imagens sem perder a ordem na qual elas estão dispostas na pasta arquivo digital. Estas vantagens podem
também ser facilmente percebidas nas pesquisas de Abreu (2009) e Cesaro Jr e Pedrini (2005) que citam o sof-
tware ImageJ® como muito simples e ágil. Em se tratando de desvantagens o CorelDraw® recebeu avaliações
negativas por ocupar uma grande quantidade de bytes na memória dos computadores, chegando interromper o
funcionamento (“travar”) de algumas máquinas e por ter um excesso de ícones/ferramentas. Vale ressaltar que
em um estudo semelhante, de Amazonas (2010), todos estes mesmos aspectos também foram mencionados
como desvantagens para o uso deste software em análises fotogramétricas. O AutoCAD® também não foi
bem avaliado por ocupar uma grande quantidade de bytes na memória de computadores, assim como também
por não aceitar comandos através de atalhos no teclado e por não permitir a seleção de mais de uma imagem
44 JOVEM PESQUISADOR - PÓS GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

para análise, gerando contratempos aos examinadores e prolongando o processo de avaliação das imagens.
Contudo apesar destas criticas dos examinadores, deve-se salientar que o AutoCAD® é um dos softwares mais
largamente empregados em pesquisas científicas (RIPKA et al, 2014; RICIERI; ROSÁRIO FILHO, 2008;
GORRERI et al, 2010; FERREIRA DA SILVA et al, 2012). Já o software ImageJ® recebeu considerações ne-
gativas por ter uma ferramenta zoom de pouca qualidade, e por trabalhar com a janela de exibição da imagem
a ser analisada separada das janelas de ferramenta e do resultado do valor angular.

Considerações Finais
Analisando-se as respostas obtidas no presente estudo, pode-se concluir que software CorelDraw®
foi mais bem aceito pelos examinadores e considerado como mais prático para a análise por fotogrametria
computadorizada. É possível concluir também que, segundo os examinadores que participaram desta investi-
gação, um software ideal para a análise fotogramétrica deve: a) apresentar uma “barra de ferramentas” de fácil
acesso e sem muitos ícones; b) apresentar uma ferramenta que marque e encontre o centro dos marcadores de
superfície, c) possuir ferramenta zoom que possa ser movida com a barra de rolagem (evitando assim que o
examinador necessite ampliar ou diminuir a imagem diversas vezes) e que não reduza a qualidade da imagem;
d) possuir mecanismo de mensuração do ângulo de forma simples e precisa, preferencialmente dispensando a
construção de linhas sobre a imagem digital; e) apresentar janela de apresentação do resultado do valor angu-
lar sobre à imagem analisada; f) não ocupar grande espaço de memória digital.

Referências
ABREU, E.M.C. Influência do método de Reeducação Postural Global (RPG) sobre a postura, a flexibilidade,
e o sistema cardiovascular de indivíduos adultos jovens saudáveis. São José dos Campos: 2009. Dissertação
de Mestrado apresentada ao Programa de Pós-Graduação em Engenharia Biomédica do instituto de Pesquisa
e Desenvolvimento da Universidade Vale do Paraíba.
AMAZONAS, D. R. Padronizações para avaliação em fotogrametria computadorizada: posicionamento de
câmera e utilização de programas. Trabalho de Conclusão de Curso (Bacharelado em Fisioterapia). Santarém:
Universidade do Estado do Pará, 2010.
BARAÚNA, M. A.; RICIERI. D. V. Biofotogrametria: Recurso Diagnóstico do Fisioterapeuta. Revista O
Coffito. São Paulo. v. 17. p. 7 - 11. 2002. Reportagem e entrevista.
CESARO, Jr T; PEDRINI, J. E. Utilização do software imagej para cálculo de área. V congresso brasileiro de
agroinformática, SBI-AGRO Londrina, 28 a 30 de setembro de 2005.
COELHO, R. R. Validade e Reprodutibilidade de um Protocolo de Avaliação de Amplitude de Movimento da
Articulação do Joelho pela Biofotogrametria Computadorizada. Rio de janeiro: 2006. 136 p. Dissertação de
Mestrado em Ciência da Motricidade Humana. Universidade Castelo Branco.
FABER, D.C., DEORIO J.K., STEEL M.W. Goniometric versus computerized angle measurement in asses-
sing hallux valgus. Foot Ankle Int.2005;26(3):234-38.
FERREIRA DA SILVA, R. L.; COELHO, R. R.; BARRETO, G. A.; AGUIAR, J. P.; SANTOS, P. O.; DAN-
TAS, E. H. M. Comparação entre a avaliação da amplitude articular estática do cotovelo por meio de três
diferentes métodos: goniometria, biofotogrametria e goniometria da imagem radiológica. Fisioterapia Brasil.
v. 10. n. 2. 2009.
FERREIRA DA SILVA, R.L.; ESTEVES, T.C.; ROSA, R.A.A.; MOURA, T.A.A. Influência da técnica Scien-
tific Stretching for Sports (3S) realizada em piscina terapêutica na flexibilidade da coluna vertebral e membros
inferiores. Fisioterapia Brasil - Volume 13 - Número 4 - julho/agosto de 2012.
GORRERI, M.C.; BARAÚNA, M.A.; STRINI, P.J.S.A.; STRINI, P.J.S.A.; SOUZA G.C.; NETO, A.J.F. Com-
puterized Biophotogrammetry Evaluation of Asymmetry Facial in Patients with Temporomandibular Disor-
ders. Odonto. 2010;18(35):5-13.
OLIVEIRA, Maria Marly de. Como Fazer Pesquisa Qualitativa. 7a ed. Editora Vozes. Petrópolis. Rio de Ja-
neiro, 2016.

45 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

RICIERI, D. V.; ROSÁRIO FILHO. N. A. Impacto de fatores externos sobre a mecânica respiratória avaliada
por um modelo fotogramétrico específico: biofotogrametria. Jornal Brasileiro de Pneumologia. v. 34. n. 9. p.
702 – 706. 2008.
RIPKA, W.L.; ULBRICHT, L.; NEVES, E.B.; GEWEHR, P.M. 2D and 3D Photogrammetric Models for
Respiratory Analysis in Adolescents. L.M. Roa Romero (ed.), XIII Mediterranean Conference on Medical
and Biological Engineering and Computing 2013, IFMBE Proceedings 41, DOI: 10.1007/978-3-319-00846-
2_263, © Springer International Publishing Switzerland, 2014.

46 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO DO EFEITO DA MANGIFERINA NO REPARO TECIDUAL E FUNCIONAL EM


MODELO DE LESÃO DE TENDÃO CALCÂNEO

Thalita de Andrade Almeida Moura, Maxwell Barbosa de Santana, Martha de Souza França, Diego Rodri-
gues de Paula, Analu Alves Maciel, Evander Oliveira Batista, Karen Matos Oliveira e Anderson Manoel
Herculano
Universidade Federal do Oeste do Pará - UFOPA1, Universidade Federal do Pará - , UFPA1, Universidade
Federal do Oeste do Pará - , UFOPA2, Universidade Federal do Pará - , UFPA3, Universidade Federal do
Pará - , UFPA4, Universidade Federal do Pará - , UFPA5, Universidade Federal do Pará - , UFPA6, Univer-
sidade Federal do Pará - , UFPA7 e Universidade Federal do Pará - e UFPA8
thalita-moura@hotmail.com

Resumo: INTRODUÇÃO: A tendinopatia é caracterizada por uma lesão que acomete o tendão e é uma doen-
ça que atinge em sua maioria trabalhadores que exercem atividades repetitivas, atletas e idosos. Dessa forma,
sabendo que o tendão calcâneo faz parte do grupo de tendões mais propensos a lesão e que a Mangiferina pos-
sui propriedades antioxidantes e antiinflamatórias, surgiu a hipótese de que essa substância possa contribuir de
forma positiva no tratamento farmacológico da tendinopatia. OBJETIVO: Avaliar o efeito da mangiferina no
reparo tecidual e funcional em modelo de lesão total de tendão calcâneo de camundongos. METODOLOGIA:
O trabalho foi aprovado pelo comitê de ética da instituição (CEPAE-UFPA) sob o parecer 161-13. Foram
utilizados 3 grupos experimentais (n=15): Controle (CTRL), n=3, sem intervenção; Veículo (VCL), n=6, sub-
metido à ruptura do tendão calcâneo e administração de 20μl solução salina 0,9% in loco; grupo Mangiferina
(MGF), n=6, também submetido à lesão experimental e tratamento in loco com a mangiferina (20μl). Os gru-
pos VCL e MGF receberam o tratamento na região peritendínea a cada dois dias a partir do 2º dia pós-lesão
até o 7º e 14º dia. Utilizou-se a técnica de coloração por hematoxilina e eosina (HE) e autofluorescência do ca-
lágeno para avaliar a organização tecidual. Foi realizada a contagem de células, por meio de DAPI (1:10.000)
para marcação dos núcleos. Foi avaliada marcha através do Índice Funcional de Aquiles (IFA) no período pré e
pós-operatório em 0, 7 e 14 dias. RESULTADOS: As análises histológicas por meio de HE e a autofluorescên-
cia do colágeno demonstram que o grupo MGF apresentou estrutura tecidual mais preservada em 7 e 14 dias
pós-lesão em comparação ao grupo VCL. Na contagem de células, no 14º dia pós-lesão o número de células
do grupo MGF (3,18±0,65) apresentou-se menor em comparação ao grupo VCL (4,33±0,29). No 7º dia após
a lesão, foi observado uma menor perda da funcionalidade do grupo MGF (-74.90±9.2) em comparação ao
grupo VCL (-98.39±14.9) (p<0.01). No 14º dia, manteve-se a diferença entre os grupos VCL (-93.09±10.4) e
MGF (-54.48±14.6) (p<0,05). CONCLUSÃO: Nossos achados sugerem que a mangiferina acelera o processo
de reparo da lesão tendínea, apresentando melhoras teciduais e funcionais em 7 e 14 dias após a lesão.

Palavras-chave: Tendinopatia,Mangiferina,Tendão calcâneo.

Introdução
Tendão é uma faixa fibrosa de tecido conjuntivo, composto principalmente por fibras de colágeno
e que possui a função de unir os músculos aos ossos. Esse tecido possui baixo suprimento sanguíneo, que
por sua vez, implica em uma difícil cicatrização quando este é afetado por alguma lesão local, o que leva ao
surgimento de diversos sinais e sintomas, culminando em uma doença chamada tendinopatia. Esta disfunção
no tendão, por gerar dor e perda da mobilidade articular, consequentemente, causa declínio de capacidade
funcional, afetando de forma negativa a qualidade de vida do acometido. Com isso, diversas pesquisas já
foram realizadas visando o tratamento dessa doença, buscando estratégias, principalmente terapêuticas, que
impliquem em acelerar o processo de reparo tecidual, para que assim o tendão retorne as suas características
histológicas e funcionais. Estudos apontam que o estresse oxidativo, juntamente com o processo inflamatório,
fazem parte dos fenômenos envolvidos e que ambos influenciam nos danos ao tecido. Deste modo, a inter-
47 JOVEM PESQUISADOR - PÓS GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

venção com substâncias que atuam como antioxidantes e antiinflamatório representam importantes candidatos
como estratégia terapêutica farmacológica local para recuperação tendínea. A Mangiferina, é um Xantonóide
ativo, de natureza polifenólica, encontrado em diversas espécies de plantas e já é relatada cientificamente
como tendo um papel positivo em diversos processos fisiológicos e patológicos, exercendo ação antioxidante,
anti-inflamatória, dentre outras. Dessa forma, sabendo que o tendão calcâneo faz parte do grupo de tendões
mais propensos a lesão e que a Mangiferina possui propriedades antioxidantes e antiinflamatórias, surgiu a
hipótese de que essa substância possa contribuir no tratamento farmacológico da tendinopatia.

Objetivo
Avaliar o efeito da mangiferina no reparo tecidual e funcional em modelo de lesão total de tendão
calcâneo de camundongos.

Metodologia
O trabalho foi aprovado pelo comitê de ética da instituição (CEPAE-UFPA) sob o parecer 161-13.
Foram utilizados 15 camundongos adultos da linhagem c57bl/6 divididos em 3 grupos experimentais: grupo
controle (CTRL), n=3, os animais que não receberam nenhuma intervenção; grupo veículo (VCL), n=6, sub-
dividido em VCL7dias (n=3), VCL14dias (n=3), submetido à ruptura do tendão calcâneo e administração de
solução salina 0,9% in loco; grupo Mangiferina (MGF), n=6, subdividido em MGF7dias (n=3) e MGF14dias
(n=3) e também submetido à lesão experimental e tratamento in loco com a mangiferina diluída na concentra-
ção de 1mM em solução salina 0,9%. Os grupos VCL e MGF receberam um volume de 20μl de cada solução
que foi administrado na região peritendínea a cada dois dias a partir do 2º dia pós-lesão. No 7º e 14º dia, os
animais de todos os grupos foram sedados e mortos por deslocamento cervical e o tendão calcâneo retirado.
ANALISE HISTOLÓGICA: Os tendões foram preparados para corte em criostato em espessura de 7μm com
orientação longitudinal. Para avaliar a organização tecidual, utilizou-se a técnica de coloração por hematoxi-
lina e eosina (HE) e um microscópio de luz com câmera digital acoplada foi usado para análise histológica e
captura de imagens, as quais foram armazenadas e analisadas de forma semi-quantitativa e qualitativa. Para
avaliar a progressão da cicatrização, os cortes foram analisados em microscópio de fluorescência, que pos-
sibilitaram identificar a organização do colágeno no tecido por duas principais referências, a orientação das
células no eixo do tendão e a própria organização em paralelo das fibras colágenas pela autofluorescência
do colágeno. Foi realizada a contagem de células, onde os cortes foram tratados com DAPI (1:10.000) para
marcação do núcleo e também observadas em um microscópio de fluorescência. A imagens receberam análise
duplo-cego com auxílio do programa Image J®. Foi realizado teste funcional através do Índice Funcional de
Aquiles (IFA), proposto por Murrel et al (1992), onde foi conduzido em todos os animais no período pré e
pós-operatório em 7 e 14 dias. O programa estatístico utilizado na avaliação destes experimentos foi o BioEs-
tat 5.0, utilizando o teste de análise de variância (ANOVA) de um critério, seguida pelo teste tukey para com-
parações múltiplas. Os valores de p< 0,05 foram considerados significativos. Os resultados foram expressos
como média ± desvio padrão.

Resultados e Discussão
As marcações com HE demonstram que o grupo MGF e o VCL apresentam tecido com maior den-
sidade celular em relação ao grupo CTRL em ambos os períodos (7 e 14 dias). O que é comum na fase
inflamatória da tendinopatia, que dura 0 - 2 semanas (CLARK, 1993; BALBINO et al, 2005; SHARMA;
MAFFULLI, 2006; BRING, 2007; RILEY, 2008). No entanto, no dia 7, o grupo MGF apresentou áreas com
melhor organização tecidual em comparação ao VCL, o que se repete do 14º dia, onde observa-se no grupo
MGF núcleos celulares mais alongados, diferindo do grupo VCL que demostram núcleos mais arredondados.
Essa diferença histológica entre os grupos MGF e VCL, nos leva a crer que o uso da mangiferina acelerou o
processo de reparo tecidual, proporcionando a diferenciação e amadurecimento celular ( CANTY e KADLER,
2005; SHARMA; MAFULLI, 2006). Isso pode ter se dado pela capacidade antiinflamatória da mangiferina
(MURUGANANDAN et al, 2005), tendo em vista que o grupo MGF em 14 dias já apresentava características
da fase proliferativa e não inflamatória, que de acordo com a literatura, era a fase correspondente aos dias de
pós lesão (SHARMA; MAFFULLI, 2006; BRING, 2007; RILEY, 2008). Além disso, é possível observar que
nos dias 7 e 14, o grupo VCL apresenta maior quantidade de infiltrados quando comparado ao grupo MGF.
Na autofluorescência do colágeno, os grupos MGF e VCL apresentam perda da sua matriz em comparação ao
48 JOVEM PESQUISADOR - PÓS GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

CTRL em ambos os períodos (7 e 14 dias), contudo o grupo MGF no dia 7 apresenta regiões em que há uma
maior organização tecidual onde pode-se identificar a presença de fibras de colágeno seguindo uma orientação
mais próxima do fisiológico, além de uma melhor preservação da sua matriz em relação ao grupo veículo, que
por sua vez apresenta grande perda de matriz, demonstrada pela sua baixa fluorescência; no dia 14 o grupo
MGF demonstra maior fluorescência, evidenciando fibras de colágeno em todo o tecido seguindo uma orien-
tação uniforme, além de melhor regeneração de sua matriz extracelular. Já o grupo VCL no 14º dia, ainda
apresenta maior desorganização tecidual comparado ao grupo MGF, contudo já se observa maior fluorescência
no tecido, entretanto sem orientação uniforme. Um estudo prévio demonstrou melhor padrão de organização
tecidual em 21 dias semelhante aos obtidos neste trabalho, por meio da inibição nitrérgica (MORAES et al,
2013), corroborando a ação antioxidante da mangiferina no reparo tecidual. Na contagem de células do tecido
tendíneo, a análise feita no 7º dia após a lesão apresentou diferenças estatisticamente significativas do grupo
controle (0,83±0,01, p<0,01) em relação aos grupos MGF (4,07±1,31) e VCL (5,49±0,33), demonstrando um
processo comum a essa lesão nessa fase, o aumento da densidade celular (CLARK, 1993; BALBINO et al,
2005; SHARMA; MAFFULLI, 2006; BRING, 2007; RILEY, 2008). Entretanto, não foi observado diferença
estatística entre os grupos MGF e VCL. No 14º dia pós-lesão o número de células do grupo VCL (4,33±0,29) e
MGF (3,18±0,65), mantiveram-se significativamente maior que no grupo CTRL. Contudo, já foi possível ob-
servar diferença estatística entre os grupos MGF e VCL, onde o número de células tende a ser menor quando
administrado mangiferina no local, indicando que no 14º dia pós-lesão tendínea o número de células do grupo
MGF são menores quando comparado ao grupo VCL. Nesse mesmo período o grupo MGF apresentou matriz
mais íntegra, diferente do grupo VCL. Assim, supomos que a diminuição no número de células marcadas do
grupo MGF se deu em decorrência do tratamento, que acelerou o processo de restauração do tecido. O IFA
do grupo controle não apresentaram diferença estatística entre os dias zero (3.86 ±26.9), 7 (3.58±25.1) e 14
(2.44±11.8) (p=0.9969). Para os grupos VCL (-2.55±13.1) e MGF (6.97±25.7) o IFA referente ao dia zero não
apresentou diferença estatística comparado ao grupo controle (p=0.7581). Quanto a análise realizada no 7º dia
após a lesão, foi observado uma menor perda da funcionalidade do grupo MGF (-74.90±9.2) em comparação
ao grupo VCL (-98.39±14.9) (p<0.01). No 14º dia, ainda houve diferença entre os grupos VCL (-93.09±10.4) e
MGF (-54.48±14.6) (p<0,05). Demonstrando que o grupo MGF manteve-se melhor funcionalmente em com-
paração com o grupo VCL. Quando comparamos o grupo MGF no 7º e 14º dia, podemos observar diferença
estatística no valor do seu índice de funcionalidade (p<0.05), evidenciando que o grupo obteve ganhos em sua
funcionalidade e que ela ocorreu de forma mais acelerada e precoce quando comparado ao grupo VCL, que
por sua vez manteve seu índice funcional no 7º e 14º (p=0.608). Os resultados do IFA juntamente às melhoras
teciduais obtidas em nossa pesquisa podem ser comparados aos encontrados em outros trabalhos que também
mostraram correlação entre a função do tendão e a organização da matriz (KRIVIC et al, 2006; 2008; MO-
RAES et al, 2013), resistência à tração e força (NG et al, 2003; 2004).

Considerações Finais
Concluímos que o uso da Mangiferina na lesão tendínea contribuiu na preservação da estrutura te-
cidual, bem como na organização das fibras de colágeno e redução no número de células em 14 dias após a
ruptura do tendão. Além disso, o tratamento com a Mangiferina acelerou o desempenho funcional em 7 e 14
dias pós lesão.

Referências
BALBINO, Carlos Aberto; PEREIRA, Leonardo Madeira; CURI, Rui. Mecanismos envolvidos na cicatriza-
ção: uma revisão. Revista Brasileira de Ciências Farmacêuticas, v. 41, n. 1, 2005.
BRING, D. K-I; KREICBERGS, A.; RENSTROM Per A. F. H; ACKERMANN, P. W. Physical Activity Mo-
dulates Nerve Plasticity and Stimulates Repair after Achilles Tendon Rupture. Journal of Orthopaedic Resear-
ch. 25: 164-72, 2007.
CANTY, E, G; KADLER, K,E. Procollagen trafficking, processing and fibrillogenesis. J Cell Sci. Apr 1;118(Pt
7):1341-53, 2005.
CLARK, R. A. F. Biology of dermal wound repair dermatological clinics. Journal of Investigative Dermato-
logy, v. 11, p. 647- 661, 1993.

49 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

KRIVIC, A.; ANIC, T.; SEIWERTH, S.; HULJEV, D.; SIKIRIC, P. Achilles Detachment in Rat and Stable
Gastric Pentadecapeptide BPC 157: Promoted Tendon-to Bone Healing and Opposed Corticosteroid Aggrava-
tion. J Orthop Res. 24: 982–989, 2006.
MORAES, A.S; OLIVEIRA, K.R.M; LÓPEZ, M.E.C; DINIZ, D.L.W; HERCULANO, A.M. Local NO syn-
thase inhibition produces Histological and functional recovery in achilles tendon of rats after tenotomy. Cell
tissue Res; 353.457-463, 2013.
MURUGANANDAN, S.; LAL, J.; GUPTA, P.K. Immunotherapeutic effects of mangiferin mediated by the
inhibition of oxidative stress to activated lymphocytes, neutrophils and macrophages. Toxicology, Limerick,
v. 215, p. 57-68, 2005.
NG, C.O.Y.; NG, G.Y.F.; SEE, E.K.N.; LEUNG, M.C.P. Therapeutic ultrasound strength of achilles tendon
repair in rats. Ultrasound in Med & Biol. 29: 1501–1506, 2003.
NG, G.Y.F.; NG, C.O.Y.; SEE, E.K.N. Comparison of therapeutic ultrasound and exercises for augmenting
tendon healing in rats. Ultrasound in Med & Biol. Nov;30(11):1539-43, 2004. RILEY, G. Tendinophaty –
from basic science to treatment. Nature clinical practice rheumatology, vol 4 no 2, 2008.
SHARMA, P. MAFFULLI, N. Biology of tendon injury: healing, modeling and remodeling, Journal Muscu-
loskelet Neuronal Interact; 6(2):181-190, 2006.

50 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ATIVIDADE ANTIPLASMÓDICA IN VITRO DOS ÓLEOS ESSENCIAIS DE FOLHAS E GA-


LHOS DE PIPER MARGINATUM JACQ. (PIPERACEAE).

Jefferson Castilho Moraes, Kelly Christina Ferreira Castro e Waldiney Pires Moraes
UNIVERSIDADE FEDERALDO OESTE DO PARÁ - UFOPA
jeffersonlay@hotmail.com

Resumo: A malária é uma doença tropical, parasitária e considerada um dos maiores problemas sociais e
econômicos no mundo. Nossos resultados apresentaram uma CI50 do óleo essencial das folhas de 4,94 μg/
mL para cepas de P. falciparum sensível e CI50 de 5,14 μg/mL para cepas cloroquinas resistentes. Uma baixa
citotoxicidade com valores de CL50 maiores que 100 μg/ml e índice de seletividade entre 18,05 e 20,24. Ao
compostos majoritários no óleo essencial de galhos foi o óxido de cariofileno (30,29%) e no óleo essencial das
folhas foi o 3,4-metilenodioxipropiofenona (12,43%).
Palavras-chave: Piper marginatum, óleo essencial, Plasmodium falciparum, atividade antiplasmódium.

Introdução
A malária é uma doença tropical, parasitária e considerada um dos maiores problemas sociais e
econômicos no mundo (OMS, 2015). Com o aparecimento de parasitas resistentes e a falta de uma vacina
eficaz, a grande endemicidade da malária tornou-se um problema de saúde cada vez mais evidente. Na região
amazônica, a utilização de plantas medicinais tem uma forte influência das populações tradicionais do campo,
das florestas e dos rios, tornando-se o principal recurso para o tratamento de diversas doenças. Nesse sentido,
considerando a grande biodiversidade da Amazônia e o potencial das plantas medicinais utilizadas na medi-
cina tradicional, cabendo destaque a Piper marginatum Jacq., que segundo a literatura vem sendo utilizada
no tratamento da malária. Este projeto tem como objetivo avaliar o potencial farmacológico antiplasmódico
do óleo essencial de Piper marginatum Jacq. de modo a contribuir para o conhecimento da espécie e possível
utilização como instrumento farmacológico para tratamento da malária assim como ferramenta na busca de
soluções do problema da resistência parasitária.

Objetivo
Avaliar o potencial farmacológico antiplasmódico de óleos essenciais de folhas e galhos de Piper
marginatum

Metodologia
O material Botânico foi coletado na Universidade Federal do Oeste do Pará (UOPA), ao qual os
óleo essenciais de folhas e galhos foram obtidos através do método de hidrodestilação utilizando o aparelho
do tipo Clevenger. Para avaliação da atividade antiplasmódica, os óleos essenciais foram submetidos a testes
esquizonticidas in vitro com duas cepas de Plasmodium falciparum, Cloroquina sensível (3D7) e Cloroquina
Resistente (W2), considerados microtestes tradicionais para avaliar o CI50 (concentração inibitória para o
crescimento de metade da população de parasitas). Para investigação da citotoxicidade do óleo essencial de
P. marginatum foram realizado ensaios com a linhagem celular humana WI-26VA-4 (fibroblasto de pulmão
ATCC CCL-95.1) utilizando o brometo 3-(4,5-dimetiltiazol-2-il)-2,5-difeniltetrazol (MTT), determinando as-
sim a CL50 (Concentração letal capaz de inibir em 50% o crescimento das células). O índice de seletividade
do óleo essencial foi determinado através da razão da atividade citotóxica em relação à atividade antimalárica.
Para a análise dos dados foi utilizado os softwares OriginPro versão 8.0 e Prism 5.0. A caracterização química
foi realizada por Cromatografia gasosa acoplada a Espectrometria de Massa (CG-EM). Os óleos essenciais de
P. marginatum foram solubilizados e a identificação dos compostos majoritários realizado através da compa-
ração entre os índices de retenção (IR) calculados, com os disponíveis na literatura (Adams, 2005) e a base de
dados da biblioteca NIST.

51 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

Resultados e Discussão
Os resultados apresentaram uma CI50 do óleo essencial das folhas de 4,94 μg/mL para cepas de P.
falciparum sensível e CI50 de 5,14 μg/mL para cepas cloroquinas resistentes. O óleo essencial dos galhos
apresentou CI50 de 5,34 μg/mL e 5,54 μg/mL para cepas sensíveis e resistentes respectivamente. Comparando
com os dados da literatura relatando outras espécies do gênero Piper avaliadas em estudos in vitro para ati-
vidade antiplasmódica, como é o caso da Piper holtonii que apresentou CI50 de 12,0 µg/mL (Maritza et al.,
2014) e de Piper sarmentosum que apresentou CI50 de 6,5 µg/mL para cepas de P. falciparum resistentes, de
um de seus componentes isolado (Rukachaisiriku et al., 2004), nossos resultados mostram que a espécie P.
marginatum apresenta um significativo potencial antiplasmódico, com uma concentração inibitória menor que
outras espécies do gênero Piper já descritas. Nossa pesquisa também demonstrou que os óleos essenciais de P.
marginatum apresentou uma baixa citotoxicidade com valores de CL50 maiores que 100 μg/ml, corroborando
com a literatura, a qual mostra que óleo essencial de P. marginatum apresentou CL50 maior que 20 μg/ml
(OLIVERO-VERBEL et al. 2009). Estes dados também nos possibilitam constatar que os óleos essenciais da
espécie P. marginatum são menos tóxicos que outras espécies do gênero Piper que apresentaram uma CL50
de até 2,54 μg/ml (OLIVERO-VERBEL et al, 2009). Além disso, nosso estudo também mostrou que os óleos
essenciais de P. marginatum apresentaram um significativo índice de seletividade, entre 18,05 e 20,24, pois
de acordo com a literatura os valores de IS devem ser maiores que 10 para indicar um potencial antimalárico
(KATSUNO et al, 2015). No que tange a identificação dos compostos químicos presente no óleo essencial
de P. marginatum, identificamos que os componentes majoritários do óleo essencial de galhos foram o óxido
de cariofileno (30,29%), seguido do espatulenol (7,74%) e α-copaeno (6,49%). Já os componentes predomi-
nantes no óleo essencial de folhas foram o 3,4-metilenodioxipropiofenona (12,43%), seguido de espatulenol
(8,42%) e 3-careno (6,51%). Ao comparar com a literatura também observamos que óxido de cariofileno está
presente como produto natural oriundo de galhos e folhas de P. marginatum (Andrade et al. 2008; Autran et
al. 2009; Oliveira Chaves & Oliveira Santos 2002), assim como a 3,4-metilenodioxiprpiofeno (ANDRADE et
al., 2008; REIGADA et al. 2007).

Considerações Finais
Com base nos resultados obtidos, concluímos que os óleos essenciais de galhos e folhas de P. mar-
ginatum apresentaram atividade antiplasmódica significativa por reduzir o nível de parasitemia nas hemácias
infectadas, baixo CI50, alto índice de seletividade, e ainda, não apresentou citotoxicidade, viabilizando a
continuação do estudo com a espécie, para posteriormente isolar seus bioativos e avaliar-los como potencial
droga antimalárica assim como validar o seu uso na medicina popular como antimalárico originado de um
produto natural.

Referências
ANDRADE E.H.A. et. al. Variability in essential-oil compositionof Piper marginatum sensu lato. Chem. Bio-
divers. 5, 197–208. 2008
AUTRAN E. S. et al. Chemical composition, oviposition deterrent and larvicidal activities against Aedes
aegypti of essential oils from Piper marginatum Jacq. (Piperaceae). Bioresource Technology 100 2284–2288.
2009
KATSUNO, k. et. al. Hit and lead criteria in drug discovery for infectious diseases of the developing wor-
ld. Nature Reviews Drug Discovery · October 2015. Disponível em < https://www.researchgate.net/publica-
tion/282590104>
MARITZA, A.; CARDOZO, R.; CÁRDENAS, G. G.; VELANDIA, J. R. Actividad antiplasmódica in vitro de
Piper holtonii (cordoncillo). Revista Cubana de Plantas Medicinales . 2014 Olivero-Verbel, J., Gueette-Fer-
nandez, J., Stashenko, E. Acute toxicity against Artemia franciscana of essential oils isolated from plants of
the genus Lippia and Piper collected in Colombia. Bol. Latinoam, 2009. Caribe 8, 419–427
OLIVEIRA SANTOS, B.V., OLIVEIRA CHAVES, M.C., 1999b. 2,4,5-Trimethoxypropiophenone from Piper
marginatum. Biochem. Syst. Ecol.27, 539–541
ORGANIZACAO MUNDIAL DA SAUDE. Relatório sobre o paludismo no mundo. 2015. Disponível em:

52 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

<www.who.int> REIGADA, J. B. et al. Chemical constituents from Piper marginatum Jacq. (Piperaceae)—
antifungal activities and kinetic resolution of (RS)-marginatumol by Candida antarctica lipase (Novozym
435). Tetrahedron: Asymmetry, v. 18, n. 9, p. 1054–1058, maio 2007. Rukachaisirikul T. et al. Chemical cons-
tituents and bioactivity of Piper sarmentosum. Journal of Ethnopharmacology 93 (2004) 173–176

53 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ACTINOBACTÉRIAS CULTIVÁVEIS DA RIZOSFERA DE ANIBA PARVIFLORA: UMA


FONTE NATURAL DE BIOCONTROLE DE ESPÉCIES DE FUNGOS AFLATOXIGÊNICOS

Sara Freitas de Sousa, Daniele Ferreira da Silva, José Jeosafá Vieira de Sousa Júnior, Talita Cunha de Fa-
ria Liberal, Alexandre Escher Boger, Raphael carlos de santana de santana e Silvia Katrine Silva Escher
Universidade Federal do Oeste do Pará - UFOPA
sara_freitas_stm@hotmail.com

Resumo: As actinobactérias é um grupo de bactérias com uma fonte inesgotável de compostos bioativos,
produzindo moléculas de extrema diversidade química e ação biológica, como antibióticos, antitumorais,
anti-inflamatórios, antivirais, antiparasitários, imunossupressores, além da produção de vitaminas e enzimas,
as quais interferem no ciclo celular de fungos. Com isso, estudos voltados a obtenção de actinobactérias pro-
dutoras de substâncias antifúngicas são desenvolvidos visando sua aplicação no biocontrole, pois as mesmas
são capazes de colonizarem nichos ecológicos que também são ocupados por fitopatógenos. Pouco se conhece
sobre a distribuição das actinobactérias no bioma Amazônico, especialmente na rizosfera de plantas nativas
como Aniba parviflora Syn Fragans (macacaporanga). Assim, neste estudo foi realizado a prospecção de acti-
nobactérias da rizosfera de macacaporanga e avaliado o potencial antagônico frente a espécies de Aspergillus.
O isolamento bacteriano foi realizado a partir da suspensão microbiana de 10 g de solo rizosférico preparada
em tampão fosfato (pH7,0), e cultivo em meio Ágar Asparagina levedura durante 21 dias à 37ºC. A seleção das
actinobactérias foi realizada com base na análise morfológica das colônias em cultivo nos meios International
Streptomyces Project (ISP), a análise micromorfológica por microscopia óptica de luz comum e microscopia
eletrônica de varredura (LEO 5410LV), além de ser realizado a identificação molecular destas bactérias. O
antagonismo foi verificado por meio de testes de culturas pareadas, a qual em 96 horas de ensaio verificou-se
atividade antimicrobiana, expressa por halos de inibição de crescimento, medidos em milímetros (mm), sendo
utilizado os fitopatógenos Aspergillus parasiticus e Aspergillus niger. A análise das sequências de RNAr 16S
obtidas apresentam similaridade entre 96 e 99% com o gênero Streptomyces sp. Todas as cepas de Streptomy-
ces sp. foram ativas contra os fitopatógenos, com destaque para Streptomyces sp. MPO3, sendo obtido halos
de 29.1 mm e 37.7 mm para os fungos Aspergillus parasiticus e Aspergillus niger, respectivamente. A análi-
se estatística indicou maior atividade antifúngica frente ao microrganismo-teste Aspergillus niger. Os dados
apresentados revelam a potencialidade das actinobactérias, a qual podem ser uma promissora fonte alternativa
de moléculas antifúngicas efetivas no controle do gênero Aspergillus.

Palavras-chave: Controle biológico,Streptomyces,Fitopatógenos.

Introdução
Fungos fitopatogênicos são responsáveis pela decomposição de substratos celulósicos, acarretando
desde o tombamento e mortalidade de plantas, podridão de sementes, de estacas e do colo da planta, cancros,
podridões de raízes, estagnação de crescimento, murchas, manchas, queimas e mofo (MICHEREFF; AN-
DRADE; MENEZES, 2005;). Além disto, algumas espécies produzem micotoxinas, como ocorre nos gêneros
Aspergillus, Fusarium e Penicillium (SWEENEY; DOBSON, 1999). A utilização de fungos e bactérias no
controle biológico de fitopatógenos, têm despertado o interesse industrial, visto a facilidade de manipula-
ção microbiana e a obtenção de seus metabólitos secundários, que não sofre interferência de sazonalidade
como ocorre em alguns dos metabólitos produzidos por plantas. Assim, a prospecção de microrganismos
promissores capazes de resolver a problemática do setor ambiental, agronômico e florestal, se apresenta como
estratégia importante para a descoberta de novas moléculas efetivas, principalmente contra microrganismos
com resistência aos fungicidas sintéticos comerciais. Nesse contexto, o grupo das actinobactérias, bactérias
filamentosas Gram positivas, recebem destaque, por serem consideradas uma fonte inesgotável de compostos
bioativos oriundos do seu metabolismo secundário, produzindo moléculas de extrema diversidade química
e ação biológica, como antibióticos, antitumorais, anti-inflamatórios, antivirais, antiparasitários, imunossu-

54 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

pressores, além da produção de vitaminas e enzimas, as quais interferem no ciclo celular dos fitopatógenos
(HOLT, WILLIAMS; SHARPE, 1989). Adicionalmente, actinobactérias quando associadas ao seu hospedeiro
podem conferir efeitos benéficos no mesmo, tais como maior resistência a condições de estresse, alterações
nas condições fisiológicas, suprimento de nitrogênio, produção de reguladores de crescimento vegetal e outros
componentes como enzimas e fármacos. Essas são capazes de colonizarem nichos ecológicos que também são
ocupados por fitopatógenos, sendo então mencionado como potencial para o controle dos mesmos (MELO et
al., 2006).

Objetivo
Assim, neste estudo objetivou-se realizar a prospecção actinobactérias da rizosfera de macacaporan-
ga e avaliar o potencial antagônico frente a espécies de Aspergillus.

Metodologia
O isolamento bacteriano foi realizado a partir da suspensão microbiana de 10 g de solo rizosférico
preparada em tampão fosfato (pH7,0), e cultivo em meio Agar Asparagina levedura durante 21 dias à 37ºC. A
seleção de actinobactérias foi realizada com base em análise morfológica das colônias em cultivo nos meios
International Streptomyces Project (ISP), e posteriormente análise micromorfológica por microscopia óptica
de luz comum e microscopia eletrônica de varredura (LEO 5410LV) para caracterização da cadeia de esporos.
O DNA bacteriano foi extraído conforme descrito por Stirling (2003) a partir da suspensão celular (OD600 >
1.8) obtida em cultivo em meio líquido ISP-2 a 30ºC durante 72h. A reação de amplificação foi realizada utili-
zando a enzima Platinum®.Taq DNA Polymerase High Fidelity (Invitrogen 11304-011) seguindo as recomen-
dações do fabricante, feitas em termociclador Bioneer MyGenie 96 Thermal block (Global Genomics Partner)
sob as seguintes condições: para o par de oligonucleotídeos Eub338F/Act1159R 95ºC por 3’; 35 ciclos de
94ºC (30’’), 68ºC (30’’), 72ºC (90’’); extensão de 72ºC (7’) (FIERER et al., 2005), e para o par fD1/rD1 95ºC
por 3’; 30 ciclos de 94ºC (1’), 55ºC (30’’), 72ºC (2’); extensão de 72ºC (7’). O produto da PCR foi purificado
utilizando o kit GFX (GE Healthcare 28-9034-70) e subclonado no vetor pCR™2.1-TOPO® utilizando o kit
TOPO TA Cloning (ThermoFisher Scientific 451641). O plasmídio clonado foi propagado em E. coli DH5-al-
pha e purificado utilizando o kit (Fermentas K0503). O sequenciamento Sanger foi realizado em sequenciador
ABI PRISM 3730 DNA ANALYZER, Applied Biosystems/Hitashi, utilizando os oligonucleotídeos inicia-
dores M13F (GTAAAACGACGGCCAGT) e M13R (AACAGCTATGACCATG) para todos os fragmentos
subclonados no vetor pCR™2.1-TOPO®. Para o completo sequenciamento do 16S rRNA foi utilizado os
oligonucleotídeos (LANE, 1991) 341-357F (CCTACGGGAGGCAGCAGCAG), 685-704f (GTAGSGGT-
GAAATACGTAGA) e 10991114f (GCAACGAGCGCAACCC). As sequências obtidas foram analisadas no
programa CLC Main Workbench versão 7.0. Os contigs foram comparados contra o banco de dados BLAST
para confirmação do gênero. O antagonismo foi verificado por meio de testes de culturas pareadas (MORET-
TO; GIMENES-FERNANDES; SANTOS, 2001), e após 96h de ensaio, verificou-se atividade antimicrobiana,
expressa por halos de inibição de crescimento medidos em milímetros (mm), a fim de avaliar o potencial de
inibição sobre os fitopatógenos Aspergillus parasiticus e Aspergillus niger. Todas as análises foram realizadas
em triplicata e os dados avaliados quanta a variância (ANOVA) e a significância estatística determinada pelo
Teste de Tukey (p < 0.05), utilizando o software Assistat Versão 7.7 (2016) (SILVA; AZEVEDO, 2016).

Resultados e Discussão
Foram isoladas 11 actinobactérias, as quais apresentaram colônias bacterianas de aspecto velutino e
pulverulento, com bom desenvolvimento do micélio aéreo nos meios ISP com coloração variando entre branco
e cinza, e apenas a cepa MPO11 produziu pigmento vermelho em meio ISP2. A morfologia da cadeia de espo-
ros variou entre cadeias retas longas, flexuosas ramificadas e Retinaculum apertum. A análise das sequências
de RNAr 16S obtidas apresentam similaridade entre 96 e 99% com o gênero Streptomyces sp. Todas as cepas
de Streptomyces sp. foram ativas contra os fitopatógenos, com destaque para Streptomyces sp. MPO3, apre-
sentando halos de inibição de até 29.1 mm e 37.7 mm frente aos fungos Aspergillus parasiticus e Aspergillus
niger, respectivamente. A análise estatística indicou maior atividade antifúngica frente ao microrganismo-teste
Aspergillus niger, o qual não foi inibido apenas por Streptomyces sp. MPO10. Os dados diferem estatistica-
mente aos do teste com o fungo Aspergillus parasiticus, com halo de inibição de 27.9 mm após 96 horas em
contato com as actinobactérias. Vasconcelos (2008) enfatiza que quando há a inibição por um período mais
55 JOVEM PESQUISADOR - PÓS GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

prolongado, é possível a identificação do microrganismo mais eficiente e com o ciclo de crescimento maior,
além de possibilitar a identificação dos metabólitos secundários mais ativos. O controle biológico desses fi-
topatógenos é de grande importância, devido aos prejuízos causados pela produção de micotoxinas tóxicas a
humanos, animais e plantas. E com isso, verifica-se o imenso potencial do gênero Streptomyces em produzir
moléculas de interesse biotecnológico, o que também influencia na escolha do mesmo para ser utilizado no
biocontrole de fitopatógenos (BETTIOL; MORANDI, 2009).

Considerações Finais
Com isso, a partir dos dados apresentados, verifica-se que as actinobactérias nativas do bioma Ama-
zônia podem ser uma fonte alternativa de moléculas antifúngicas promissoras efetivas no controle de fungos
aflatoxigênicos do gênero Aspergillus.

Referências
HOLT, J.G.; WILLIAMS, S.T.; SHARPE, M.E. Bergey’s manual of systematic bacteriology. Baltimore:
Williams & Wilkins, 1989. v. 4, 2300-2648.
MICHEREFF, Sami J.; ANDRADE, D. E. G. T.; MENEZES, Maria. Ecologia e manejo de patógenos radicu-
lares em solos tropicais. Universidade Federal e Rural de Pernambuco, 2005.
MORETTO, K. C. K.; GIMENES-FERNANDES, N.; SANTOS, J. M. dos. Influence of Trichoderma spp. on
Colletotrichum acutatum mycelial growth and morphology and on infection of ‘Tahiti’ lime detached flowers.
Summa Phytopathologica, v.27, n.4, p. 357-364, 2001.
PRIDHAM, T. G. et al. A selection of media for maintenance and taxonomic study of Streptomyces. Antibiot
Annu, p. 947-53, 1956. ISSN 0570-3131 (Print)
SHIRLING, E. T.; GOTTLIEB, D. Method for characterization of Streptomyces species. Int. J. Syst, 1966,
Citeseer.
SILVA F.A.S, AZEVEDDO C.A.V. (2016). The Assistat Software Version 7.7 and its use in the analysis of
experimental data. Afr. J. Agric. Res. Vol. 11 (39), pp. 3733-3740, 29. DOI: 10.5897/AJAR2016.11522.
STIRLING, D. DNA extraction from fungi, yeast, and bacteria. Methods Mol Biol, v. 226, p. 53-4, 2003.
SWEENEY, M.J. & DOBSON, A.D.W. Molecular biology of mycotoxin biosynthesis. FEMS Microbiology
Letters 175: 49-163. 1999.
VASCONCELLOS, R. L. F. Actinobactérias da rizosfera de Araucaria angustifolia com potencial biotecnoló-
gico. 2008, 73 f. Dissertação (Mestrado em Agronomia) - Escola Superior de Agricultura “Luiz de Queiroz.
Piracicaba, 2008.

56 JOVEM PESQUISADOR - PÓS GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO DA SENSIBILIDADE TÁTIL PROTETORA DOS MEMBROS INFERIORES


EM INDIVÍDUOS DIABÉTICOS

Helen Soares de Lima, Luana Carla Lima de Almada, Camila de Almeida Silva e Maria do Socorro da Silva
Mota
Universidade do Estado do Pará - UEPA
helen_aas@yahoo.com.br

Resumo: O diabetes mellitus é um grupo de distúrbios do metabolismo caracterizado pela hiperglicemia e


com alto impacto socioeconômico em decorrência de suas complicações. Entre elas está a redução da sensação
do tato superficial, principalmente em região distal de membros inferiores (MMII), o que contribui para o au-
mento do índice de ulcerações e consequentemente amputações nesses pacientes. Devido a isso, é de extrema
importância a avaliação física regular de diabéticos com o intuito de identificar pacientes em risco e promover
orientações adequadas para prevenir lesões. A partir disso, o objetivo deste estudo foi avaliar a sensibilidade
tátil dos MMII em indivíduos com Diabetes mellitus. A pesquisa foi aprovada pela Comissão de Ética em Pes-
quisa envolvendo Seres Humanos da UEPA, parecer nº 2.221742/2017 e para sua realização foi utilizada uma
amostra de 26 indivíduos com diabetes mellitus tipo II de ambos os sexos, atendidos e cadastrados na Unidade
Básica de Saúde do Santíssimo, município de Santarém-Pará. O procedimento de avaliação física foi feito em
ambos os membros inferiores dos participantes. Foi iniciado com a inspeção dos pés, seguida da avaliação da
sensibilidade tátil através do uso de 4 monofilamentos de 2g, 4g, 10g e 300g em 5 áreas da região plantar:
antepé medial, antepé lateral, médio-pé, calcanhar e hálux. Como resultados obteve-se que a amostra foi pre-
dominantemente feminina (65,38%), com idade variando entre 42 e 87 anos. Durante o exame físico foram
identificados principalmente presença de ressecamento de pele (38,46%) e espessamento (23,08%). Ao teste
de sensibilidade 76,92% apresentaram comprometimento em pelo menos um dos pontos avaliados. Desses,
55% senti ram o toque somente a partir do monofilamento de 10g. Os locais com maior alteração de sensi-
bilidade tátil protetora foram o calcanhar (69,23%) e hálux (42,30%). A partir desses resultados foi possível
observar a vulnerabilidade da maioria dos indivíduos avaliados e o risco de surgimento de úlceras plantares
em decorrência da diminuição da sensibilidade protetora.

Palavras-chave: Diabetes Mellitus,Complicações,Sensibilidade tátil

Introdução
O diabetes mellitus (DM) é um problema de saúde pública mundial e uma das principais síndromes
crônicas que afetam a humanidade. Segundo a Organização Mundial de Saúde (2016) 422 milhões de adultos
convivem com o diabetes no mundo, sendo que 16 milhões de brasileiros possuem a doença. Trata-se de um
grupo heterogêneo de distúrbios metabólicos dos carboidratos, lipídios e proteínas que apresenta em comum
a hiperglicemia, resultante de defeitos na ação da insulina, na sua secreção ou em ambas (HALL, 2017; KU-
MAR; ABBAS; ASTER, 2016). A história natural da doença é marcada pelo aparecimento de complicações
que geram elevada morbimortalidade e comprometem a produtividade e qualidade de vida dos doentes e seus
familiares. Em decorrência disso, trata-se de uma das doenças crônicas de maior impacto socioeconômico
para o sistema de saúde pública (SBD, 2016; SOUZA, 2015). Um fator agravante é que uma grande parte da
população não sabe que é portadora da doença, visto que ela permanece assintomática por vários anos, sen-
do, com frequência, diagnosticada somente quando se manifestam os sinais de complicações (Ministério da
Saúde, 2013). Dentre as complicações mais comuns estão as ulcerações em membros inferiores (MMII) geral-
mente ocasionadas pela neuropatia diabética, que é capaz de gerar perda da sensação termoalgésica, redução

57 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

do tato protetor superficial e comprometimento cicatricial, deixando, dessa forma, o indivíduo mais vulnerável
a lesões (FORTALEZA et al., 2010; SOUZA, 2015). Estima-se que aproximadamente 20% das internações
de indivíduos com diabetes ocorrem por lesões nos MMII e 85% das amputações nesses indivíduos são pre-
cedidas de ulcerações (AUDI et al., 2011). A partir disso, a prevenção dentro da Atenção Básica é a primeira
linha de defesa contra as úlceras diabéticas. É recomendável que toda pessoa com DM realize pelo menos um
exame dos pés anualmente, essa consulta deverá incluir uma rotina sistemática de avaliação da sensibilidade
protetora e da integridade dos pés com vistas a prevenir danos. Porém, o exame adequado é quase sempre
negligenciado ou realizado de maneira incompleta nas Unidades Básicas de Saúde (UBS’s) (American Dia-
betes Association, 2013). Nesse sentido, de forma a contribuir para a detecção precoce dessas complicações e
prevenção de danos, tem-se percebido a necessidade e incentivado as avaliações regulares desses indivíduos
dentro das UBS’s.

Objetivo
Avaliar indivíduos com DM e mensurar os possíveis comprometimentos de sensibilidade tátil que
possuem em MMII, correlacionando os dados encontrados com os já descritos na literatura.

Metodologia
Trata-se de um estudo quantitativo, transversal e descritivo. Foi realizado no município de Santarém
Pará, no período de Setembro a Outubro de 2017. A população estudada foi composta por indivíduos do gê-
nero feminino e masculino, com diabetes mellitus tipo II, cadastrados no grupão Hiperdia da UBS do bairro
Santíssimo. A coleta de dados foi feita através de uma avaliação física, iniciou-se com a inspeção detalhada de
MMII a procura de: ferimentos, bolhas, rachaduras e ressecamento da pele. Para a avaliação da sensibilidade
tátil bilateral utilizou-se um conjunto de monofilamentos Semmes-Weinstein nylon, da marca SORRI-BAU-
RU® em cinco áreas da região plantar do pé: antepé medial, antepé lateral, médio-pé, calcanhar e hálux. Para
isso, foram utilizados os monofilamentos: Violeta (2g), Vermelho (4g), Laranja (10g) e Magenta (300g). O
instrumento foi posicionado de forma a ficar perpendicular à superfície da pele, sendo feito apenas um toque
como monofilamento nas regiões avaliadas. Os monofilamentos foram usados em ordem crescente, caso o
paciente apresentasse sensibilidade preservada em todos os pontos, a verificação com o próximo monofila-
mento era dispensada. O mais fino monofilamento sentido pelo participante da pesquisa em cada ponto definiu
seu nível de sensibilidade tátil e a resposta foi classificada de acordo com orientação do Ministério da Saúde
(2013). Os dados foram então submetidos a análise descritiva quanto a frequência. Esta pesquisa foi realiza-
da de acordo com a resolução nº. 466/12 do Conselho Nacional de Saúde (CNS) e aprovada pelo Co¬mitê
de Ética e Pesquisa envolvendo seres humanos da Universidade do Estado do Pará (UEPA), sob parecer nº.
2.221.742, de 16 de agosto de 2017.

Resultados e Discussão
Foram avaliados 26 indivíduos diabéticos, sendo 65,38% do gênero feminino e 34,62% do gênero
masculino, com idade variando entre 42 e 87 anos, média de 66 anos. Durante a inspeção foi identificado
presença de úlceras interdigitais em 7,69% dos pacientes, rachaduras em 15,38%, um caso de amputação, res-
secamento de pele em 38,46% e espessamento em 23,08% principalmente em região de calcanhar. Em 2015,
Carmo et al. ao avaliarem 592 indivíduos com DM em 17 UBS’s também detectaram alterações de pele nos
membros inferiores, principalmente ressecamento, em 73,8% dos pacientes. Condições dermatológicas, como
pele seca, rachaduras e calosidades constituem condições pré-ulcerativas e devem ser monitoradas (KUMAR;
ABBAS; ASTER, 2016). Após a inspeção, foi realizado o exame de avaliação da sensibilidade tátil protetora
na região plantar dos pés. Detectou-se que 76,92% apresentaram comprometimento da sensibilidade em pelo
menos um dos pontos avaliados. Desses, 55% sentiram o toque somente a partir do monofilamento de 10g,
40% só sentiram o toque com o monofilamento de 300g e 5% dos pacientes não sentiram qualquer toque.
Dentre os locais que mais apresentaram alteração de sensibilidade tátil protetora, destacam-se o calcanhar
(69,23%) e hálux (42,30%). Uma possível explicação para essas alterações pode ser o fato de que a manu-
tenção da hiperglicemia por longos períodos pode desencadear danos a fibras sensoriais grossas, diminuindo

58 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

a sensibilidade ao toque leve, vibração e sentido posicional. Esses danos evoluem lentamente, estando rela-
cionados diretamente com a duração do diabetes (ROWLAND; PEDLEY, 2011). Dentre os locais avaliados,
percebeu-se que os com maior comprometimento na região plantar foram o calcanhar e o hálux. Esses locais
podem se apresentar mais comprometidos em decorrência da maior quantidade de queratina e gordura, além
disso, são áreas mais sobrecarregadas durante a locomoção e recebem inervação sensitiva do nervo sural,
que tende a ser frequentemente atingido em casos de neuropatia (Audi et al., 2011) A partir desses resultados
pode-se verificar um comprometimento de sensibilidade tátil em indivíduos diabéticos, devendo-se cada vez
mais serem estimuladas atividades de educação e orientação em saúde sobre controle glicêmico e cuidados
diários com os pés.

Considerações Finais
Constatou-se que a maioria dos pacientes avaliados apresentou alteração na sensibilidade tátil pro-
tetora em pelo menos um dos pontos avaliados e os locais com maior comprometimento foram as regiões de
calcanhar e hálux. A partir da obtenção dos resultados da avaliação física da população atendida os profis-
sionais podem planejar estratégias diferenciadas e específicas de prevenção, detecção precoce, orientação e
tratamento integral com o intuito de atingir esse público de maneira satisfatória e eficaz.

Referências
AUDI, E. G. et al. Avaliação dos pés e classificação do risco para pé diabético: contribuições da enfermagem.
Cogitare Enfermagem, v. 16, n. 2, p. 240-6, 2011.
BRASIL. MINISTÉRIO DA SAÚDE. Estratégias para o cuidado da pessoa com doença crônica: diabetes
mellitus. Ministério da Saúde, Secretaria de Atenção à Saúde, Departamento de Atenção Básica. – Brasília:
Ministério da Saúde, 2013.
CARMO, T. M. D. et al. Monoflamento de Semmes-Weinstein: uma avaliação da sensibilidade protetora dos
pés na prevenção da úlcera plantar entre pacientes diabéticos. Revista Ciência et Praxis, v. 8, n. 15, 2015.
FORTALEZA, A. C. S. et al. Avaliação clínica da sensibilidade em indivíduos com diabetes melito. Colloquium
Vitae, v. 2, n. 2, p. 44-49, 2010.
KUMAR, V.; ABBAS, A. K.; ASTER, J. C.: Robbins Patologia Básica. 9. ed. Rio de Janeiro: Elsevier, 2016.
ORGANIZAÇÃO MUNDIAL DE SAÚDE (OMS). World Health Organization. Global report on diabetes.
2016. Disponível em <http://apps.who.int/iris/bitstream/10665/204871/1/9789241565257_eng.pdf?ua=1>.
Acesso em: 13 de abr. 2017. HALL, J. E. Tratado de Fisiologia Médica. 13ª ed. Rio de Janeiro: Elsevier, 2017.
ROWLAND, L. P.; PEDLEY, T. A. Merritt - Tratado De Neurologia, 12 ed. Rio de Janeiro: Guanabara Koogan,
2011.
SBD - SOCIEDADE BRASILEIRA DE DIABETES. Diretrizes (2015-2016). São Paulo: A.C. Farmacêutica,
2016.
SOUZA, C. C. Eficácia de uma intervenção fisioterapêutica na qualidade de vida, propriocepção, sensibilidade
e mobilidade de idosos diabéticos institucionalizados. Dissertação (Mestrado em Gerontologia Biomédica).
Pontifícia Universidade Católica do Rio Grande do Sul. Porto Alegre, 2015.

59 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

CARACTERÍSTICAS FÍSICO-QUÍMICAS, COMPOSTOS FENÓLICOS E POTENCIAL AN-


TIOXIDANTE DE MÉIS DE ABELHAS SEM FERRÃO (MELIPONINAE SPP.) PRODUZI-
DOS EM BELTERRA, PARÁ

Victor Valentim Gomes, Gabriela Sousa Dourado, Adelene Menezes Portela Bandeira, Samuel Carvalho
Costa, Oriana Valentim Gomes e Paulo Sérgio Taube Júnior
Universidade Federal do Oeste do Pará - UFOPA1, Universidade Federal do Oeste do Pará - , UFOPA2,
Universidade Federal do Oeste do Pará - , UFOPA3, Universidade Federal do Oeste do Pará - , UFOPA4,
Faculdade da Amazônia - , UNAMA5 e Universidade Federal do Oeste do Pará - e UFOPA6
victorvalentimgomes@gmail.com

Resumo: O objetivo deste estudo foi avaliar a composição fisico-química (umidade, minerais totais, acidez li-
vre, pH, teor de 5-HMF, sólidos solúveis, frutose, glicose, sacarose e cor), bem como a presença de compostos
fenólicos e atividade antioxidante (pela inibição do radical DPPH) de 4 espécies de abelhas sem ferrão (Me-
liponinae spp.) produzidas em Belterra – Pará. Os resultados mostraram que os parâmetros umidade, acidez
livre, 5-HMF e açúcares redutores estão em desacordo com a legislação vigente, entretanto, estes e os demais
parâmetros estão coerentes com resultados disponíveis na literatura para méis de abelhas sem ferrão. Houve
correlação positiva forte entre o conteúdo fenólico e a atividade antioxidante. A partir deste estudo, reforça-
-se a necessidade da elaboração de um regulamento específico para méis de abelhas sem ferrão e obtem-se a
primeira caracterização do mel de abelha Cacho-de-uva (Frisiomelitta Cfr. longipes), com elevado contéudo
fenólico e de inibição radicalar.

Palavras-chave: mel de abelhas nativas Frisiomelitta Cfr. longipes, 5-HMF,mel de abelhas nativas,Frisiome-
litta Cfr. longipes,5-HMF

Introdução
O mel de abelha é um líquido viscoso fabricado principalmente a partir do néctar de plantas. É com-
posto majoritariamente de açúcares (em especial frutose e glicose) e água, além de outros componentes como
enzimas, minerais, ácidos orgânicos e compostos fenólicos (BRASIL, 2000). Esta complexa composição varia
conforme a espécie da abelha, localização geográfica, fontes florais disponíveis e processo de armazenagem
(BILUCA, 2014). No Brasil, o mel produzido pela subfamília Meliponinae spp., também conhecida como
abelhas sem ferrão, nativas ou indígenas, possui especificidades que a distingue de outros méis (BRAGHINI,
2016). Na região oeste do Pará, como em todo o país, a criação racional de abelhas indígenas (meliponicul-
tura) para a produção e comercialização do mel é crescente (BRAGHINI, 2016; GOMES et al., 2017). Entre-
tanto, seus parâmetros de qualidade e autenticidade estão em desacordo com a legislação brasileira, baseada
em méis de Apis mellifera, ocasionando a desvalorização deste produto no mercado (BILUCA, 2014). Desta
forma, estudos de caracterização física, química e bioativa dos méis destas abelhas são relevantes para definir
a identidade, qualidade e atividades biológicas (BILUCA, 2014).

Objetivo
Avaliar a composição físico-química, fenólica e atividade antioxidante de méis de abelhas nativas
(Meliponinae spp.) produzidas no município de Belterra, Pará, Brasil.
Metodologia
Coletou-se em maio de 2017 quatro amostras de méis de abelhas da subfamília Meliponinae spp. de diferen-
tes espécies em um meliponário localizado no município de Belterra, Pará: Cacho-de-uva (Frisiomelitta Cfr.
longipes), Mosquitinho (Tetragonisca angustula), Canudo (Scaptotrigona sp.) e Jandaíra (Melipona compren-

60 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

sipes). As amostras foram acondicionadas em tubos Falcon de 50mL em temperatura ambiente, simulando o
armazenamento doméstico, para posterior análises. Determinaram-se os teores de umidade e sólidos solúveis
(ºBrix) por refratometria, os teores de minerais totais por gravimetria e acidez livre por titulometria (AOAC,
2006). Avaliou-se pH das amostras por potenciometria (GOMES et al., 2017). A cor dos méis foi analisada por
método espectrofotométrico UV/Vis (GOMES et al., 2017). Os açúcares (frutose, glicose e sacarose) foram
obtidos seguindo método indireto por eletroforese capilar (RIZELIO, 2012). As concentrações de 5-Hidro-
ximetilfurural (5-HMF) foram avaliadas utilizando a cromatografia eletrocinética micelar capilar (RIZELIO,
2012). Para análise da composição fenólica total dos méis, aplicou-se o método espectrofotométrico UV/
Vis de Folin-Ciocalteu (RIZELIO, 2012). A capacidade antioxidante foi determinada através do método de
sequestro do radical DPPH (GOMES et al., 2017). Todas as análises realizadas foram em triplicata e os seus
resultados expressos com média e desvio padrão. Aplicou-se análise de variância (ANOVA) e teste de Tukey
para avaliar as distinções entre as médias, considerando diferenças significativas para p<0,05 com nível de
confiança de 95%. Para estes tratamentos estatísticos, utilizou-se o software OringPro versão 8.5.

Resultados e Discussão
Os teores de umidade (%) variaram de 20,21±0,00 (cacho-de-uva) à 32,13±0,00 (jandaíra), apresen-
tando distinções entre as médias (p<0,05). A legislação preconiza no máximo 20% (BRASIL, 2000), toda-
via neste e em outros estudos apresentam-se valores superiores, devido ao processo de operculação do mel
destas abelhas (BILUCA, 2014; BRAGHINI, 2016). O conteúdo total de minerais (%) variou de 0,25±0,01
à 0,06±0,03, enquadrando-se no padrão legislativo (máximo 0,6%) (BRASIL, 2000). Este parâmetro rela-
ciona-se com o tipo de solo que a planta e o néctar encontram-se (GOMES et al., 2017). Os méis avaliados
possuem acidez livre acima do determinado legalmente (máximo de 50mEq/Kg) (BRASIL, 2000), variando
de 72,54±1,85 à 132,36±2,17 mEq/Kg. Outras pesquisas já revelaram elevados índices em méis de abelhas
indígenas (BILUCA, 2014; BRAGHINI, 2016). Todas as amostras apresentaram pH ácido, característico do
mel, variando entre 3,16±0,06 e 3,55±0,07, sendo uma faixa ideal para inibir o crescimento de microrganis-
mos (GOMES et al., 2017), favorecendo a estabilidade e vida de prateleira (BILUCA, 2014). O 5-HMF é
uma substância que avalia a degradação do mel, formado pela reação de açúcar em meio ácido e em elevadas
temperaturas (BRAGHINI, 2016). Apenas o mel de cacho-de-uva possui concentração (92,68±5,95mg/Kg)
acima do limite legislativo (máximo de 60mg/Kg) (BRASIL, 2000). O mel de canudo apresentou concentra-
ção abaixo do limite de quantificação e os demais obtiveram 12,65±3,33 (mosquito) e 57,12±0,36 (jandaíra).
Visto isso, não se recomenda armazenamento doméstico, pois em localidades quentes como no Brasil e es-
pecialmente na região amazônica, a formação deste composto pode ocorrer ainda na colmeia (BRAGHINI,
2016). A concentração de sólidos solúveis (ºBrix) dos méis analisados foi de 69,01±0,00 à 78,22±0,00, com
distinções significativas entre si (p<0,05). Este é um parâmetro essencial contra adulterações e relaciona-se
com o conteúdo de açúcares (BRAGHINI, 2016). Os teores de açúcares obtiveram concentrações de frutose
maiores que o de glicose, no qual a somatória destes variou entre 53,52±1,42 à 57,70±1,34%, não apresentan-
do discrepâncias significativas (p<0,05). Segundo a legislação vigente, os açúcares redutores devem ser de no
mínimo 65% (BRASIL, 2000). Todavia, Braghini (2016) e Biluca (2014) também observaram baixos teores.
Para o conteúdo de sacarose, todas amostras apresentam-se abaixo de limite de quantificação do método. Os
méis possuem coloração âmbar-escuro, entretanto seus valores diferiram estatisticamente (p<0,05). A colora-
ção do mel pode estar relacionada com os teores de minerais, umidade, fenólicos, temperatura e tempo de ar-
mazenamento (GOMES et al., 2017). O teor de compostos fenólicos totais (mEAG/00g) variou de 36,90±1,02
(jandaíra) à 129,61±4,87 (cacho-de-uva). Essa disparidade é dependente da planta que abelha coleta o néctar,
sugerindo que há seletividade de flora entre as espécies (BILUCA, 2014). A atividade antioxidante dos méis
variou de 32,43±2,77 à 88,83±0,64 (%). Para ambas análises, a distinção foi significativa (p<0,05) entre as
amostras. Como os compostos fenólicos possuem propriedades antioxidantes, correlacionou-se essas duas va-
riáveis e obteve-se um valor de r² igual a 0,9326, isto é, uma correlação positiva, linear e forte. Além disso, o
mel de cacho-de-uva (Frisiomelitta Cfr. longipes) destacou-se com maior teor fenólico e de inibição radicalar.

61 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

Considerações Finais
Ratifica-se a distinção da composição dos méis entre as espécies de abelhas sem ferrão e também
em relação aos parâmetros legais, carecendo de regulamento específico. O armazenamento à temperatura
ambiente favorece a formação de 5-HMF. Os teor de compostos fenólicos e atividade antioxidante presente
nos méis atribuem propriedades terapêuticas, obtendo significativa correlação. Destaca-se o mel da espécie
Frisiomelitta Cfr. longipes (cacho-de-uva), sendo este o primeiro estudo de caracterização físico-química e
bioativa desta espécie.

Referências
A.O.A.C. (Association of Official Analytical Chemist) (2006). In W. Horwitiz (Ed.), Official methods of
analysis of the AOAC, 18th ed. Washington D.C., USA: Association of Official Analytical Chemists.
BILUCA, F. C. Caracterização química e influência do tratamento térmico em méis de abelha sem ferrão
(meliponinae spp.) produzidos no estado de Santa Catarina. 2014. 112p. Dissertação (Mestrado em Ciências
dos alimentos), Universidade Federal de Santa Catarina, Florianópolis, 2014.
BRAGHINI, F. Estabilidade de méis de abelhas sem ferrão (Meliponinae spp.) submetidos a diferentes
condições térmicas. 2016. 112p. Dissertação (Mestrado em Ciências dos alimentos), Universidade Federal de
Santa Catarina, Florianópolis, 2016.
BRASIL. Ministério da Agricultura, Pecuária e Abastecimento. Instrução Normativa nº 11, de 20 de outubro
de 2000.
Regulamento Técnico de Identidade e Qualidade do Mel. MAPA, Brasília, 2000.
GOMES, V. V. et al. Evaluation of the Quality of Honey Commercialized in Western Pará, Brazil. Revista
Virtual de Química, v. 9, n. 2, 2017.
RIZELIO, V. M. Caracterização química do mel catarinense: composição, atividade antioxidante e o uso
da eletroforese capilar como alternativa na avaliação da qualidade. 2012. 140p. Dissertação (Mestrado em
Ciências dos alimentos), Universidade Federal de Santa Catarina, Florianópolis, 2012.

62 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

OCORRÊNCIA DE MICOBACTÉRIAS NÃO TUBERCULOSAS (MNT) EM PRIMATAS NÃO


HUMANOS NO ZOOLÓGICO DE SANTARÉM-PARÁ

Renata estela souza viana, Welligton Conceição da Silva, Adjanny Estela Santos de Souza , Eveleise Samira
Martins Canto, Maurício Ogusku
FACULDADE DA AMAZÔNIA - UNAMA1, FACULDADE DA AMAZÔNIA - , UNAMA2, UNIVERSIDADE
DO ESTADO DO PARÁ - , UEPA3, UNIVERSIDADE FEDERALDO OESTE DO PARÀ - , UFOPA4 e INSTI-
TUTO NACIONAL DE PESQUISAS DA AMAZÔNIA - e INPA5
estela.renata@outlook.com

Resumo: Introdução: O gênero Mycobaterium é responsável por diversas doenças que podem ser identifica-
das em humanos. Objetivo(s): Preocupados com a saúde dos animais e dos humanos que tem contato com os
mesmos, o presente trabalho objetivou verificar a ocorrência de micobactérias não tuberculosas (MNT) em
primatas não humanos presentes no zoológico de Santarém. Metodologia: Trata-se de um estudo descritivo
quantitativo. Foram utilizados 25 símios, sendo 12 da espécie Sapajus apella (macaco prego); 2 Cebus kaapori
(caiarara); 8 Ateles marginatus (macaco aranha de testa branca); 3 Ateles paniscus (macaco aranha de cara ver-
melha). Foi realizada contenção física seguida de contenção farmacológica, posteriormente foram realizadas
coletas de secreção nasal e orofaríngea com swab estéril. O material biológico foi semeado em meio Ogawa-
-kudoh incubado por até 8 semanas/37oC para o isolamento. Após o isolamento foram realizados esfregaços
para coloração pelo método de Ziehl-Neelsen, em seguida as amostras que confirmaram a presença de bacilos
álcool-ácido resistentes (BAAR) foram encaminhadas para o Laboratório de Micobacteriologia do INPA (Ins-
tituto Nacional de Pesquisas da Amazônia) para identificação da espécie pelos métodos de PRA hsp65 (PCR) e
confirmadas por sequenciamento parcial do gene hsp65. Resultados: Foram coletadas um total de 50 amostras,
sendo 25 secreção nasal e 25 orofaríngea. Em 20% (5) das amostras oriundas da orofaringe foram isolados
Mycobacterium, sendo 1 (4%) M. brumae, 3 (12%) M. peregrinum e 1 (4%) M. porcinum. Em 24% das amos-
tras de secreção nasal foram isolados Mycobacterium, sendo 1 (4%) M. fortuitum e 5 (20%) M. peregrinum.
Considerações finais: As espécies isoladas estão associadas a doenças humanas de natureza oportunista. A pre-
sença de MNT, especialmente aquelas consideradas patógenos emergentes, em amostras de animais selvagens,
em cativeiro, pode implicar em problemas sanitários para estes animais, que vivem sob estresse constante, e
dessa forma também para os humanos que por ventura venham a entrar em contato com eles.

Palavras-chave: Símios,Mycobacterium,Animais silvestres

Introdução
O gênero Mycobacterium é constituído por espécies do complexo M. tuberculosis, M. leprae e outras
denominadas de micobactérias não tuberculosas (MNT) (CVE 2016a). As MNT compreendem mais de 140
espécies identificadas até o momento e podem ser identificadas com base em testes fenotípicos (tempo de cres-
cimento, produção ou não de pigmentos, provas bioquímicas, crescimento ou não na presença de inibidores
químicos e testes moleculares (PRA, PCR Restriction Analysis e sondas genéticas “in house” ou comerciais)
(TORTOLI, 2003). As micobactérias não tuberculosas (MNT) encontram-se dispersas na natureza incluindo
a água natural e potável e, ao contrário das espécies do complexo Mycobacterium tuberculosis (CMTB),
apresentam patogenicidade variável. A capacidade das MNT em produzir doença está claramente documen-
tada na literatura e sua incidência vem aumentando progressivamente, não só pelo fato do homem estar com-
partilhando o mesmo habitat, mas também pela melhora nos métodos de diagnóstico e identificação destes
micro-organismos (FALKINHAM, 2009). As micobactérias de crescimento rápido Mycobacterium fortuitum,
Mycobacterium chelonae e Mycobacterium abscessus são micro-organismos oportunistas, normalmente en-
contrados no solo, na poeira e em encanamentos para água. Dificilmente causam doenças em seres humanos,
a menos que sejam inoculadas diretamente no organismo por feridas traumáticas ou por materiais cirúrgicos
contaminados. O grupo de maior importância clínica das micobactérias atípicas, na classificação de Runyon,
é o grupo das bactérias de crescimento rápido ou grupo 4. Frequentemente envolvidas em infecções de pele
e tecidos moles, já foram responsabilizadas por infecções em cateteres intravenosos e peritoneais, abscessos
após injeções, infecções em sítio cirúrgico, mastoplastias e cirurgias oftálmicas (MACEDO E HENRIQUES,

63 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

2009).
Objetivo
Verificar a ocorrência de micobactérias não tuberculosas (MNT) em primatas não humanos presentes
no zoológico de Santarém-Pará.
Metodologia
Trata-se de um estudo descritivo quantitativo, realizado com animais oriundos do zoológico de San-
tarém. O Zoológico de Santarém (ZOO UNAMA) mantido pela Faculdade UNAMA e Mineração Rio do
Norte é um instrumento fundamental para educação ambiental e preservação de animais silvestres, principal-
mente os que estão ameaçados de extinção e tem como objetivo tratar, manter e reabilitar para estarem aptos
a retornar aos seus ambientes naturais. Neste estudo foram utilizados 25 símios, sendo 12 da espécie Sapajus
apella (macaco prego); 2 Cebus kaapori (caiarara); 8 Ateles marginatus (macaco aranha de testa branca); 3
Ateles paniscus (macaco aranha de cara vermelha). Foi realizada contenção física seguida de contenção far-
macológica com diazepan 1mg/kg e ketamina 10mg/Kg. Em seguida foram realizadas coletas de secreção
nasal e orofaríngea com swab estéril. O material biológico foi semeado em meio Ogawa-kudoh incubado por
até 8 semanas/37oC para o isolamento. Após o isolamento foram realizados esfregaços para coloração pelo
método de Ziehl-Neelsen, em seguida as amostras que confirmaram a presença de bacilos álcool-ácido resis-
tentes (BAAR) foram encaminhadas para o Laboratório de Micobacteriologia do INPA (Instituto Nacional de
Pesquisas da Amazônia) para identificação da espécie pelos métodos de PRA hsp65 (PCR) e confirmadas por
sequenciamento parcial do gene hsp65.
Resultados e Discussão
Foram coletadas 50 amostras, sendo 25 secreção nasal e 25 orofaríngea. Em 20% (5) das amostras
oriundas da orofaringe foram isolados Mycobacterium, sendo 1 (4%) M. brumae, 3 (12%) M. peregrinum e
1 (4%) M. porcinum. Em 24% (6) das amostras de secreção nasal foram isolados Mycobacterium, sendo 1
(4%) M. fortuitum e 5 (20%) M. peregrinum. Embora as espécies isoladas não sejam do complexo Mycobac-
terium tuberculosis (CMT) estão associadas a doenças humanas de natureza oportunista. O Mycobacterium
brumae foi isolado de uma amostra (4%) de secreção orofaríngea, é uma espécie micobacteriana ambiental
de crescimento rápido identificada em 1993. Lee e cols (2004), relatam uma infecção da corrente sanguínea
causada por M. brumae relacionada ao cateter em uma mulher de 54 anos com câncer de mama. Mycobac-
terium peregrinum foi a espécie isolada com maior frequência nas amostras: 12% na secreção orofarígea e
20% na secreção nasal. Esta espécie pertence ao complexo Mycobacterium fortuitum, correspondendo a uma
micobactéria não tuberculosa de crescimento rápido. Esta espécie tem sido isolada esporadicamente de pa-
cientes com imunossupressão, submetidos a cirurgias variadas, incluindo casos de doenças de pele e doenças
dos tecidos moles, peritonite, infecções de sítio cirúrgico, bacteremia primária, pneumonia (NAGAO et al.,
2008). Mycobacterium porcinum foi isolado de uma amostra (4%) de secreção orofaríngea, e tem sido isolado
de pacientes com infecções clínicas incluindo, infecções de feridas (62%), infecções de cateteres centrais e /
ou bacteremia (16%), e possível pneumonia (18%), (WALLACE et al., 2004). O Mycobacterium fortuitum
foi isolado de uma amostra (04%) de secreção nasal e corresponde a uma micobactéria atípica de crescimento
rápido comumente encontrada no meio ambiente em solo e fontes de água; também pode ser isolada em saliva
de seres humanos e eventualmente em pele. As micobactérias podem ser agentes de infecções de feridas ci-
rúrgicas inclusive em cirurgias plásticas, porém com uma frequência pequena e usualmente em casos de surto
(CVE, 2016b).

Considerações Finais
O isolamento de micobactérias não tuberculosas (MNT) em animais selvagens em cativeiro alerta
para a importância destes como fonte de infecção para seres humanos, como tratadores, visitantes, biólogos e
veterinários. Assim, apesar de à primeira vista, não apresentar significado clínico para os animais, este achado
deve servir como alerta para o emprego de estratégias de manejo sanitário que ofereçam melhores condições
de higiene e saúde para estes animais. Ademais, o trabalho indica a necessidade da pesquisa de micobactérias
em outras fontes no zoológico, como a água tratada servida aos animais, por exemplo. Espécies de MNT vem
sendo descritas como causadoras de sérias infecções em pacientes imunossuprimidos, mas também há relatos
de infecção pulmonar crônica em paciente humano imunocompetente, o que os caracteriza como patógenos
emergentes. Assim, a presença de MNT, especialmente aquelas consideradas patógenos emergentes, em amos-

64 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

tras de animais selvagens, em cativeiro, pode implicar em problemas sanitários para estes animais, que vivem
sob estresse constante, e dessa forma também para os humanos que por ventura venham a entrar em contato
com eles.
Referências
CVE 2016a. Centro de vigilância epidemiológica “prof. Alexandre Vranjac”. Recomendações para o
diagnóstico e tratamento das micobacterioses não tuberculosas no estado de São Paulo disponível em http://
www.cve.saude.sp.gov.br/htm/cve_tb.html consulta em 25/01/2016 CVE 2016b.
Centro de vigilância epidemiológica “prof. Alexandre Vranjac”. Orientações para investigação clínica e
tratamento de infecções em ferida cirúrgica de mamoplastia por Mycobacterium fortuitum disponível em
http://www.cve.saude.sp.gov.br/htm/cve_tb.html consulta em 25/01/2016
FALKINHAM JO. Surrounded by mycobacteria: nontuberculous mycobacteria in the human environment. J
Appl Microbiol 2009;107:356-367.
MACEDO, J.L.S.; HENRIQUES, C.M.P. Infecções pós-operatórias por micobactérias de crescimento rápido
no Brasil. Rev Bras Cir Plást. 2009;24(4):544-51.
NAGAO, A.M.; SONOBE B.M.; BANDO, B.T. ; SAITO, A.T.;, SHIRANO, A.M.; MATSUSHIMA
A.A.; FUJIHARA A.N.; TAKAKURA A.S.; IINUMA, A.Y.; ICHIYAMA, S. Surgical site infection due to
Mycobacterium peregrinum: a case report and literature review. International Journal of Infectious DiseasM.
es (2009) 13, 209—211
TORTOLI, E. Impact of genotypic studies on mycobacterial taxonomy: the new mycobacteria of the 1990s.
Clin Microbiol Rev 2003;16(2):19-54.
WALLACE, R.J. JR; BROWN-ELLIOTT, B.A.; WILSON, R.W.; MANN, L.; HALL, L.; ZHANG, Y.; JOST,
K.C. JR; BROWN, J.M.; KABANI, A.; SCHINSKY, M.F.; STEIGERWALT, A.G.; CRIST, C.J.; ROBERTS,
G.D.; BLACKLOCK, Z.; TSUKAMURA, M.; SILCOX, V.; TURENNE, C. Clinical and laboratory features
of Mycobacterium porcinum. J Clin Microbiol. 2004 Dec;42(12):5689-97.

65 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PESQUISA DE FORMAS PARASITOLÓGICAS, PARA FINS DE DIAGNÓSTICO DE


LEISHMANIA SP. PELA CITOLOGIA DE LINFONODO E MEDULA ÓSSEA EM CÃES COM
DIAGNÓSTICO POSITIVOS PELO ELISA PARA LVC, NO MUNICÍPIO DE SANTARÉM-PA

Welligton Conceição Da Silva, Thanael Azevedo De Miranda, Dennis José Da Silva Lima E Raimundo No-
nato Colares Carmago Júnior
FACULDADE DA AMAZÔNIA - UNAMA1, FACULDADE DA AMAZÔNIA - , UNAMA2, FACULDADE DA
AMAZÔNIA - , UNAMA3 e INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DO
PARÁ - e IFPA4
welligton.flamengo@hotmail.com

Resumo: A leishmaniose é uma doença infecciosa de caráter crônico e zoonótico, causado por um protozoário
pleomórfico da ordem Kinetoplastida, família Trypanosomatidae, gênero Leishmania. Apresenta um ciclo bio-
lógico heteroxênico, precisando assim de dois hospedeiros. O diagnóstico laboratorial da leishmaniose pode
ser realizado por meio de exames citológicos, histopatológicos, sorológico e por meio de técnicas de biologia
molecular. Foram utilizados 22 cães, os quais não passaram por processo de triagem, foram observados ani-
mais com e sem sintomatologia clínica, os animais eram machos e fêmeas, todos com idade superior a seis
meses, residentes no Município de Santarém/PA, soropositivos no teste de ELISA. Dos 22 animais ELISA
positivo identificou-se as formas parasitárias amastigotas de Leishmania spp. em 06 (27,27%). Foi observado
que dos 22 animais positivos 2 (duas) amostras foram positivos no CAL (9,09%) e 4 (quatro) amostras positi-
vas na CAL+CMO (18,18%). Contudo, observou-se que a associação das duas técnicas, CAL + CMO é mais
sensível, quando comparada a utilização de uma delas isoladamente.

Palavras-chave: Caninos,Sorologia,Leishmania chagasi.

Introdução
A leishmaniose é uma doença infecciosa de caráter crônico e zoonótico, causado por um protozoário
pleomórfico da ordem Kinetoplastida, família Trypanosomatidae, gênero Leishmania. Apresenta um ciclo
biológico heteroxênico, precisando assim de dois hospedeiros, um vertebrado, que pode ser um animal silves-
tre, doméstico ou seres humanos, e de um invertebrado, geralmente um flebotomíneo que atua como vetor de
transmissão da doença (SONODA, 2007; SILVA, 2011). O cão é considerado o principal reservatório domés-
tico de L. chagasi, tanto em ambiente urbano quanto rural. Os reservatórios silvestres da doença são raposas
(Cerdocyonthous), marsupiais (Didelphis albiventris) e roedores (Nectomys squamipes) (DANTAS-TORRES
et al., 2006; REY, 2008). A importância do cão como reservatório de L. chagasi deve-se ao fato de apresentar
intenso parasitismo cutâneo e ser capaz de transmitir o parasita ao vetor mesmo assintomático, constituindo-
-se em um fator essencial para disseminação, amplificação de focos e normalmente antecedendo o acometi-
mento de casos em humanos (MADEIRA et al., 2004; NUNES et al., 2010). O diagnóstico laboratorial da
leishmaniose pode ser realizado por meio de exames citológicos, histopatológicos, sorológico e por meio de
técnicas de biologia molecular (IKEDA-GARCIA & FEITOSA, 2006). No Brasil, os testes mais utilizados no
diagnóstico de leishmaniose visceral humana e canina são a Reação de Imunofluorescência Indireta (RIFI) e
o EnzymeLinkedImmunoSorbentAssay (ELISA), sendo considerados, sobretudo este último, testes de esco-
lha para inquéritos populacionais (GONTIJO e MELO, 2004). O Teste DPP® é caracterizado por ser rápido,
pois o resultado é conhecido após 15 minutos da coleta da amostra biológica (soro, plasma e sangue total), é
de fácil manipulação, pois não precisa de mão de obra especializada para a sua execução, apresentam maior
sensibilidade (98%) em animais sintomáticos quando comparado aos animais assintomáticos (47%) (GRI-
MALDI et al., 2012). O teste de ELISA é o mais utilizado para imunodiagnóstico de leishmaniose visceral.
É um teste rápido, de fácil execução e leitura, sendo um poucomais sensível. O teste é sensível, permitindo
a detecção de baixos títulos de anticorpos, mas é pouco preciso na detecção de casos subclínicos ou assinto-
máticos, A técnica possui sensibilidade de 80 a 100% (GONTIJO e MELO, 2004). Segundo o Ministério da
Saúde (2006), a punção aspirativa esplênica é o método parasitológico que oferece maior sensibilidade (90-
95%) para demonstração do parasita (porém, apresenta restrições quanto ao procedimento), seguida pelo o

66 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

aspirado de medula óssea, biópsia hepática e a aspiração de linfonodos. Por ser um procedimento mais seguro,
recomenda-se a punção aspirativa da medula óssea (LAURENTI, 2009). Os resultados positivos utilizando
aspirados de medula óssea produzem sensibilidade entre 30 e 83% e em aspirados de linfonodos de 30a 85%,
quando ambos são combinados este percentual pode variar de 71 a 91% (LAURENTI, 2009).

Objetivo
Verificar a presença de formas parasitológicas de Leishmania capazes de comprovar o diagnóstico
parasitológico direto para LVC nos animais sabidamente positivos no ELISA.

Metodologia
Foram utilizados 22 cães, os quais não passaram por processo de triagem, foram observados animais
com e sem sintomatologia clínica, os animais eram machos e fêmeas, todos com idade superior a seis meses,
residentes no Município de Santarém/PA, soropositivos no teste de ELISA. Os animais eram submetidos ini-
cialmente ao teste rápido DPP imunocromatográfico e posteriormente no teste de ELISA para confirmação do
diagnóstico. Foi realizada a citologia aspirativa de linfonodo (CAL), preferencialmente o linfonodo poplíteo
e citologia de aspirado de medula óssea (CMO) (colhida preferencialmente pela asa do íleo) de todos os 22
animais. Ambos os procedimentos foram realizados com o uso de agulhas descartáveis 1,2x40 mm e seringas
de 10 ml contendo 0,05mL de ácido etilenodiamino tetra-acético (EDTA). Após a coleta de cada material, os
mesmos foram transferidos para uma lâmina de vidro para a realização do esfregaço. Posteriormente foram
corados com corante hematológico rápido e analisados em microscopia óptica com objetiva de imersão em
aumento de 1000x, realizando a leitura de pelo menos 200 campos, para identificar a presença de formas amas-
tigotas, tal forma foi identificada de acordo com a descrição de Ikeda-Garcia E Feitosa (2006).

Resultados e Discussão
Dos 22 animais ELISA positivoidentificou-se as formas parasitárias amastigotas de Leishmania spp.
em 06 (27,27%). Foi observado que dos 22 animais positivos 2 (duas) amostras foram positivos no CAL
(9,09%) e 4 (quatro) amostras positivas na CAL+CMO (18,18%). Segundo Laurenti (2014) a busca por novas
técnicas de diagnósticos precisos de leishmaniose devem ser investigadas, pois a sorologia não apresenta uma
forma ideal de diagnostico, devido a sua reduzida sensibilidade em detectar cães assintomáticos e sua baixa
especificidade. Diante disso, alguns autores como Ferrer (1999) e Koutinas et al. (2001) buscaram comparar
técnicas de diagnóstico para leishmaniose. Segundo Ferrer (1999), o método de diagnóstico parasitológico
é utilizado com freqüência na clínica de pequenos animais, sendo a técnica rápida e com lesões traumáticas
reduzidas. Um estudo parasitológico realizado por Koutinas et al. (2001) e Ferrer et al. revelou que a quanti-
dade de animais positivos parasitologicamente através da CMO foi 50 % e para CAL 30%. Em contrapartida,
Furtado (2011), encontrou no seu estudo que o CMO apresentou (50%), enquanto o CAL (37,5%); valores
superiores aos encontrados neste estudo. Ferraz (2015) realizou um estudo comparativo para o diagnóstico de
leishmaniose, utilizando a comparação do swab oral que apresentou (67,4%) em relação ao swab conjuntival
(68,5%), os dois quando comparados ao aspirado de linfonodo (84,8%) apresentam menor sensibilidade na
detecção do parasita. Realizou ainda a comparação do swab oral isoladamente o qual apresentou (36,7%),
quando combinados com a aspiração do linfonodo demostraram-se aumento expressivo (86,7%), combinado
com o swab conjuntival e DPP (83,4%). Nos caninos sintomáticos a combinação da PCR com o swab oral
apresentou sensibilidade de (82,3%), tendo elevação quando associado ao swab conjuntival (93,6%), subiu
para (95,2%) na combinação com todos os swabs e atingiu o máximo quando associado a aspiração do linfo-
nodo (98,4%). No presente estudo é observada uma maior sensibilidade do CAL associado ao CMO, desse
modo pode se perceber que a técnica de aspiração dos linfonodos se torna superior no quesito sensibilidade se
compara da a swabs orais e conjuntivais.

Considerações Finais
Neste estudo foi obtido (9,09%) de animais positivos segundo a técnica da CAL e 18,18% na asso-
ciação das duas técnicas, CAL + CMO, não havendo resultados positivos somente para a técnica CMO nos
animais soropositivos pela técnica de ELISA. Isso demonstrou que a associação das duas técnicas, CAL +
CMO é mais sensível, quando comparada a utilização de uma delas isoladamente.

67 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

Referências
DANTAS-TORRES, F.; BRANDÃO-FILHO, S. P. Visceral leishmaniasis in Brazil:
revisitingparadigmsofepidemiologyandcontrol. Revista do Instituto de Medicina Tropical de São Paulo, v. 48,
n. 3, p. 151 – 156, 2006.
FERRAZ, M. A. Desempenho do swab oral no diagnóstico molecular de cães naturalmente infectados
por Leishmania (Leishmania) infantum/ Mariana Aschar Ferraz. São Paulo, 2015. Dissertação (mestrado),
Faculdade de Medicina da Universidade de São Paulo.
FERRER, L. M. Clinical aspects of canine leishmaniasis. In: Canine Leishmaniasis: an update. Proceedings of
the International Canine Leishmaniasis Forum. Barcelona Spain. Wiesbaden: Hoeschst Roussel Vet, p. 6-10,
1999.
FURTADO, M.V.L., VIOL, M.A. e BABO-TERRA, V.J. Pesquisa de amastigotas de Leishmania spp. em
linfonodos, medula óssea, baço, pele e sangue de cães naturalmente infectados. PUBVET, Londrina, V. 5, N.
30, Ed. 177, Art. 1198, 2011.
KOUTINAS,A. F.; SARIDOMICHELAKIS, M. N.; MYLONAKIS, M. E.; LEONTIDES, L.; POLIZOPOULOU,
Z.; BILLINIS, C.; ARGYRIADIS, D.; DIAKOU, N.; PAPADOPOULOS, O. A randomised, blinded, placebo-
controlled clinical trial with allopurinol in canine leishmaniosis. VeterinaryParasitology v. 98, n. 4, p. 247-261,
2001.
GRIMALDI, G.; TEVA, A.; FERREIRA, A. L.; SANTOS C. B.; PINTO I. S.; AZEVEDO, C. T.; FALQUETO,
A. Evaluationof a novel chromatographicimmunoassaybasedon Dual-Path Platform technology (DPP® CVL
rapidtest) for theserodiagnosisofcanine visceral leishmaniasis. Transactions of the Royal Society of Tropical
Medicine and Hygiene, v.106, p. 54–59, 2012.
GONTIJO, C. M. F.; MELO, M. N. Leishmaniose visceral no Brasil. Revista Brasileira de Epidemiologia, v.
7, n. 3, p. 338-349, 2004.
IKEDA-GARCIA, F. A.; FEITOSA, M. M. Métodos de diagnóstico da leishmaniose visceral canina.
ClínicaVeterinária, v. 11, n. 1, p. 32-38, 2006.
KAMHAWI, S. Phlebotomine sand flies and Leishmania parasites: friends or foes? Trends in Parasitology, v.
22, n. 9, 2006.
LAURENTI, MD, de Santana Leandro MV Jr, Tomokane TY, de Lucca HR, Aschar M, Sousa CS, Silva RM,
Marcondes M, da Matta VL, Comparative evoluation of the DDP CVL rapid test for canine serodiagnosis in area
of visceral leishmaniasis. Vet Parasit.2014; pii: S0304-4017(14)00487-7. Dói: 10.1016/j.vetpar.2014.09.002.
LAURENTI, M.D. Correlação entre o diagnóstico parasitológico e sorológico na leishmaniose visceral canina.
Bepa, v.67, p.13-23, 2009.
MADEIRA, M. F.; SCHUBACH, A. O.; SCHUBACH, T. M.; LEAL, C. A.; MARZOCHI, M. C. Identification
of Leishmania (Leishmania) chagasi isolated from healthy skin of symptomatic and asymptomatic dogs
seropositive for leishmaniasis in the municipality of Rio de Janeiro, Brazil. The Brazilian Journal of Infectious
Diseases, v. 8, n. 6 p.440–444, 2004.
MINISTÉRIO DA SAÚDE/ SECRETARIA DE VIGILÂNCIA EM SAÚDE/DEPARTAMENTO de
VIGILÂNCIA EPIDEMIOLÓGICA. Manual de Vigilância e Controle da Leishmaniose Visceral. Série A:
Normas e Manuais Técnicos. Brasília,122p., 2006.
NUNES, C. M.; PIRES, M. M. P.; DA SILVA, K. M.; ASSIS, F. D.; GONÇALVES-FILHO, J.; PERRI, S.
H. V. Relationship between dog culling and incidence of human visceral leishmaniasis in an endemic area.
VeterinaryParasitology, v. 170, n. 1-2, p. 131–133, 2010.
SILVA, T. P.VD.; SANTOS, J. P. Leishmaniose Visceral Canina em Bom Jesus, Piauí, Brasil: Um Relato de
Caso Autóctone. Enciclopédia Biosfera, v. 7, n. 13, 2011.
SILVA, T. P.VD.; SANTOS, J. P. Leishmaniose Visceral Canina em Bom Jesus, Piauí, Brasil: Um Relato de
Caso Autóctone. Enciclopédia Biosfera, v. 7, n. 13, 2011. SONODA, M. C. Leishmaniose visceral canina:

68 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ANÁLISE DO BEM-ESTAR SUBJETIVO INFANTIL A PARTIR DO DESENHO DA FIGURA


HUMANA: CARACTERÍSTICAS DA PESSOA FELIZ E INFELIZ.

Raquel dos Santos Correa, Iana Maria Rodrigues Cordovil, Samara Tavares Silva, Adria Miranda Silva e
Iani Dias Lauer Leite
Universidade Federal Do Oeste Do Pará - UFOPA
raquel-dsc1@hotmail.com

Resumo: O bem-estar subjetivo é a análise subjetiva de cada pessoa realiza sobre si. Esse estudo, pretendeu
avaliar o bem-estar subjetivo infantil a partir do desenho da figura humana. Os participantes desse estudo
possuíam idade entre 8 e 11 anos (m=8,16), entre os quais haviam 13 crianças, 8 meninos e 5 meninas, sendo
utilizado como instrumento para a coleta de dados a técnica DFH. No desenho da pessoa feliz destacaram-
-se com maiores médias os itens 3 (M=4,91), 12 (M=5,0) e 14 (M=5,0), que dizem respeito a integração da
figura como um todo, formato da boca e braços estendidos. As menores médias foram nos itens 9 (M=2,0),
10 (M=2,67), 17 (M=2,33) e 18 (M=1,0): esses quatro itens tratam da presença de elementos externos no de-
senho, como elementos da natureza, automóveis, construções, símbolos afetivos e objetos próximos à figura
ou sendo portados por ela. No desenho da pessoa infeliz foram identificados características como: (a) Boca
expressando aspecto de afeto negativo, (b) Olhos expressando afeto negativo, (c) Presença de elementos
da natureza (Chuva, trovões), (d)Braços cruzados,(e) Presença de machucados pelo corpo, (f) Presença ou
qualquer tentativa de representar lagrimas/choro, (g) Utilização de “emoticons” ou figuras que representem
afeto negativo, (h) Utilização de figuras imaginárias de cunho negativo (vampiros, monstros), e (i) Qualquer
tentativa de expressão facial que expresse raiva. Em linhas gerais as duas possibilidades de estado da figura
humana dadas aos infantes (pessoa feliz e infeliz), permitiram às mesmas refletir e aplicar nos desenhos, dis-
tinções entre um ser feliz e infeliz e possuir mais clareza sobre a concepção de bem-estar e consequentemente
a possibilidade de coexistência de afetos negativos e positivos e do caráter transitório dos graus de BES. Nesse
sentido, os resultados obtidos identificaram bem-estar para a maioria dos participantes, à exceção de 3 crian-
ças, que apresentaram médias baixas conforme o DFH.

Palavras-chave: bem estar subjetivo,pesquisa com crianças,desenho da figura humana

Introdução
Os estudos de Viapiana; Bandeira; Giacomoni (2016) validaram a avaliação do Bem-estar subjeti-
vo (BES) através do desenhou da figura humana (DFH) por intermédio do desenvolvimento de indicadores
que mensurassem o BES no DFH. Nesse contexto, o bem-estar subjetivo surge como a análise subjetiva de
cada pessoa realiza sobre si. O desenho é um dos canais comunicativos mais antigos conhecidos pelo homem
(ARTECHE & BANDEIRA,2006; SUEHIRO, ET AL:2016), podendo medir fatores cognitivos, emocionais,
de personalidade e de criatividade (WECHSLER et al, 2011; OLIVEIRA &WECHSLER, 2016). Essa ferra-
menta tem sido amplamente utilizada para a avaliação psicológica de crianças (VIAPIANA; BANDEIRA;
GIACOMONI, 2016), podendo ser “entendida como expressão de aspectos desenvolvimentais” (ARTECHE
& BANDEIRA,2006). Os usos de desenhos em pesquisas com crianças resguardam que o desenho é uma das
formas de comunicação da cultura infantil. Sendo um recurso familiar para a criança, possibilita um caminho
viável para a compreensão de concepções infantis dado algum tema. O desenho permite que a criança exprima
graficamente (em alguns casos junto com a escrita) suas percepções sobre os contextos sociais e culturais,
além de favorecer o entendimento de aspectos de personalidade e de dimensões emocionais e cognitivas.
Dessa maneira, o presente estudo pretende avaliar o bem-estar subjetivo infantil a partir do desenho da figura
humana, elencando características marcadoras da pessoa feliz e infeliz, julgadas pelos infantes participantes
da pesquisa.

69 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

Objetivo
Geral: Avaliar o bem-estar subjetivo infantil a partir do desenho da figura humana.
Específicos: Identificar características marcadoras da pessoa feliz e infeliz no DFH na visão dos in-
fantes de 08 (oito) a 11 (onze) anos de idade, participantes de um projeto de inclusão social, localizado na área
urbana do município de Santarém/PA. Averiguar o bem-estar subjetivo das crianças participantes mediante o
uso da técnica Desenho da Figura Humana.

Metodologia
Os participantes desse estudo possuíam idade entre 8 e 11 anos (m=8,16), entre os quais haviam 13
crianças, 8 meninos e 5 meninas, todos participantes de um projeto de educação musical e inclusão social,
intitulado Sementes Musicais, sendo 75% dos participantes oriundos de escola pública. Quanto ao instrumen-
to para a coleta dos dados, foi utilizada a técnica do Desenho da Figura Humana (DFH). Para o desenho da
criança feliz, no que tange a análise, foram considerados os indicadores desenvolvidos por Viapiana, Bandeira
e Giacomini (2016) e para o desenho da pessoa infeliz foi realizada análise descritiva dos desenhos. O DFH
pretendeu que a criança através de suas representações gráficas expressasse suas concepções acerca de carac-
terísticas que ela julga essenciais para uma pessoa feliz e infeliz.

Resultados e Discussão
Esse estudo, considerou os indicadores desenvolvidos por Viapiana; Bandeira; Giacomoni, (2016)
para a avaliação de bem-estar subjetivo (BES) através do desenhou da figura humana (DFH). No referido
estudo foram construídos 18 indicadores para constituir o sistema de avaliação BES/DFH: Linhas firmes,
bem controladas, sem nenhuma ondulação (mais da metade da figura; União das linhas; Integração da figura;
Proporção adequada; Simetria adequada; Limpeza; Tamanho médio da figura; Figura central; Pano de fundo;
Símbolos afetivos; Penteado; Boca expressando sorriso; Braços não estendidos; roupa, sapato; detalhes; obje-
tos; objetos inanimados. O teste de validade do sistema proposto, garantiu 91% de concordância entre os três
juízes que o analisaram revelando alto nível de fidedignidade. Para a presente pesquisa, cada participante foi
convidado a produzir dois desenhos: primeiro de uma Pessoa Normal, e o segundo de uma pessoa infeliz. Os
desenhos da pessoa feliz foram analisados segundo os 18 itens propostos por Viapiana, Bandeira e Giacomoni
(2016) enquanto que o desenho da pessoa infeliz proporcionou o levantamento rudimentar de fatores que as
crianças julgaram como pertencentes a afetos negativos, sendo considerado a analise do desenho em si e os
discursos dos infantes ao explicarem seus desenhos. Os desenhos da pessoa feliz foram analisados conforme
os itens do sistema desenvolvido pelas referidas autoras, com gradação variando de 1 (ausente) a 5 (apresenta).
Os itens variavam desde as características das linhas, simetria dos membros, presença de roupas até objetos
contidos nos desenhos. Para essa análise participaram a pesquisadora e 2 colaboradoras, que avaliaram sepa-
radamente cada desenho. As maiores médias para o desenho da Pessoa Feliz foram nos itens 3 (M=4,91), 12
(M=5,0) e 14 (M=5,0), que dizem respeito a integração da figura como um todo, formato da boca e braços
estendidos. As menores médias foram nos itens 9 (M=2,0), 10 (M=2,67), 17 (M=2,33) e 18 (M=1,0): esses
quatro itens tratam da presença de elementos externos no desenho, como elementos da natureza, automóveis,
construções, símbolos afetivos e objetos próximos à figura ou sendo portados por ela. As médias por parti-
cipante variaram de 4,27 a 2,61 no desenho da Pessoa Feliz. Sobre o desenho da pessoa infeliz, as crianças
foram convidadas a desenhar uma pessoa infeliz, no intento de elencar características julgadas por elas, como
referentes a uma pessoa infeliz. O propósito dessa categoria de desenho, visou promover análises subjetivas
mais aprofundadas, acerca do que elas consideravam característicos de uma pessoa feliz e infeliz, contri-
buindo para um melhor entendimento das concepções de bem-estar subjetivo infantil. Entre os elementos
destacados pelas crianças para essa última categoria de desenho, foram identificados características como: (a)
Boca expressando aspecto de afeto negativo, (b) Olhos expressando afeto negativo, (c) Presença de elementos
da natureza (Chuva, trovões), (d)Braços cruzados,(e) Presença de machucados pelo corpo, (f) Presença ou
qualquer tentativa de representar lagrimas/choro, (g) Utilização de “emoticons” ou figuras que representem
afeto negativo, (h) Utilização de figuras imaginárias de cunho negativo (vampiros, monstros), e (i) Qualquer
tentativa de expressão facial que expresse raiva. Os resultados, em termos globais, trouxeram indicativos de
bem-estar para a maioria dos participantes, à exceção de 3 crianças, que apresentaram médias baixas conforme
o DFH. Nota-se que a criança ao produzir o desenho incorpora elementos familiares ao seu contexto e ao seu
estado psicológico no momento do desenho remontando as oscilações nos graus de BES que uma pessoa pode
70 JOVEM PESQUISADOR - GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

apresentar.

Considerações Finais
Diante das duas possibilidades de categorias de estado da figura humana dadas aos infantes (pessoa
feliz e infeliz), as crianças puderam refletir e aplicar nos desenhos, distinções entre um ser feliz e infeliz e
possuir mais clareza sobre a concepção de bem-estar e consequentemente a possibilidade de coexistência de
afetos negativos e positivos e do caráter transitório dos graus de BES. Salientamos que, satisfatórios níveis
de BES não implicam na existência ou aplicabilidade de todos os aspectos identificados pelas crianças, eles
formam um conjunto de elementos que possuem interrelações com o conceito de BES, e na medida em que
são vivenciados resultam ou interferem com intensidades distintas na avaliação de cada pessoa.

Referências
ARTECHE, A. X.; BANDEIRA, D. R. O desenho da figura humana: Revisando mais de um século de
controvérsias. Ridep, Nº 22 · Vol. 2 · 2006 · 133-155.
GIACOMINI, C.M. (2002). Bem estar subjetivo infantil: conceito de felicidade e construção de instrumentos
para avaliação. Tese de doutorado não publicada. Instituto de Psicologia, UFRGS.
OLIVEIRA, Karina da Silva; WECHSLER, Solange M. Indicadores de Criatividade no Desenho da Figura
Humana. Psicologia: Ciência e Profissão, Vol.36 Nº 1, p. 6-19. Campinas, jan/mar. 2016.
VIAPIANA, V. F., BANDEIRA, C. M., & GIACOMONI, C. H. Bem-Estar Subjetivo infantil: avaliação por
meio do Desenho da Figura Humana. Avaliação Psicológica, 2016, 15(1), pp. 49-59.
WECHSLER, Solange M. Et Al. Desenho da Figura Humana: Análise da Prevalência de Indicadores para
Avaliação Emocional. Psicologia: Reflexão e Critica, 24(3), 411-418. Campinas, abril, 2011. Disponível em:
www.scielo.br/prc. Acessado em: 20/03/2017.

71 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PERFIL DAS MULHERES COM CÂNCER DO COLO DE ÚTERO E DE MAMA ATENDIDAS


NO HOSPITAL REGIONAL DO BAIXO AMAZONAS, SANTARÉM/PA, 2010 A 2015.

Larissa Ádna Neves Silva, Eluane Katriny Silva de Sousa, Juliana Gagno Lima e Heloisa do Nascimento
Moura Meneses
UNIVERSIDADE FEDERALDO OESTE DO PARÀ - UFOPA1, UNIVERSIDADE FEDERALDO OESTE DO
PARÀ - , UFOPA2, UNIVERSIDADE FEDERALDO OESTE DO PARÀ - , UFOPA3 e UNIVERSIDADE FE-
DERALDO OESTE DO PARÀ - e UFOPA4
laralissa_@hotmail.com

Resumo: O câncer do colo de útero e de mama estão entre os mais prevalentes na população feminina. Ainda
são muitos os desafios que determinam a resolutividade dos serviços de saúde, contudo o papel continuo das
equipes de saúde é monitorar e realizar buscas ativas dessas mulheres, de forma a reduzir os indicadores de
morbimortalidade. Dessa forma o trabalho busca descrever o perfil das mulheres com câncer do colo de útero
e de mama atendidas no Hospital Regional do Baixo Amazonas, no município de Santarém, Pará, no período
de 2010 a 2015. Trata-se de uma pesquisa descritiva, com abordagem quantitativa, no qual foram utilizados
dados secundários do Sistema de Informação de Registro Hospitalar de Câncer (SIS-RHC). Para caracterizar
o perfil, foram consideradas as variáveis: ocupação, faixa etária e nível de escolaridade, de mulheres atendidas
no período de 2010 a 2015 no Hospital Regional do Baixo Amazonas, procedentes do município de Santarém.
Os resultados apresentam que no município de Santarém, Pará, foram registrados no período de 2010 a 2015,
211 casos de localização primária do câncer de mama e 212 de câncer do colo de útero. No perfil das pacientes
internadas verificou-se que para o primeiro, a maior prevalência na faixa etária de 50 a 59 anos (28%), com
fundamental incompleto (26%) e geralmente domésticas (33%), seguida de professoras (6,2%) e trabalhado-
ras agrícolas (4%). Enquanto que para o segundo, observou-se que a idade varia de 35 a 54 anos (48%), com
fundamental incompleto (33%) e frequentemente são domésticas (36%), seguida de trabalhadoras agrícolas
(12%) e pescadoras (2,4%). Assim, os dados mostram que o câncer de mama acomete mais mulheres adultas
intermediária, enquanto o câncer do colo de útero cada vez se apresenta em uma faixa etária menor na cidade
de Santarém, Pará. Tal fator sugere que pode estar ocorrendo atividades sexuais precoces ligadas a automedi-
cação com anticoncepcionais orais, ou deve relacionar-se com a ampliação de buscas ativas pelas equipes de
saúde na realização do rastreamento. Ainda poderia ser justificado pelas dificuldades de acesso aos serviços de
saúde, principalmente ao que cabe os serviços da Atenção Básica na realização de exames.

Palavras-chave: Saúde da mulher, Câncer do colo de útero, Câncer de mama.

Introdução
Dados do Instituto Nacional do Câncer (INCA) apontam o câncer de mama e câncer do colo de útero
como os mais incidentes entre as mulheres brasileiras na Região Norte. Estima-se que em 2018, o Estado do
Pará apresente mais de 2.000 casos novos, sendo valores referentes a 100 mil habitantes. Mesmo com uma po-
lítica específica para as mulheres, ainda existem fatores que determinam a resolutividade dessas necessidades
de saúde que podem estar relacionados a dificuldades no acesso e acolhimento (rigidez na agenda das equipes),
barreiras culturais, sociais e ambientais (resistência, discriminação ou despreparo dos profissionais) e falhas
na abordagem clínica, ocasionando o afastamento do serviço de saúde (BRASIL, 2016). De acordo com Thu-
ler e Medonça (2005), ambos os cânceres são de bom prognóstico, caso diagnosticado e tratado precocemente.
No diagnóstico precoce do câncer de mama insere-se a mamografia e o exame clínico das mamas, enquanto o
câncer do colo uterino tem se concentrado no rastreamento de mulheres sexualmente ativas através do exame
citopatológico do colo uterino. Entretanto os autores reforçam que o diagnóstico tardio pode provocar eleva-
das taxas de mortalidade, o que pode sugerir fragilidades na prestação de procedimentos terapêuticos a essas
pacientes. Na perspectiva acima, o papel da Estratégia Saúde da Família (ESF) é ampliar o rastreamento e
monitorar a população feminina com buscas ativas, reduzindo os indicadores de morbimortalidade por estas

72 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

neoplasias. Dessa forma traçar o perfil dessas mulheres é importante para conceber resultados sobre a relação
dessas usuárias com os serviços e planejar os processos de trabalho das equipes, disponibilizando dados epi-
demiológicos sobre qual público está vulnerável e promovendo ações preventivas nesses grupos específicos.

Objetivo
Descrever o perfil de mulheres com câncer do colo de útero e mama atendidas no Hospital Regional
do Baixo Amazonas, no município de Santarém/PA, no período de 2010 a 2015.

Metodologia
Trata-se de uma pesquisa descritiva, com abordagem quantitativa, no qual foram utilizados dados
secundários do Sistema de Informação de Registro Hospitalar de Câncer (SIS-RHC). Para caracterizar o per-
fil, foram consideradas as variáveis: ocupação, faixa etária e nível de escolaridade, de mulheres atendidas no
período de 2010 a 2015 no Hospital Regional do Baixo Amazonas, procedentes do município de Santarém,
Pará. A base de dados está disponível no site < https://irhc.inca.gov.br/RHCNet/selecionaBaseExterno.ac-
tion?tipo=1 >. Para visualização dos dados e cálculos de porcentagens foi utilizado o programa Microsoft
Excel 2016.

Resultados e Discussão
O câncer de mama no Brasil é a segunda maior causa de óbitos na população feminina e segundo o
INCA, no ano de 2018, espera-se mais de 1000 casos novos dessa neoplasia no Estado do Pará. Penha et al.
(2013) colocam que as condições socioeconômicas podem influenciar positivamente na ocorrência do câncer,
por agregar fatores como tabagismo, consumo de álcool, hábitos alimentares, obesidade, ocupação e acesso
aos serviços de saúde. No município de Santarém, Pará, foram registrados no período de 2010 a 2015, 211
casos de localização primária do câncer de mama, o que equivale a 11,89% de todos os outros cânceres. No
perfil das pacientes internadas verificou-se uma maior prevalência na faixa etária de 50 a 59 anos (28%), com
fundamental incompleto (26%) e geralmente domésticas (33%), seguida de professoras (6,2%) e trabalhadoras
agrícolas (4%). Estes resultados corroboram com o estudo feito por Silva (2009), que entrevistou na cidade de
Vitória, Espírito Santo, 2930 mulheres e identificou que os casos mais prevalentes de câncer de mama eram em
mulheres com ensino fundamental incompleto (33,2%) e dentre as ocupações, 8,1% faziam trabalhos de ser-
ventia (domésticas, copeira, babás, caseiras) e 6,1% eram professoras. Tais resultados mostram que há relação
entre a ocupação e nível de escolaridade com a exposição ao câncer de mama. Segundo o Ministério da Saúde
(2016), o câncer do colo de útero é o quarto maior tipo mais comum de câncer entre as mulheres brasileiras.
Figrato e Hoga (2003) colocam que tal prevalência pode estar relacionada com fatores socioeconômicos e am-
bientais e o estilo de vida, este último ligado à pluralidade de parceiros sexuais, tabagismo, hábitos inadequa-
dos de higiene e o uso contínuo de anticoncepcionais orais. Para o câncer do colo do útero foram registrados
no período de 2010 a 2015, 212 casos de localização primária, representando 11,9% dos cânceres apresentados
no município de Santarém, Pará. Caracterizando as mulheres internadas nesse intervalo de tempo, observou-se
que a idade varia de 35 a 54 anos (48%), com fundamental incompleto (33%) e frequentemente são domésticas
(36%), seguida de trabalhadoras agrícolas (12%) e pescadoras (2,4%) corroborando com os dados ocupação
e nível de escolaridade das pacientes internadas com localizações primárias do câncer de mama. Observando
dados da Sala de Apoio a Gestão Estratégica do Ministério da Saúde (SAGE) sobre a saúde da mulher, espe-
cificamente a prevenção e tratamento de câncer do colo e mama, vê-se que em relação ao número de exames
citopatológicos entre os anos de 2011 a 2017 houve decréscimo de aproximadamente ou maior que 1% a cada
ano. Sobre o número de mamografias nesse mesmo período verificou-se um aumento de 15% do total de exa-
mes realizados (BRASIL, 2018).

Considerações Finais
Os resultados apresentados mostram que o câncer de mama acomete mais mulheres adultas interme-
diária, enquanto o câncer do colo de útero cada vez se apresenta em uma faixa etária menor na cidade de San-
tarém, Pará. Tal fator sugere que pode estar ocorrendo atividades sexuais precoces ligadas a automedicação
com anticoncepcionais orais, ou deve relacionar-se com a ampliação de buscas ativas pelas equipes de saúde
na realização do rastreamento. Caberia ainda avaliar quais os tipos de informação que os profissionais estão
repassando as usuárias, bem como a disponibilidade na agenda da equipe para prestar o atendimento Autores
73 JOVEM PESQUISADOR - GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

afirmam a relação da ocupação com os cânceres apresentados o que pôde ser observado nos resultados, geral-
mente os casos incidentes e prevalentes são em atividades profissionais que exigem esforço físico e mental,
ou estilo de vida associado a exposição aos determinantes: tabagismo, produtos químicos, consumo de álcool,
hábitos alimentares, entre outros. Ainda poderia ser justificado pelas dificuldades de acesso aos serviços de
saúde, principalmente ao que cabe os serviços da Atenção Básica.

Referências
BRASIL, Ministério da Saúde. Secretaria Nacional de Assistência à Saúde. Instituto Nacional de Câncer.
Estimativa da incidência e mortalidade por câncer na Região Norte e Pará para 2018. Rio de Janeiro: INCA;
2018
BRASIL. Ministério da Saúde. Protocolos da Atenção Básica: Saúde das Mulheres / Ministério da Saúde,
Instituto Sírio-Libanês de Ensino e Pesquisa – Brasília, 2016.
BRASIL, Ministério da Saúde, SAGE – Sala de Apoio à Gestão Estratégica. Dados dos anos de 2011 a 2017.
Brasília, 2018.
FRIGATO, Scheila. HOGA, Luiza Akiko Komura. Assistência à mulher com câncer de colo uterino: o papel
da enfermagem. Revista Brasileira de Cancerologia, 2003, 49(4): 209-214.
PENHA, Nathalia Santos da et al. Perfil sociodemográfico e possíveis fatores de risco em mulheres com
câncer de mama: um retrato da Amazônia. Rev Ciênc Farm Básica Apl. 2013;34(4):579-584.
SILVA, Priscilla Ferreira e. Perfil de mulheres com câncer de mama atendidas em Vitória – ES: influência
das variáveis sociodemográficas com o estadiamento clínico do tumor antes do tratamento. Vitória, 2009.
[Dissertação].
THULER, Luiz Claudio Santos. MENDONÇA, Gulnar Azevedo. Estadiamento inicial dos casos de câncer de
mama e colo do útero em mulheres brasileiras. Rev Bras Ginecol Obstet. 2005; 27(11): 656-60

74 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PERFIL DE RESISTÊNCIA ANTIMICROBINA DOS ESTAFILOCOCOS PRESENTES NAS


SUPERFÍCIES DA UTI DE UM HOSPITAL DA AMAZÔNIA.

Arthur Menezes Vaz, Caio Lucas Dourado, Marcelo José Sanches da Rocha, Gabriel Matthews Magalhães
Céspedes, Juarez de Souza e Yane Santos Almeida
Universidade do Estado do Pará - UEPA1, Universidade do Estado do Pará - , UEPA2, Universidade do Es-
tado do Pará - , UEPA3, Iespes - , IESPES 4, Universidade do Estado do Pará - , UEPA5 e Universidade do
Estado do Pará - e UEPA6
arthurmenezesvaz@gmail.com

Resumo: Esta pesquisa analisou microbiológicamente áreas da Unidade de Tratamento Intensivo (UTI) do
hospital municipal de Santarém (HMS), local de pacientes debilitados, expostos a procedimentos invasivos e
a colonização microbiológica. O estudo foi realizado em superfícies inertes da UTI por meio da coleta com
swabs, e as amostras coletadas foram cultivadas e identificadas quanto ao crescimento bacteriano e a reali-
zação do antibiograma. O estudo foi transversal, exploratório, prospectivo com abordagem quantitativa. A
coleta foi realizada com material estéril seguindo os métodos de Koneman et al., (2010). As amostras foram
semeadas em ágar-sangue e incubadas a temperatura de 37ºC em estufa bacteriológica durante 48 horas. As
colônias foram analisadas por meio da coloração Gram e provas bioquímicas da catalase e redutase. O anti-
biograma foi realizado em meio de cultura Mueller Hinton, em que foi impregnado por infusão de disco de
antibióticos (DME®). Os halos do antibiograma foram interpretados segundo a tabela CLSI (Manual Clinical
and laboratory Standards Institute). Os resultados mostraram que 60% das amostras geraram colônias bacte-
rianas sendo todas do gênero Staphylococcus spp, com prevalênciade S. aureus sobre o estafilococo coagulase
negativa(SCN). Nas amostras verificamos que 100% dos Staphylococcus spp foram resistentes a oxacilina.
Dos SCN 75% foram resistentes a quinolonas (levofloxacino, ciprofloxacino e norfloxacino) e a gentamicina,
25% resistentes à tetraciclina e 37,5% resistentes a vancomicina. As colônias S. aureus oxacilina resistente
(ORSA) foram 33% resistentes as quinolonas, 22% a gentamicina e 100% sensíveis à vancomicina e a tetra-
ciclina. Aproximadamente, 50% das bactérias encontradas eram multirresistentes. Podemos assim concluir
que a UTI do HMS se mostrou fonte de bactérias patogênicas e multirresistentes, mostrando a necessidade
de um controle mais eficiente pelos profissionais de saúde, reduzindo de maneira mais agressiva o risco do
desenvolvimento de infecções graves no ambiente hospitalar.

Palavras-chave: UTI,Antibiograma,Resistência

Introdução
A disseminação de infecções relacionadas a assistência à saúde (IRAS) frequentemente advém da
contaminação cruzada, visto que a via mais comum de transferência de patógenos ocorre entre equipe de saúde
e pacientes. Além disso, é comum a contaminação de superfícies inanimadas e equipamentos por patógenos,
muitos deles já com algum grau de resistência antimicrobiana. As infeções hospitalares associadas a micror-
ganismos resistentes aumentaram em todo o mundo. Nos Estados Unidos(EUA), mais de 70% da microbiota
hospitalar é resistente a, pelo menos, um antibiótico (RUTALLA, 2006). Dessa forma, as bactérias têm de-
senvolvido resistência aos antibióticos de uso comum e até às novas terapias, gerando preocupação quanto
à temática resistência bacteriana (Oliveira & Silva, 2008). Ademais, a Unidade de Terapia Intensiva (UTI) é
considerada epicentro de resistência bacteriana, sendo fonte de bactérias multirresistentes, responsáveis por
um grande número de IRAS. Portanto, a análise do ambiente na disseminação de bactérias resistentes visa
contribuir para compreensão das recomendações de controle das IRAS, definição de políticas de controle e
aproximação dos profissionais de saúde com o tema.

75 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

Objetivo
Geral: -Identificar o perfil de resistência antimicrobiana dos estafilococos nas superfícies inertes da
UTI do HSM.
Específicos: -Identificar nas superfícies as espécies de estafilococos. -Testar a efetividade dos antimi-
crobianos indicados para o gênero Staphylococcus spp.

Metodologia
A pesquisa foi realizada na UTI do Hospital Municipal de Santarém (HMS). Foi um estudo trans-
versal, exploratório, prospectivo com abordagem quantitativa. As superfícies e equipamentos utilizados pelos
médicos e enfermeiras e presentes nos leitos da UTI-adulta foram selecionados baseado nos estudos de Da-
masceno (2010). A coleta seguiu os métodos propostos por Koneman et al., (2010). A coleta foi feita sem aviso
prévio, em superfícies visualmente limpas, com swabs estéreis armazenados em tubo com solução salina. A
primeira semeadura foi em meio ágar-sangue e a segunda, após a identificação morfotintorial e bioquímica,
em meio de cultura Mueller-Hinton e incubada a 37°C por 48 horas. Posteriormente, o meio foi impregnado
por difusão em disco de antibióticos. Os dados foram interpretados seguindo a tabela CLSI (Manual Clinical
and laboratory Standards Institute) e tabulados através do programa Excel®. A escolha dos antibióticos seguiu
a sugestão clínica da ANVISA (Agência Nacional de Vigilância Sanitária) para gêneros bacterianos. Assim,
para o gênero estafilococos, foram escolhidos penicilina, oxacilina, vancomicina, tetraciclina, gentamicina,
levofloxacino, ciprofloxacino e norfloxacino. Esse trabalho foi autorizado pelo Comitê de Ética e Pesquisa,
pela Secretaria Municipal de Saúde de Santarém e pela administração do HMS e não necessitou Termo de
Consentimento Livre e Esclarecido.

Resultados e Discussão
Das 17 colônias do gênero Staphylococcus spp., 100% delas foram resistentes aos B-lactâmicos,
53%(9) às quinolonas, 47%(8) à gentamicina, 17%(3) à vancomicina e 11%(2) às tetraciclinas. Aproximada-
mente, 50% das bactérias analisadas foram multirresistentes (resistentes a três ou mais classes de antibióticos).
Esse grau de resistência é preocupante por existir relação direta entre a microbiota do meio, colonização do
paciente e posterior infecção do mesmo, visto que há grande semelhança genética entre as bactérias envolvi-
das nesse processo (Damasceno 2010). Das 17 colônias, 9 eram de S. aureus e, dessas, 100% foram resistentes
à oxacilina e penicilina. Resultado já esperado, uma vez que, dados norte americanos demonstram que, há
décadas, existe prevalência de bactérias ORSA nos hospitais. No Brasil, segundo MOURA et al. (2007), a
principal bactéria causadora de IRAS na UTI é do grupo ORSA, presente em até 80% dos casos. Ademais,
as cepas ORSA aumentam em três vezes o tempo de internação (FREITAS, 2000) e causam óbito em cerca
de 50% dos pacientes com bacteremia intra-hospitalar (MOURA, et al 2007). Vale ressaltar que, conforme o
manual da CLSI, o S. aureus resistente a oxacilina é também a todos os beta-lactâmicos, carbapenêmicos e
cefalosporinas. Além disso, frequentemente, ele pode ser resistente a aminoglicosídeos, macrolídeos, quino-
lonas, e tetraciclinas (Damasceno, 2010). Sobre isso, esse estudo observou resistência de 33% das colônias
ORSA à ciprofloxacino, levofloxacino e norfloxacino. A resistência à gentamicina foi de 22% e esse grupo de
bactérias era multirresistente. Esse resultado foi inferior ao relatado por Moura et al. (2007), em que anali-
sando duas UTI’s, observou um índice de resistência de 43%. Atualmente, a sensibilidade do S. aureus às te-
traciclinas está abaixo de 65% (Goodman&Gilman, 2005). Porém, 100% dos estafilococos ORSA analisados
foram sensíveis à tetraciclina. Todos os ORSA do estudo foram sensíveis à vancomicina, seguindo padrões da
maioria das literaturas. Logo, pela grande sensibilidade e por ser bactericida, a vancomicina é o antibiótico de
primeira escolha para as bactérias em questão. As 8 colônias de estafilococos coagulase negativa(SCN) foram
100% resistentes a penicilina e oxacilina, 75% às quinolonas e a gentamicina, 25% a tetraciclina e 37,5%
resistentes a vancomicina. Esses dados preocupam, pois essas bactérias se relacionam com as principais sín-
dromes infecciosas nosocomiais, ou seja, pneumonias, infecção do trato urinário relacionado à sonda, infecção
da corrente sanguínea relacionada a cateter e infecção do sítio cirúrgico. Segundo o programa SENTRY, os
SCN estão entre as bactérias com maior incidência em hemoculturas, trato respiratório inferior, pele e partes
moles nas Américas. Ainda, a ANVISA categoriza como fator de risco para IRAS a iatrogenia, provenien-

76 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

te de procedimentos invasivos utilizados na UTI, como intubação e uso de cateteres vasculares e urinários
(BRASIL, 2013). Esses procedimentos tem íntima relação com o SCN, visto que, a utilização inadequada de
cateteres é a sua principal via de contaminação (LEVINSON, 2010). De acordo com as diretrizes da CLSI, o
crescimento discernível a olho nu dentro do disco de antibiograma caracteriza uma bactéria como resistente
à vancomicina, como ocorreu em três amostras de SCN nesse estudo, sendo essas bactérias multirresistentes.
Apesar desse dado alarmante, a limpeza da fonte de contaminação com álcool 70% erradicaria esse patógeno
do meio (FERREIRA et al., 2013).

Considerações Finais
Podemos assim concluir que a UTI do HMS se mostrou fonte de bactérias patogênicas e multirre-
sistentes, mostrando a necessidade de um controle mais eficiente pelos profissionais de saúde, reduzindo de
maneira mais agressiva o risco do desenvolvimento de infecções graves no ambiente hospitalar.

Referências
ANVISA. Agência Nacional de Vigilância Sanitária. Assistência Segura: Uma Reflexão Teórica Aplicada
à Prática. Brasília. (2013). Disponível em: https://www20.anvisa.gov.br/segurancadopaciente/imagens/
documentos/livros/livro1-Assistencia_Segura.pdf
DAMASCENO, Q. S. Características epidemiológicas dos micro-organismos resistentes presentes em
reservatórios de uma Unidade de Terapia Intensiva (Dissertação de mestrado) (2010). Recuperado de http://
www.bibliotecadigital.ufmg.br
FERREIRA, A.M. et al. Superfícies Do Ambiente Hospitalar: Um Possível Reservatório De Micro-Organismos
Subestimado? - Revisão Integrativa. Revista de Enfermagem UFPE On Line. Recife, 7(esp):4171-82, maio.,
2013.
KONEMAN, E.W. et al., Diagnóstico Microbiológico, texto e atlas colorido. Rio de Janeiro. Guanabara
Koogan, 2008.
LAURENCE, L.BRUNTON; BRUCE.A.CHABNER; BJORN.C.KNOLLMANN. As bases farmacológicas
da terapêutica de GOODMAN & GILMAN, 10ª edição, 2005.
LEVINSON, W. Microbiologia Médica e Imunologia: 10 ed. Porto Alegre: Editora Artmed, 2010.
MANUAL DE INTERPRETAÇÃO DAS ZONAS DE INIBIÇÃO E CONCENTRAÇÃO INIBITÓRIA
MÍNIMA. DME, edição 2016
MOURA, E.B et al. Infecção hospitalar: estudo de prevalência em um hospital públicp de ensino. Revista
Brasileira de Enfermagem, vol.60, núm.4, julho-agosto, 2007, pp.416-421
OLIVEIRA, A. C.; SILVA, R. S. Desafios do Cuidar em Saúde Frente à Resistência Bacteriana: Uma Revisão.
Revista Eletrônica de Enfermagem, n. 10, v. 1, p. 189-197, 2008.
RUTALLA, A. W.; WHITE, M. S.; GERGEN, M. F.; WEBER, D. J. Bacterial contamination of keyboards:
efficacy and functional impact of disinfectants. Infect. Control. Hosp. Epidemiol., New Jersey, v.27, n.4,
p.372-377, abr. 2006.
SENTRY Latin America Study Group. Results from the SENTRY Antimicrobial Surveillance Program (1997).
Diag Microbiol Infect Dis 1998.

77 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO DE GERMINAÇÃO E DESENVOLVIMENTO INICIAL DE PLÂNTULAS PRO-


GÊNIES DE DIFERENTES MATRIZES DE MOGNO BRASILEIRO (SWIETENIA MACRO-
PHYLLA)

Laura Fernanda De Lima Lobato, Douglas Valente De Oliveira, Bianca Diniz Da Rocha, Jobert Silva Da
Rocha, Danilo Icaro Da Silva Rocha, Willian Aguiar Pinto E Edwin Camacho Palomino
Universidade Federal do Oeste do Pará - UFOPA
laura.fll@hotmail.com

Resumo: Pertencente à família Meliaceae, o Mogno Brasileiro (Swietenia macrophylla King.), espécie nativa
da Amazônia, está entre as espécies sob ameaça de extinção devido sua exploração em larga escala pelo setor
madeireiro. Parâmetros que definem a qualidade das mudas e sua potencialidade para ser instalada em campo
são altura e diâmetro. Neste sentido, o presente trabalho teve como objetivo, avaliar o comportamento inicial
de progênies procedentes de diferentes matrizes da espécie florestalSwietenia macrophylla King., desde a
germinação de sementes até o desenvolvimento inicial de mudas. O experimento foi conduzido no Viveiro ex-
perimento de produção de mudas florestais da Universidade Federal do Oeste do Pará. O estudo foi desenvol-
vido entre os meses de Dezembro de 2017 a Fevereiro de 2018. As análises estatísticas foram feitas através do
programa Assistat 7.7 Beta, e as médias comparadas pelo teste de Tukey a 5% de probabilidade. Os parâmetros
altura/diâmetro apresentados pelas plântulas apresentaram valores estatisticamente iguais. As variáveis mais
vigorosas apresentaram-se nas matrizes 1,3 e 5, que também indicaram valores de germinação diferenciados.
Portanto, as matrizes 1; 3 e 5, que apresentaram maiores porcentagem de germinação, indicaram a mesma
velocidade entre elas para germinação completa. Conclui-se com o presente estudo que as matrizes apresenta-
ram sementes com potencial germinativo semelhantes, indicando porcentagens homogêneas de germinação; a
matriz 4, de todas, apresentou menor porcentagem de germinação (25%) e consequentemente, maior taxa de
mortalidade de sementes (75%); a taxa de mortalidade de sementes superou a taxa de germinação para o lote
de sementes de todas as matrizes avaliadas e as progênies indicaram valores médios dos parâmetros altura e
diâmetro estatisticamente semelhantes.

Palavras-chave: ALTURA,DIÂMETRO,GERMINAÇÃO

Introdução
A qualidade de mudas de espécies florestais tem uma afinidade direta com a qualidade e preparo
do substrato, cuidados na semeadura e durante o cultivo pois disso depende produto final que são as mudas.
Parâmetros que definem a qualidade das mudas e sua potencialidade para ser instalada em campo são altura e
diâmetro (TUCCI, 2007). A germinação por sua vez, representa a o crescimento do eixo embrionário que foi
interrompida na fase de maturação da semente, desenvolvendo-se se até o ponto de formar uma planta com
plenas condições de nutrir-se por si só, tornando-se independente, germinação está associada ao conjunto
de reações responsáveis pelo desenvolvimento de uma estrutura reprodutiva, (KRAMER e KOZLOWSKI,
1972). Pertencente à família Meliaceae, o Mogno Brasileiro (Swietenia macrophylla King.), espécie nativa
da Amazônia, está entre as espécies sob ameaça de extinção devido sua exploração em larga escala pelo setor
madeireiro. Sua distribuição geográfica vai desde a América do Sul até o México. No Pará, é muito encontrado
na parte sul do estado. O mogno brasileiro têm crescido significativamente nos últimos anos em consórcio
com outras espécies devido seu alto valor agregado na madeira em tora (LORENZI, 1998).

Objetivo
O presente trabalho teve como objetivo, avaliar o comportamento inicial de progênies procedentes
de diferentes matrizes da espécie florestal Swietenia macrophylla King., desde a germinação de sementes até
o desenvolvimento inicial de mudas.

78 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

Metodologia
O experimento foi conduzido no Viveiro experimento de produção de mudas florestais da Universi-
dade Federal do Oeste do Pará (2º25’9’’31 S; 54º44’30’’59 O). As sementes utilizadas no estudo foram cole-
tadas de matrizes pertencentes a um plantio florestal misto particular, localizado na Fazenda Emaús, no Mu-
nicípio de Santarém-Pará, situada na margem esquerda da Rodovia Santarém/Curuá-Una, km11 (2º30’49’’00
S; 54º39’35’’98 O). Compreende uma área total de 240 ha, dos quais 122 ha estão divididos em cinco áreas
com plantios florestais, implantados nos anos de 2008 a 2012, ao qual, inclui associação das espécies andiro-
ba (Carapa guianensis), cumarú (Dipterix odorata), nim (Azadirachta indica), e Mogno brasileiro (Swietenia
macrophylla King.), que será o objeto de estudado do presente trabalho. As sementes foram coletadas direta-
mente no chão, durante o período de dispersão da espécie. Após a coleta as sementes foram identificadas de
acordo com sua matriz de origem, que corresponderam a cinco árvores selecionadas. O estudo foi desenvol-
vido entre os meses de Dezembro de 2017 a Fevereiro de 2018, as sementes foram coletadas no início do mês
de Dezembro e o experimento implantado no dia 12 do mesmo mês. Constituiu-se em avaliar a germinação e
o desenvolvimento inicial das progênies de Mogno (Swietenia macrophylla King.) em condições de viveiro,
utilizando-se suas respectivas matrizes como tratamento. As análises iniciaram a partir da instalação do ex-
perimento, avaliando-se, inicialmente, dias de germinação após a semeadura e porcentagem de germinação,
posteriormente, crescimento em altura, diâmetro do colo, taxas de mortalidade das progênies. O acompanha-
mento da germinação foi realizado até a sua estabilização, que correspondeu um período de três semanas (21
dias). Por outro lado, a avaliação do crescimento foi realizado em um intervalo de 7 em 7 dias (uma semana),
iniciando-se após a estabilização da germinação através da medição da altura com régua, até aos 42 dias (6 se-
manas). Para a medição de diâmetro foi necessário a utilização de um paquímetro digital com precisão de 0,01
mm. O delineamento utilizado na montagem do experimento foi o inteiramente casualisado (DIC), utilizando-
-se 5 tratamentos em 4 repetições contendo 7 sementes por parcela totalizando 28 sementes por tratamento. Os
dados de altura e germinação obtidos, foram organizados em planilha eletrônica e os testes de Kolmogorov-S-
mirnbov para normalidade dos dados, Bartlett para homogeneidade das variâncias dos tratamentos e Fischer
para Análise de Variância, foram feitas através do programa Assistat 7.7 Beta, e as médias comparadas pelo
teste de Tukey a 5% de probabilidade.

Resultados e Discussão
Nesse experimento a germinação foi definida como a emissão da plântula e foi acompanhada a partir da se-
meadura, partindo dessas informações percebeu-se que o parâmetro germinação mostrou-se homogêneo aos
tratamentos usados, contudo, a partir da análise da Figura 1, pode-se observar uma melhor performance das
sementes advindas das matrizes 1; 3 e 5, indicando para estas uma relativa aptidão à germinação em relação
as outras. Além disso, vale ressaltar o baixo índice germinativo da matriz 4 em relação as outras, indicando
entre todas o tratamento com menores porcentagem para essa variável. De acordo com a trabalho, os trata-
mentos mostraram-se padronizados em relação a velocidade de germinação, indicando valores próximos em
exigência de dias para germinação, com sementes começando a germinar a partir do 14º dia, resultado idênti-
co ao apresentado por Cruz et al., (2016), envolvendo germinação de sementes da mesma espécies estudada.
Portanto, as matrizes 1; 3 e 5, que apresentaram maiores porcentagem de germinação , indicaram a mesma
velocidade entre elas para germinação completa, rebentando em média ao 16º dia após a semeadura. Cruz et
al., (2016), apresentou resultados de germinação com Mogno (Swietenia macrophylla King), onde a maioria
das sementes apresentaram germinação do 18º ao 21º dia e encerrando no 31º dia, índices semelhantes aos
apresentados no presente estudo, onde todos os tratamentos utilizados expuseram suas germinação completa
entre o 14º ao 21º dia após a semeadura e encerrando germinação já no 21º dia. Entretanto, sabe-se que para
qualquer espécie florestal quanto mais rápido ocorrer a germinação das sementes e a imediata emergência das
plântulas, menos tempo as mesmas ficarão sob condições adversas, passando pelos estádios iniciais de de-
senvolvimento de forma mais acelerada, apresentando-se como uma variável essencial a seleção de plântulas
(MARTINS; NAKAGAWA; BOVI, 1999). De acordo com Munguambe (2013), a altura é um dos principais
parâmetros avaliativos das plantas, pois se pode selecionar e classificar mudas, além de ser uma característica
de fácil medição. Nesse sentido, através dos dados mensurados do parâmetro altura foi possível observar qual
79 JOVEM PESQUISADOR - GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

tratamento (matriz) utilizado apresentou maiores desenvolvimentos das plântulas progênies. Segundo Olivei-
ra et al., (2008), plantas com maior diâmetro apresentam maior sobrevivência, por apresentarem capacidade
de formação e de crescimento de novas raízes, indicando potencial para instalação em campo. Além disso, o
diâmetro do coleto é um parâmetro usado para avaliar desenvolvimento e qualidade de mudas em diferentes
ambientes e encontra-se relacionado diretamente com o crescimento das plantas em altura e acréscimo de
aérea foliar (REGO; POSSAMAI, 2006). Portanto, os parâmetros altura e diâmetro de plântulas são medidas
essenciais para diagnósticos eficientes de teste envolvendo progênies de diferentes matrizes, como o presen-
te trabalho. Dessa forma, os parâmetros altura/diâmetro apresentados pelas plântulas de Mogno brasileiro
(Swietenia macrophylla King.) em viveiro, sob influência genética de cinco matrizes, apresentaram valores
estatisticamente iguais para a variável altura média, assim como para a variável diâmetro do coleto, de acordo
com o teste de médias. No entanto, mesmo estatisticamente não significativas, as variáveis altura e diâmetro
médio apresentaram-se mais vigorosas nas matrizes 1; 3 e 5, que também indicaram valores de germinação
diferenciados. Observando a curva de crescimento em altura total, percebe-se que na primeira semana de me-
dições, a M1 mostrou-se superior às demais matrizes com uma altura média de 7,7 cm, entretanto, a partir da
terceira semana seu crescimento se igualou ao crescimento da M5 devido ao declínio sofrido por M1 na segun-
da semana. A M2 e M4 mostraram um padrão de crescimento semelhante, apesar de os indivíduos da Matriz
2 apresentarem maiores valores em altura. Vale ressaltar que a partir da quarta semana de avaliação, a M2
mostrou um crescimento mais acentuado, com relação às demais matrizes. O crescimento dos indivíduos da
M3 mostrou-se análogo ao crescimento das matrizes 2 e 4, contudo, na quinta semana seu crescimento sofreu
declínio, praticamente se igualando à altura média final da M4, uma vez que M3 mostrou-se superior à M4 du-
rante o intervalo da primeira à quinta semana de avaliação. Observa-se que todas as matrizes obtiveram taxas
de mortalidades superiores à de sobrevivência de sementes, sendo na M4 onde demonstra o maior percentual
de sementes que não germinaram (75%), seguido por M2 (67,86%). As matrizes 3 e 5 demonstraram valores
idênticos para sementes não germinadas: 57,14%. Sendo a M1, a matriz que houve maior índice de germina-
ção. Analisando os valores de sobrevivência foi possível identificar semelhança aos valores relacionado à taxa
de germinação encontrados por Couto (2002), onde o autor relatou que 48% das sementes germinaram após
30 dias no seu estudo com Mogno brasileiro. Portanto, mesmo diante da relativa aptidão das matrizes 1 e 5 em
promover progênies com melhores taxas de crescimento, o teste de médias calculado para os parâmetros altura
e diâmetro mostraram-se não significativo, ou seja não houve diferenças estatísticas no comparativo entre os
tratamentos utilizados no experimento. Dessa forma, estatisticamente o desempenho no crescimento durante a
fase inicial das progênies de Mogno brasileiro são semelhantes, indicando que durante as 6 primeiras semanas
do estágio juvenil da espécie a performance das progênies é parecida.

Considerações Finais
Ao final das avaliações, pôde-se concluir com o presente estudo que: as matrizes apresentaram se-
mentes com potencial germinativo semelhantes, indicando porcentagens homogêneas de germinação; a ma-
triz 4, de todas, apresentou menor porcentagem de germinação (25%) e consequentemente, maior taxa de
mortalidade de sementes (75%); a taxa de mortalidade de sementes superou a taxa de germinação para o lote
de sementes de todas as matrizes avaliadas; as progênies indicaram valores médios dos parâmetros altura e
diâmetro estatisticamente semelhantes e durante a fase inicial do desenvolvimento de mudas das progênies de
5 matrizes utilizadas, os índices mostraram-se análogos.

Referências
COUTO, J. M. F. GERMINAÇÃOE MORFOGÊNESE in vitro DE MOGNO (Swietenia macrophylla King).
Viçosa, 2002.
CRUZ, E. D.; SENA LIMA, A. de; LOPES, C. B. Germinação de sementes de espécies amazônicas:
mogno(Swietenia macrophylla King). Comunicado Técnico, Belém-PA, v 284. Embrapa, 2016.
KRAMER, P.J.; KOZLOWSKI, T. Fisiologia das árvores. Lisboa: Fund. Calouste Gulbenkian, 1972, 745p
LEMOS FILHO, J. P. de; DUARTE, R. J. Germinação e longevidade das sementes de Swietenia macrophylla
King – mogno(Meliaceae). Revista Árvore, Viçosa, v. 25, n. 1, p. 125-130, 2001.

80 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

LORENZI, H. Árvores brasileiras : manual de identificação e cultivo de plantas arbóreas nativas do Brasil. 2.
ed. Nova Odessa:Plantarum, 1998. v. 1, 352 p.
MARTINS, C. C.; NAKAGAWA, J.; BOVI, M. L. Efeito da posição da semente no substrato e no crescimento
inicial das plântulas de palmito vermelho (Euterpe espiritosantensis Fernades – Palmae). Revista Brasileira de
Sementes, Brasília, v. 21, n. 1, p. 164-173, 1999.
MUNGUAMBE, J. F. Qualidade morfológica de mudas clonais de eucalipto na fase de expedição em viveiros
comerciais. 2013. 74 p. Dissertação (Mestrado em Ciência Florestal) - Universidade Federal Lavras - UFL,
Lavras, 2013.
OLIVEIRA, D. P. Crescimento de mudas de Eucalyptus urophilla x Eucalyptus grandis e Corymbia citriodora
em substrato contendocasca de café carbonizado. 2010. 42 p. Monografia (Graduação em Engenharia Florestal)
- Universidade Federal do Espírito Santo - UFES, Jerônimo Monteiro, 2010.
REGO, G. M.; POSSAMAI, E. Efeito do Sombreamento sobre o Teor de rva.htm> Acessado em 21 de mar
de 2018.

81 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AÇÃO ANTIMICROBIANA DO ÓLEO DE CUMARU NAS INFECÇÕES CAUSADAS POR


STAPHYLOCOCCUS AUREUS

Yan Vitor Silva Oliveira, Ana Carolina Pereira Dos Santos, Ana Paula da Silva Cruz, Vanessa Ross De Sou-
sa Teixeira e Keyla Pereira Tiago
Instituto Esperança de Ensino Superior - IESPES
rosyan.2031@gmail.com

Resumo: No Brasil, o conhecimento sobre plantas medicinais é uma das riquezas da cultura indígena, esti-
ma-se que 80% da população utilizam de recursos naturais para suprir as necessidades de assistência médica
primária. O cumarú é uma planta típica da região Amazônica, pertence à família das Leguminosas, entre os
povos nativos é popularmente conhecida como "árvore dos feiticeiros", chegando a medir até 32m de altura.
Desta planta é utilizada a semente, conhecida como fava-de-cumarú, nela está presente o princípio ativo cuma-
rina, que tem como ação farmacológica: antibacteriano, diaforética e antiespasmódica. Devido ao aumento do
uso indiscriminado de antibiótico o número de resistência bacteriana vem aumentado a cada ano, o que tem
levado ao surgimento de bactérias resistentes.A semente é bem reputada como antiespasmódica, diaforética,
tônico cardíaco, antibiótico, antifúngico e alguns a consideram como emenagoga. Também indicado para as
tosses, evitando o uso prolongado. Essas virtudes estão relacionadas com a presença de cumarina. Devido ao
seu aroma intenso as sementes foram utilizadas para perfumar tabaco, chocolate e bebidas, tendo emprego in-
dustrial como sucedâneo da Baunilha. O óleo proveniente de suas sementes ajuda a debelar as úlceras bucais,
alivia as dores de ouvido e serve como tônico para o couro cabeludo. Objetivo do estudo e avaliar a ação anti-
microbiana do óleo de cumaru nas infecções causadas pelas bactérias Staphylococcus aureus. Trata-se de um
estudo quantitativo, descritivo. Para realizar a quantificação bacteriana utilizou-se a escala 0,5 de MacFarland
a semear foi realizada em superfície do Agar Miller Hinton em três dimensões diferentes, em seguido foram
introduzidos um disco de papel de filtro embebidos com 10uL de óleo de Cumaru, em seguida incubar a placa
em 37º C por 24 horas.Os halos de inibição foram mensurados e comparados de acordo com a padronização
dos testes a sensibilidade de antimicrobiano(CLSI). Foram realizados testes onde obtivemos 12 (60%) de
resultados positivos que apresentam halos significativos de ação antimicrobiana, porém necessita-se de mais
testes para melhor resultado.De acordo com os resultados obtidos o óleo de cumaru tem uma excelente ação
antibacteriana em Staphylococcus aureus, no entanto necessita-se de mais testes para validar sua ação.

Palavras-chave: Cumaru, infecção, bactéria

Introdução
As infecções causadas pela bactéria Staphylococcus aureus, pode ser classificada como simples as
mais graves infecções, sendo considerada a mais virulenta do seu gênero. Encontrada na microbiota humana,
sua enorme capacidade de adaptação e resistência à maioria dos antimicrobianos colocou-a atualmente entre
as espécies de maior importância nas infecções nosocomiais. (LIMA, 2015) Os Staphylococcus aureus são
bactérias esféricas, piogênicas por excelência. Gram-positivas e que crescem em forma de cachos de uva (do
grego staphile = cacho de uva). (TORTOGA, 2000) O número de casos que apresentam a resistência bac-
teriana está cada vez maior, considerada um problema de saúde pública mundial, fato para o qual têm sido
propostas diversas iniciativas de controle. Portanto, a contínua emergência de microrganismos resistentes nas
instituições de saúde constitui-se um grande desafio mobilizando órgãos nacionais e internacionais de vigi-
lância e controle epidemiológicos. (OLIVEIRA,2008) Esses são alguns dos problemas importantes da ação
dos Staphylococcus aureus sobre o hospedeiro e que se unem a sua tendência à variabilidade genética com
consequente resistência às drogas antimicrobianas; há de realçar seu papel na patogenia humana, pois repre-
sentam eles, na atualidade, importante problema médico a ser resolvido. (FAGUNDES, 2004) Desta forma,
a estafilococia pode se expressar como estado de colonização das superfícies cutâneo-mucosas (portadores
transitórios ou permanentes) ou como doença aguda ou crônica, supurativa, localizada ou disseminada, benig-

82 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

na, grave ou mesmo fatal, causada pela presença do estafilococo, seja por meio da ação de suas enzimas, ou
à distância, sem a presença do agente, isto é, por meio de suas toxinas. Relaciona-se a condições de higiene
precárias como a fatores debilitantes da imunidade do hospedeiro. (BRESOLIN, 2005) O óleo essencial é o
líquido adquirido de uma planta, através de destilação ou extração química por solventes. Apesar do nome, ele
nem sempre é um fluido gorduroso ou oleoso. Muito utilizado na medicina alternativa como a aromaterapia, o
óleo essencial possui vários benefícios e exerce inúmeros melhoramentos para a saúde que nem precisam mais
ser comprovados. Apesar de serem produtos naturais, os óleos essenciais podem ser agressivos para a pele,
portanto devem ser utilizados com uma grande precaução. O uso dos óleos essenciais é bastante popular nas
áreas farmacêutica, terapêutica e cosmética. A fitoterapia e a aromaterapia devem a sua fama ao uso das subs-
tâncias odorantes. Alguns óleos essenciais são muito conhecidos por suas propriedades medicinais, o óleo de
cravo-da-Índia é um analgésico muito poderoso, bastante utilizado na área dentária, o de lavanda serve como
anti-séptico em aromaterapia e em algumas utilizações médicas, assim como o da árvore-do-chá. O cumarú é
uma planta típica da região Amazônica, pertence à família das Leguminosas, entre os povos nativos é popular-
mente conhecida como "árvore dos feiticeiros", chegando a medir até 32m de altura. Desta planta é utilizada a
semente, conhecida como fava-de-cumarú, nela está presente o princípio ativo cumarina, que tem como ação
farmacológica: antibacteriano, diaforética e antiespasmódica. (BARACUHY, 2014).

Objetivo
Avaliar a resistência ou sensibilidade in vitro do óleo de cumaru frente ás bactérias Staphylococcus
aureus.

Metodologia
Trata-se de um estudo quantitativo, descritivo. Para realizar a quantificação bacteriana utilizou-se a
escala 0,5 de MacFarland. Na primeira etapa foi realizada coleta de amostra de cepas de Staphylococcus au-
reus (newp 0023), para a realização dos ensaios. Após a coleta, as amostras foram divididas em duas alíquotas,
uma utilizada para análise dos parâmetros acima citados e a outra foi armazenada no Laboratório de Análises
Clínicas do Instituto Esperança de Ensino Superior (IESPES) até a conclusão do projeto. Na segunda etapa do
projeto extraiu-se o óleo de cumaru para a análise de sua eficaz no tratamento de infecções pela bactéria citada.
Na terceira etapa, adotou-se um parâmetro de medição a susceptibilidade/resistência da bactéria Staphylococ-
cus aureus. Na quarta etapa, suspendeu-se as colônias de bactérias Staphylococcus aureus (newp 0023) em
solução salina estéril (NaCl 0,85%) até obter uma turvação compatível com o grau 0,5 da escala Mac Farland.
Embebeu-se um swab estéril na suspensão bacteriana, comprimindo-o contra as paredes do tubo para tirando
o excesso da suspensão, e semeou-se em seguida de todas direções na placa (três direções), abrangendo toda a
superfície. Aguardou-se aproximadamente 15 minutos, a superfície do agar secar, em seguido foram introdu-
zidos um disco de papel de filtro embebidos com 10uL de óleo de Cumaru, com um antibiótico comparativo,
Gentamicina, em seguida incubar a placa em 37º C por 24 horas.

Resultados e Discussão
Os halos de inibição foram mensurados e comparados de acordo com a padronização dos testes a
sensibilidade de antimicrobiano (CLSI) de 2018. Foram realizados testes onde obtivemos a ação da atividade
antimicrobiana dos resultados positivos que apresentam halos significativos de ação antibacteriana, em duas
placas de Staphylococcus aureus (newp 0023), foram observados halos de inibição do teste de difusão em
disco que houve ação do óleo de cumaru frete ás bactérias Staphylococcus aureus (newp 0023) de (19,3 e 19,4
mm), sendo que a comparação com o antibiótico Gentamicina, foram observados halos de inibição do teste
de difusão, com valor inferior ao óleo de cumaru (19,0 e 19,1 mm) porém necessita-se de mais testes, como a
concentração inibitória mínima para melhor resultado.

Considerações Finais
De acordo com os resultados obtidos o óleo de cumaru tem uma excelente ação antibacteriana em
Staphylococcus aureus podendo contribuir com o desenvolvimento econômicos para a região paraense e com
o uso incorreto de antibiótico, podendo ser uma alternativa terapêutica, no entanto necessita-se de mais testes
83 JOVEM PESQUISADOR - GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

para validar sua ação.

Referências

BARAGUHY,J.G.V;Plantas medicinais, de uso comum no nordeste do Brasil. Editora da Universidade federal


de Campina Grande. 2º edição revisada, Campo Grande, 2014.
BRESOLIN, B. M. Z, STELLA, J. K; Pesquisa sobre a bactéria Staphylococcus aureus na mucosa nasal e
mãos de manipuladores de alimentos em Curitiba/Paraná/Brasil, Estud. Biolog., v.27, n.59, abr./jun. 2005.
FAGUNDES, H., OLIVEIRA, C.A.F; Infecções intramamárias causadas por Staphylococcus aureus e suas
implicações em saúde pública. Ciência Rural, Santa Maria, v.34, n.4, p.1315-1320, jul-ago, 2004.
LIMA, M. F. P; Staphylococcus aureus e as infecções hospitalares – revisão de literatura. Revista UNINGÁ,
Vol.21, n.1, pp.32-39 (Jan - Mar 2015)
TORTOGA, GJ, Funke BR, Case CL. Microbiologia. 6. ed. Porto Alegre: ArTmed; 2000.

84 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

SAÚDE PÚBLICA E ACESSO AOS SERVIÇOS DE SAÚDE: PERCEPÇÕES E VIVÊNCIAS


DOS MORADORES DE UMA COMUNIDADE RIBEIRINHA NO INTERIOR DA AMAZÔNIA

Marlyara Vanessa Sampaio Marinho, Débora Nascimento Quaresma, Nayara Tallita Moreno Rodrigues,
Jackson Celso Pereira Pires e John Henry de Oliveira Vale
Universidade do Estado do Pará - UEPA
marlyaravsmarinho@gmail.com

Resumo: A região Amazônia possui povos em diferentes regiões que necessitam serem englobadas de fato no
acesso a saúde de qualidade. Objetivo: Analisar as percepções dos moradores da comunidade de Arapixuna
acerca da saúde pública e do acesso aos serviços de saúde. Metodologia: Pesquisa de abordagem qualitativa,
realizada na comunidade de Arapixuna em Santarém-Pará com 15 voluntários, sendo estes usuários do Siste-
ma Único de Saúde – SUS e residentes há mais de 02 anos nessa região. Os participantes foram divididos em
02 grupos focais, sendo o primeiro com 05 adultos (de 18 a 59 anos) e o segundo com 10 idosos. Foi reali-
zada a entrevista semiestruturada e posteriormente, ocorreu a transcrição na íntegra das falas para realizar de
acordo com as temáticas abordadas a análise de conteúdo. Este estudo teve aprovação do Comitê de Ética em
Pesquisa da Universidade do Estado do Pará. Resultados e Discussão: De acordo com os relatos dos morado-
res da comunidade sobre o SUS, percebeu-se que estes não possuem conhecimentos voltados para a criação e
princípios do sistema, bem como, para os direitos dos usuários. Concomitante a isso, as dificuldades elencadas
por eles estão associadas à falta de humanização e demora nos atendimentos, assim como na insuficiência de
profissionais e na elevada demanda de pacientes. Considerações Finais: A necessidade de políticas públicas e
programas focados na atenção aos ribeirinhos são evidentes quando a temática envolve a saúde dessa popu-
lação.

Palavras-chave: Sistema Único de Saúde,Programa Institucional de Bolsas de Iniciação Científica,FAPES-


PA,UEPA.

Introdução
A região Amazônica possui uma diversidade ambiental, social e cultural, ímpar. Todos os povos re-
sidentes nessa área, como indígenas, quilombolas, caboclos e imigrantes de outros países, necessitam de uma
atenção diferenciada e focada (CONFALONIERI, 2005). Em Santarém-Pará, existem cerca de 234 regiões
ribeirinhas, que se localizam em territórios de várzea e de planalto. Por mais que haja pesquisas de cunho
científico realizadas como tentativa de entender a dinâmica de vida desses povos, pouco ainda se sabe sobre
a real condição de saúde dos ribeirinhos de cada comunidade. A carência em políticas públicas que envolvam
essa população ainda é insuficiente considerando-se as suas particularidades (BRASIL, 2013). Para Nogueira
(2010), as políticas de saúde para as populações rurais como os ribeirinhos e caboclos ainda são pouco traba-
lhadas. Por mais que a saúde pública seja predominantemente mais urbana, outros povos como os indígenas,
possuem uma assistência específica, sendo esta um subsistema associado ao SUS, com equipe própria ou que
se desloca para realizar as atividades de prevenção e proteção. De acordo com Viacava (2007), o insuficiente
acesso aos serviços de saúde perpassa por largas dificuldades encontradas por esses povos, visto que estes
muitas vezes não possuem condições financeiras para se locomoverem e se abrigarem na cidade. Porém, o
nível de satisfação de uma população em relação aos serviços de saúde vão além da assistência e facilidade de
acesso, visto que fatores psicoculturais também são preponderantes para se deliberar opiniões (PIOSEVAN,
1995). Com isso, a pesquisa realizada é de importante relevância por ser pioneira em relação a essa temática
na comunidade Arapixuna, além de contribuir com o papel das universidades, que é ser participante principal
nos estudos sobre práticas, vivências, experiências, percepções e sensações de comunidade ribeirinhas.

85 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

Objetivo
Analisar as percepções dos moradores da comunidade de Arapixuna acerca da saúde pública e do
acesso aos serviços de saúde.

Metodologia
Foi utilizada a metodologia qualitativa, que de acordo com Minayo (2007), ancora-se na realidade
social do problema estudado, frente as preocupações, dinâmica e desenvolvimento de determinado grupo.
Realizou-se a coleta de dados na comunidade ribeirinha Arapixuna, situada no Canal do Jari, esta possuidora
de águas do rio Amazonas lançadas de encontro às águas do rio Tapajós. Esta região compõe juntamente com
outras 14 comunidades a região do Arapixuna, possuindo cerca de 170 famílias. Os participantes da pesquisa
foram os moradores da Comunidade Arapixuna, estes usuários do SUS. Foram escolhidos para participarem
da pesquisa moradores que tivessem informações úteis a respeito do problema de estudo, maiores de 18
anos, usuários do Sistema Único de Saúde (SUS) e aceitassem participar do estudo, lendo e posteriormente
assinando o Termo de Consentimento Livre e Esclarecido (TCLE). Assim, para coletar-se os dados foi-se
utilizado de dois grupos focais, nos quais um era o grupo jovem (composto por 05 adultos que trabalhassem
na comunidade, identificados de I1 a I5) e o grupo da melhor idade (composto por 10 idosos participantes
dos grupões de idosos da comunidade, identificados de I1 a I10). A seleção de participantes foi realizada pela
presidente da comunidade. Compareceram aos grupos focais um total de 15 pessoas. Posteriormente à coleta
de dados, realizou-se a transcrição do conteúdo das entrevistas e em seguida ocorreu à análise. Foi levado em
conta às palavras e seus significados mencionados, assim como foi verificado em qual contexto as ideias e a
frequência delas haviam sido aplicadas juntamente a extensão e uniformização das explanações e especifici-
dade das respostas. Essa análise ocorreu de acordo com a técnica de Bardin (2006), sendo organizada em três
fases: 1) pré-análise, 2) exploração do material e 3) tratamento dos resultados, inferência e interpretação. As
ponderações foram separadas em eixos e subeixos temáticos em conformidade com o que propunha o roteiro
semiestruturado, destacando-se nas unidades de registros (UR’s), sendo cada participante possuidor de uma
UR’s, constituindo essa a sua identificação. Todos os participantes da pesquisa foram codificados com objetivo
de que fosse assegurado o anonimato. Os aspectos éticos foram respeitados na pesquisa conforme a Resolução
466/12 do Ministério da Saúde, estando também aprovada pelo Comitê de Ética em Pesquisa da Universidade
do Estado do Pará (Nº 1.976.727). Os participantes foram certificados sobre objetivos, riscos e benefícios e
logo após assinaram o TCLE.

Resultados e Discussão
Por meio do estudo, verificou-se na temática “Conhecimento sobre a criação do SUS, princípios dou-
trinários e organizacionais e direitos dos usuários”, que os moradores e profissionais da saúde partícipes do
SUS, não sabiam falar sobre a criação e princípios e diretrizes do sistema. Enquanto que no eixo “Eficiência
e resolutividade do sistema”, constatou-se que o usuário possui um olhar muito negativo no atendimento aos
serviços, relacionados às filas, demora no atendimento, referências e contra referências, visto que para eles, o
ser humano não é assistido como um todo, em suas particularidades e totalidades. Alguns moradores referiram
utilizar do atendimento particular na cidade de Santarém por não conseguirem vaga a curto prazo pelo SUS,
ao mesmo tempo que outras expressaram não terem condições financeiras para serem atendidas no particular e
não possuírem moradia na cidade, tendo que se alojar em barcos durante a permanência em Santarém. A baixa
resolutividade do sistema foi um ponto ressaltado pelos dois grupos. De acordo com os moradores ribeirinhos,
os fatores que deixam o sistema precário é a elevada demanda de pacientes para o número reduzido de profis-
sionais, bem como a superlotação dos hospitais, não havendo a distribuição para outros níveis de atendimento
de acordo com as suas necessidades. Para eles, muitas doenças dispostas na sociedade, seriam solucionadas
apenas com prevenção. Concomitante a isso, a importância da equipe multiprofissional, atrelada a relevância
de cada profissional nos cuidados da saúde individuais nos atendimentos, foram outros pontos falados por eles.

Considerações Finais
Por meio desta pesquisa verificou-se que se faz necessária a inserção de políticas públicas voltadas
para moradores de comunidades ribeirinhas, haja vista, que estes possuem particularidades próprias da região.
86 JOVEM PESQUISADOR - GRADUAÇÃO
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A precariedade de equidade de fato presente para o camponês ainda é um desafio para o sistema de saúde
pública. Atrelar saúde, dificuldades de acesso e o acesso ao atendimento público com resolutividade, ainda é
um grande desafio.

Referências
BARDIN, L. Análise de conteúdo (L. de A. Rego & A. Pinheiro, Trads). Lisboa: Edições 70. 2006 (Obra
original publicada em 1977).
BRASIL. Ministério da Saúde. Secretaria de Gestão Estratégica e Participativa. Departamento de Apoio
à Gestão Participativa. Política Nacional de Saúde Integral das Populações do Campo e da Floresta ed.;1.
Reimp. Brasília: Editora do Ministério da Saúde, 2013.
CONFALONIERE, U.E.C. Saúde na Amazônia: um modelo conceitual para análise de paisagens e doenças.
Estudos avançados 19 (53), 2005 p. 221-236.
MINAYO, M.C.S. O desafio do conhecimento: Pesquisa qualitativa em saúde. 10. ed. São Paulo: HUCITEC,
2007. 406 p.
NOGUEIRA, A.C.F. A comunidade do Pau Rosa/Amazonas e a relação entre Natureza, Cultura e o Processo
Saúde/Doença. Rev. Saúde Soc. São Paulo, v.19, n.1, p.22-34, 2010.
PIOSEVAN, A.; TEMPORINI, E.R. Pesquisa exploratória: procedimento metodológico para o estudo de
fatores humanos no campo de saúde pública. Revista de Saúde Pública. Vol.29, nº4, São Paulo – agosto/1995.
VIACAVA, F. Acesso e uso de serviços de saúde em idosos residentes em áreas rurais, Brasil, 1998 e 2003.
Cadernos de Saúde Pública, Rio de Janeiro, v.23, n.10, p.2490-2502, 2007.

87 JOVEM PESQUISADOR - GRADUAÇÃO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

DETECÇÃO DE PARTÍCULAS SÓLIDAS EM ÁGUA UTILIZANDO SENSORES DE LUZ IN-


TEGRADOS À PLATAFORMA ARDUINO

Caio Vinícius Maia da Silva, Victória Sousa de Sena , Ana Flávia Silva Castro, Luan Moraes Ferreira, Vic-
tor Palhão Picanço, Maria Luísa Castro Barros, Sâmya Maria Brito Carneiro e Marialina Corrêa Sobrinho
voxstm2@gmail.com
Colégio Dom Amando - CDA

Este trabalho, realizado pelo Grupo de Estudos de Robótica e Automação do Colégio Dom Amando (GERA-
-CDA) apresenta o funcionamento de um detector de partículas em água utilizando sensores de luz integrados
com a plataforma Arduino. Hoje, a robótica, programação e automação de processos constituem-se como
ferramentas relevantes na facilitação de tarefas e otimização de processos. O GERA-CDA, equipe composta
por doze alunos da terceira série do Ensino Médio do Colégio Dom Amando idealizou um equipamento capaz
de detectar e rastrear partículas sólidas dispersas na superfície da água em um recipiente fechado, o qual pode
ser aplicado para programar limpeza de reservatórios sem a necessidade de abri-los para verificar visualmente
seu estado. O projeto foi planejado e executado entre janeiro e março de 2018, e funciona utilizando a interfe-
rência na luz detectada por sensores de luz posicionados no fundo do reservatório. Tais sensores são ligados a
uma placa Arduino Genuino Uno, que, ao receber o sinal de que o valor da luz detectada por um dos sensores
é menor do que um valor “x” predeterminado, acende um LED correspondente àquele sensor, possibilitando,
assim, além da detecção, a localização das partículas dispersas na água. É importante que, para evitar inter-
ferências e ruídos no sensoriamento, a luz incida perpendicularmente sobre os sensores e que seja capaz de
iluminá-los de forma homogênea. Para reduzir o consumo de energia elétrica, o sistema pode ser programado
para executar um número determinado de varreduras no dia, permanecendo desligado pelo período de tempo
desejado pelo usuário. Portanto, após repetidos testes do sistema, o GERA-CDA conclui que se trata de uma
ferramenta funcional e que, com as devidas adaptações às necessidades e características de cada ambiente,
pode ser utilizado com confiança e segurança.
Palavras-chave: Computação,Arduino,Sensores de luz,Programação,Detecção de partículas,Óptica,Senso-
riamento

88 JOVEM PESQUISADOR - ENSINO MÉDIO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PRODUÇÃO DE MASSA DE FORRAGEM DO PANICUM MAXIMUM CV. BRS ZURI SOB


DOSES CRESCENTES DE NITROGÊNIO EM SOLO AMAZÔNICO

Mailana Almeida de Souza, Carlos Mikael Mikael, Rogério Rangel Rodrigues, Luciano de Sousa Chaves,
Adriano Araújo da Silva, Carlos Eduardo Pedroso de Sousa, Jackson Marinho Sarmento e Clécio Henrique
Limeira
almeida.ifpa@hotmail.com
Instituto Federal de Educação, Ciência e Tecnologia do Pará - IFPA

A disponibilidade de nutrientes no solo é crucial para a produção de forragem. A maioria dos solos brasileiros
apresenta deficiência em algum nutriente essencial, necessitando de adubação periódica. Desta forma, objeti-
vou-se avaliar a produção de massa seca de forragem (MSF) do Panicum maximum cv. BRS Zuri sob doses
crescentes de nitrogênio no solo. O experimento foi realizado em casa de vegetação no setor de agropecuária
do Instituto Federal de Educação, Ciência e Tecnologia do Pará, Campus Santarém. Utilizou-se o delinea-
mento experimental inteiramente casualizado, com quatro tratamentos e quatro repetições (vasos). Os trata-
mentos foram constituídos por doses crescentes de nitrogênio (Ureia – 45% de N), sendo: 0, 50, 100 e 150%
da recomendação mínima para a cultura (50 kg ha-1), equivalente as doses de 0, 25, 50 e 100 kg ha-1. O solo
utilizado foi um latossolo amarelo, predominante na região, extraído da camada de 20 cm. Este foi distribuído
em vasos, com capacidade de 2,5 dm³, que foram saturados com água e deixados drenar por 24 h. Após este
período, anotou-se o peso dos vasos, equivalendo ao peso do solo na capacidade de campo. Assim, as irriga-
ções foram feitas com base na reposição (até o peso inicial) da água evapotranspirada diariamente, utilizando
balança eletrônica. Após semeadura, as plantas cresceram por 45 dias, ocasião em que foi realizado o corte
de uniformização a 25 cm de altura, simulando a altura ideal de saída por animais em pastejo, dando início ao
experimento. Após 28 dias de experimento, a variável avaliada foi produção de MSF. As plantas foram corta-
das a 25 cm de altura, ensacadas, pesadas em balança analítica e colocadas em estufa de secagem à 65ºC por
72 horas. Os dados foram submetidos à análise de variância e teste de média. De acordo com os resultados,
observou-se diferença significativa (P<0,05) entre os tratamentos avaliados. Sendo que o tratamento de 150%
da recomendação (equivalente a 100 kg ha-1 de N) foi superior aos demais, apresentando produção média de
16,02 g de MSF por perfilho analisado. Não houve diferença estatística entre os tratamentos de 50 e 100%
(equivalentes a 25 e 50 kg ha-1de N), apresentando média produção de 11,13 e 13,32 g, respectivamente. No
entanto, estes foram superiores ao tratamento de 0% da dose recomendada, tendo produção média de 7,15 g
de MSF. A adubação nitrogenada de até 150% da recomendação mínima proporciona resultados positivos na
elevação da produção de MSF da cultivar

Palavras-chave: forrageira,adubação,ureia.

89 JOVEM PESQUISADOR - ENSINO MÉDIO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

TAXA DE ALONGAMENTO DO PSEUDOCOLMO DO PANICUM MAXIMUM CV. BRS


ZURI SOB DOSES CRESCENTES DE NITROGÊNIO EM SOLO AMAZÔNICO

Jackson Marinho Sarmento, Carlos Mikael Mikael, Rogério Rangel Rodrigues, Luciano de Sousa Chaves,
Adriano Araújo da Silva, Carlos Eduardo Pedroso de Sousa, Mailana Almeida de Souza e Clécio Henrique
Limeira
jmarinho.sarmento@gmail.com
Instituto Federal de Educação, Ciência e Tecnologia do Pará - IFPA

Existem diversos fatores que exercem grande influência nos padrões de resposta do gênero Panicum ao nível
de intensificação dos sistemas de produção em que são inseridas, especialmente quanto a doses de fertilizan-
tes. Desta forma, objetivou-se avaliar a taxa de alongamento do pseudocolmo (TALC) do Panicum maximum
cv. BRS Zuri sob doses de nitrogênio no solo. O experimento foi realizado em casa de vegetação no setor de
agropecuária do Instituto Federal de Educação, Ciência e Tecnologia do Pará, Campus Santarém. Utilizou-se
odelineamento experimental inteiramente casualizado, com quatro tratamentos e quatro repetições (vasos).
Os tratamentos foram constituídos por doses crescentes de nitrogênio (Ureia – 45% de N), sendo: 0, 50, 100
e 150% da recomendação mínima para a cultura (50 kg ha-1), equivalente as doses de 0, 25, 50 e 100kg ha-
1. O solo utilizado foi um latossolo amarelo, predominante na região, extraído da camada de 20 cm. Este foi
distribuído emvasos,com capacidade de 2,5 dm³, que foram saturados com água e deixados drenar por 24 h.
Após este período, anotou-se o peso dos vasos, equivalendo ao peso do solo na capacidade de campo. Assim,
as irrigações foram feitas com base na reposição (até o peso inicial) da água evapotranspirada diariamente,
utilizando balança eletrônica.Após semeadura, as plantas cresceram por 45 dias, ocasião em que foi realizado
o corte de uniformização a 25 cm de altura, simulando a altura ideal de saída por animais em pastejo, dando
início ao experimento. Após 28 dias de experimento, a variável avaliada foia TALC. A altura do pseudocolmo
foi mensurada a cada três dias com auxílio de régua graduada. O TALC é o quociente da diferença entre o
comprimento final e inicial do pseudocolmo durante o período de avaliação e a duração do período de avalia-
ção em dias. Os dados foram submetidos à análise de variância e teste de média. De acordo com os resultados,
observou-se diferença significativa (P<0,01) entre os tratamentos avaliados. A maior TALC foi encontrada
no tratamento de 150% da recomendação (equivalente a100 kg ha-1 de N), apresentando média de 0,42 cm/
perfilho/dia, diferindo estatisticamente dos demais. O tratamento de 100% obteve média de TALC de 0,27
cm/perfilho/dia. E os tratamentos de 0 e 50% apresentaram as menores médias (0,06 e 0,04 cm/perfilho/dia,
respectivamente), não diferindo entre si. Conclui-se que a adubação nitrogenada de 150% da recomendação
mínima proporcionou resultados positivos na elevação da TALC média da cultivar avaliada.
Palavras-chave: perfilho,adubação,ureia.

90 JOVEM PESQUISADOR - ENSINO MÉDIO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

CARACTERIZAÇÃO CITOGENÉTICA DE HYPOSTOMUS GR. PLECOSTOMUS (SILURI-


FORMES:LORICARIIDAE) DA REGIÃO DE CONFLUÊNCIA ENTRE OS RIOS TAPAJÓS E
AMAZONAS, SANTARÉM-PA

Mylene Aquino Elias, Luan Aércio Melo Maciel, Mendelsohn Fujiie Souza, Albino Luciano Portela de Sousa
e Luis Reginaldo Ribeiro Rodrigues
luanaercio@hotmail.com
Onesima Pereira de Barros - EEEFMOPB1, Universidade Federal do Oeste do Pará - , UFOPA2, Universi-
dade Federal do Oeste do Pará - , UFOPA3, Instituto Esperança de Ensino Superior - , IESPES4 e Universi-
dade Federal do Oeste do Pará - UFOPA5

O gênero Hypostomus Lacépèd, 1803 (Siluriformes, Loricariidae) é constituído com cerca de 130 espécies
nominais, no qual fazem parte peixes conhecidos popularmente como acaris ou cascudos, estes apresentam
ampla distribuição em toda região neotropical da América do Sul. Hypostomus caracterizam-se por apresen-
tarem diferenças genéticas em seu genoma, com arranjos cariotípicos variando de 2n=64 cromossomos em
Hypostomus aff. cochliodon e 2n=84 em Hypostomus sp. evidenciando padrão não conservativo de evolução
dos cariótipos. Objetivou-se descrever o padrão cariotípico de Hypostomus gr. plecostomus. provenientes da
região de confluência entre os rios Tapajós e Amazonas, em Santarém-PA. Foram analisados dois exempla-
res de H. gr. plecostomus (VRP-14♀ e VRP-15♂) coletados na área do Porto da Companhia Docas do Pará
(CDP), rio Tapajós, Santarém-PA. Células em divisão foram colhidas a partir do tecido renal (rim cefálico)
conforme o proposto por Gold et al. (1990). O cariótipo foi caracterizado utilizando-se técnicas de coloração
convencional por Giemsa, bandeamento C e marcações de Regiões Organizadoras de Nucléolos (RONs) com
nitrato de prata. Estabeleceu-se o número diplóide dos espécimes após a contagem de 25 metáfases em cada
indivíduo, e edição dos cariótipos feitos com auxílio do programa Adobe Photoshop CS6. Os resultados apon-
taram em H. gr. plecostomus número diplóide 2n=68 cromossomos, com a fórmula cariotípica consistindo
em 13m+10sm+45st/a e número fundamental (NF) = 107. No cariótipo do macho observou-se a presença de
um par cromossômico heteromórfico formado por um metacêntrico grande e um acrocêntrico, enquanto que,
na fêmea também ocorreu um par heteromófico, entretanto neste caso o metacêntrico é pequeno. Blocos he-
terocromáticos foram observados na região centromérica do segundo par metacêntrico e regiões teloméricas
de quatro pares acrocêntricos, e em todo braço curto do cromossomo metacêntrico heteromórfico no macho.
As NORs foram localizadas na região telomérica de um par submetacêntrico, e um par subtelocêntrico.
Portanto, H. gr. plecostomus da região do baixo Tapajósapresenta número diploide 2n=68 cromossomos, e
possivelmente estes espécimes exibem sistema de cromossomos sexuais do tipo XY. Estudos adicionais são
requeridos para o melhor esclarecimento das características cariotípicas desta espécie.

Palavras-chave: Citogenetica,cromossomos,hypostomus,loricariidae

91 JOVEM PESQUISADOR - ENSINO MÉDIO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PERCEPÇÃO SOBRE A CONTAMINAÇÃO POR AGROTOXICOS DO AMBIENTE E DO


LEITE MATERNO DE MÃES LACTANTES RESIDENTES EM DEZ COMUNIDADES NO
ENTORNO DE ÁREAS DE PRODUÇÃO AGRÍCOLA DO MUNICÍPIO DE BELTERRA,
PARA

Carla Beatriz dos Santos Torres, Isabella Clarissa Vasconcelos Rêgo, Paulo Sergio Taube Junior, Greice
Nara Viana dos Santos, Joseph Simões Ribeiro, Silvia Caroline de Sousa Aguiar, Jociléia da Silva Bezerra e
Soraia Baia dos Santos
luanaercio@hotmail.com
Universidade Federal do Oeste do Pará - UFOPA1, Escola Estadual Rodrigues dos Santos - , EERS2, Uni-
versidade Federal do Oeste do Pará - , UFOPA3, Universidade Federal do Oeste do Pará - , UFOPA4, Uni-
versidade do Estado do Amazonas - , UEA5

As aplicações de agrotóxicos nas monoculturas, feitas por aviões, tratores agrícolas ou equipamento manual,
podem contaminar alimentos, água, ar, leite materno e sangue dos trabalhadores e população do entorno. A
exposição humana, ambiental, ocupacional e alimentar aos agrotóxicos pode provocar vários agravos à saúde
(PIGNATI, MACHADO & CABRAL, 2014; BRASIL,2010). O objetivo do estudo foi verificar a percepção
sobre a contaminação por agrotóxicos do ambiente e do leite materno de mães lactantes residentes em dez
comunidades do entorno de áreas de produção agrícola no município de Belterra, Pará. Quanto a metodolo-
gia 23 questionários semi-estruturados foram aplicados na residência das lactantes das comunidades de São
Francisco, São José, São Raimundo do Mojú, Trevo de Belterra, São Pedro, Nova aliança, Portão de Belterra,
São Francisco da Volta Grande, Ramal do limão e Ramal da onça. Está pesquisa está vinvculada a um projeto
de mestrado da Universidade Federal Oeste do Pará aprovado pelo comitê de ética. Os dados foram analisa-
dos através de estatística descritiva com elaboração de frequência absoluta e relativa. Quanto aos resultados
todas as lactantes 100% (23) afirmaram que sabiam que são utilizados próximo de suas casas agrotóxicos nas
plantações de soja, arroz e milho. Devido elas sentirem o odor do produto quando pulverizado, e também por
já terem presenciado o processo de pulverização em outro momento. A maioria 87% (20) acreditam que o am-
biente, alimentos e a água podem ser contaminado por agrotóxicos, pois se espalham através do ar e da chuva,
podendo contaminar diversas matrizes. Também afirmaram que por morarem próximo a lavoura a uma maior
possibilidade de contaminação pelos agrotóxicos. Apenas 13% (3) acreditam que os agrotóxicos não são
capazes de contaminar o ambiente, alimentos e água, devido uma maior distância da plantação para sua casa.
A maioria 70% (16) acreditam que os agrotóxicos podem contaminar o leite materno e prejudicar a saúde da
criança amamentada, no entanto 30% (7) acreditam que não, pois afirmaram que os agrotóxicos não possuem
capacidade de contaminar o leite e nem causar problemas de saúde a criança. Essas mães lactantes são conhe-
cedoras da possibilidade de contaminação por agrotóxico do ambiente e do leite materno. Ficando evidente a
necessidade do planejamento de ações mitigadoras e gerenciamento de riscos dos agrotóxicos para que haja a
construção de políticas educativas que priorizem a comunicação de risco para à prevenção de agravos a saúde
dessas mães, suas crianças e o restante da população exposta aos agrotóxicos.
Palavras-chave: Percepção, Percepçãocontaminação, agrotóxicos.,Percepção, contaminação, agrotóxicos.

92 JOVEM PESQUISADOR - ENSINO MÉDIO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PROJETO AQUAPONIA: INTEGRAÇÃO SUSTENTÁVEL DA PRODUÇÃO AGROPECUÁ-


RIA COMO MEIO EDUCATIVO

Ana Júlia da Silva Corrêa, Carlos Mikael Mikael, Maria Vera Lúcia Ferreira de Araújo, Rogério Rangel
Rodrigues, Roger Franzoni Pozzer, Clécio Henrique Limeira, Adriano Araújo da Silva e Elton Nunes Britto
anajuliasc002@gmail.com
Instituto Federal de Educação, Ciência e Tecnologia do Pará - IFPA

A aquaponia é uma modalidade de cultivo de alimentos que envolve a integração entre a aquicultura e a hidro-
ponia em sistemas de recirculação de água e nutrientes. Esse sistema apresenta-se como alternativa real para
a produção de alimentos de maneira menos impactante ao meio ambiente, por suas características de susten-
tabilidade. Nesse sentido, objetivou-se através da implantação de uma unidade demonstrativa de Aquaponia,
no Instituto Federal de Educação, Ciência e Tecnologia do Pará (IFPA), campus Santarém, capacitar alunos,
técnicos e produtores da região do baixo amazonas à utilização de métodos de produção sustentável. Após
a implantação do sistema, que ocorreu no ano de 2017, iniciou-se os processos de difusão da tecnologia no
município de Santarém. Esse processo deu-se através de entrevistas à imprensa local e por meio de exposi-
ções e palestras ministradas em eventos técnicos e científicos de importância regional. O projeto atendeu as
demandas educacionais, servido como fonte para o desenvolvimento técnico-científico de alunos de diferentes
cursos do IFPA, sobremaneira aos cursos técnicos em Agropecuária e Aquicultura, e de outras instituições de
ensino, seja fundamental, médio ou superior, vinculando atividades práticas do cotidiano a seus conhecimen-
tos teóricos, auxiliando o ensino nas áreas de biologia, química, matemática, física, meio ambiente e susten-
tabilidade, além de áreas técnicas de cada curso. Em visitas técnicas à unidade demonstrativa, os discentes
receberam orientações sobre os manejos adequados de qualidade da água ao sistema aquapônico, manejo dos
peixes e das hortaliças, bem como a importância da produção sustentável de alimentos por meio da integração
das atividades produtivas. O projeto atendeu aproximadamente 500 pessoas, diretamente com a disseminação
e aprimoramento técnico do sistema de produção integrada, contribuindo para a difusão e reprodução dessa
tecnologia na região do baixo amazonas. O mesmo também atendeu as demandas de estágio profissional su-
pervisionado de treze estudantes do curso de Agropecuária do IFPA, da implantação do sistema até o presente
momento. Percebe-se com o relato, que o Projeto “Aquaponia” abrange um pacote tecnológico que vai ao
encontro da perspectiva de sustentabilidade, contribuindo com o desenvolvimento educacional de estudantes
e cidadãos para o uso de modelos de produção mais sustentáveis, mesmo em ambientes urbanos, colaborando
para a melhoria da qualidade de vida da população local. Mesmo diante das limitações financeiras e operacio-
nais, o projeto obteve êxito em suas ações, atendendo e capacitando diversos entes da comunidade local, que
servirão como difusores da tecnologia.
Palavras-chave: água, peixe, hortaliça.

93 JOVEM PESQUISADOR - ENSINO MÉDIO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO DO PESO DE CAMUNDONGOS (MUS MUSCULUS) UTILIZADOS EM UM


TESTE DE TOXICIDADE AGUDA

Leonardo Vasconcelos Cativo, Milena de Sousa Vasconcelos, Soraia Baia dos Santos, Victor Hugo Rabelo
de Aquino e Maxwell Barbosa de Santana
leonardo.cativo14@gmail.com
Colégio Santa Clara - CSC1, Universidade Federal do Oeste do Pará - , UFOPA2, Universidade Federal do
Oeste do Pará - , UFOPA3, Universidade Federal do Oeste do Pará - , UFOPA4 e Universidade Federal do
Oeste do Pará - UFOPA5

Testes de toxicidades são amplamente utilizados para avaliar possíveis efeitos tóxicos de fármacos que possam
ser utilizados em testes farmacológicos. Um dos aspectos avaliados é o peso dos animais. Muitas substâncias
são avaliadas em testes de toxicidade, como óleos essenciais. Este trabalho tem como objetivo avaliar o peso
corpóreo de animais diariamente, durante um teste de toxicidade aguda do Óleo Essencial da Piper Margina-
tum, realizado no Laboratório de Laboratório de Química Aplicada a Toxicologia, Saneamento Ambiental e
Recursos Hídricos da Universidade Federal do Oeste do Pará. Para tanto, foram utilizados 12 camundongos,
albinos, da linhagem Swiss, pesando entre 32-36g. Antes do início do teste, os animais passaram por uma tria-
gem de peso, onde estes foram pesados individualmente e separados por peso homogêneos, em 4 grupos de 3
animais cada, conforme a dose única de óleo a ser aplicada oralmente. Posteriormente, os animais tiveram o
seu peso avaliado todos os dias duranteos 14 dias de teste, sempre na mesma hora em que foi feita a adminis-
tração do óleo no 1° dia, e antes de receberem a dose diária de ração também pesada. Ao final, obteve-se as
respectivas médias de peso inicial e final: Grupo (1) 35±1g -39,7 ±5g; Grupo (2) 32±1g - 36,7±1.52g; Grupo
(3) 33±1g -36,7g ±1.52g; Grupo (4) 32g ±1g - 32 ±0,57g. Com este trabalho, foi possível perceber a impor-
tância dos conhecimentos científicos para as pesquisas experimentais com animais em laboratório, bem como
para o desenvolvimento destas, pois, durante as atividades desempenhadas foram seguidos protocolos de ex-
perimentos já padronizados tanto para o uso do animal modelo utilizado quanto para o teste que foi aplicado.

Palavras-chave: experimentação animal,toxicidade aguda,óleo essencial

94 JOVEM PESQUISADOR - ENSINO MÉDIO


I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

EXTENSÃO UNIVERSITÁRIA: PREVENÇÃO DE DOENÇAS RENAIS EM ALUSÃO AO DIA


MUNDIAL DO RIM

David Sanches Figueiredo Viana, Edilson Santos Silva Filho, Matheus Fernando Borges, Maristella Rodri-
gues Nery da Rocha, Miguel Rebouças de Sousa e Gabriel da Costa Soares
david_sfviana@hotmail.com
Universidade do Estado do Pará - UEPA1, Universidade do Estado do Pará - , UEPA2, Universidade do
Estado do Pará - , UEPA3, Universidade do Estado do Pará - , UEPA5 e Universidade do Estado do Pará -
e UEPA6

Resumo: Introdução: A insuficiência renal crônica (IRC) é uma doença progressiva que acomete os rins ir-
reversivelmente, além de ser uma das principais complicações do diabetes e da hipertensão arterial. Dado o
aumento da sobrevida e a mudança dos hábitos de vida da população mundial, diversas previsões propõem um
aumento de doenças endocrinometabólicas e cardiovasculares em níveis alarmantes. Em vista dessa proble-
mática, a Liga Acadêmica de Nefrologia e Transplante do Oeste do Pará (LANEFRO), instituição composta
por acadêmicos de medicina, decidiu realizar uma ação com alusão ao Dia Mundial do Rim no intuito de
melhorar o panorama da saúde na região de Santarém/PA. Objetivo do Estudo: Promover educação em saúde
e conscientização à população sobre a importância de prevenir a IRC. Metodologia: Trata-se de um relato de
experiência da ação intitulada “Dia Mundial do Rim” realizada no dia 12 de março de 2018, em um ponto
turístico de grande movimento da cidade; organizada por um médico nefrologista juntamente com os discentes
de medicina da LANEFRO. Realizou-se uma parceria com diversas instituições de ensino superior da região
no intuito de ampliar as frentes de prevenção da IRC para os transeuntes. Cada grupo foi dividido em estações,
nas quais eram realizadas atividades diferentes: aferição de pressão arterial, glicemia capilar, peso, estatura
e orientações sobre doenças crônicas. Além disso, houve um momento de descontração com coreografias
musicais e alongamentos para a realização de uma corrida posterior à ação, como incentivo para a prática de
atividades físicas. Resultados: Em torno de 100 pessoas tiveram a oportunidade de esclarecer dúvidas em rela-
ção a hábitos de vida saudáveis e à prevenção da IRC. A maioria desconhecia o significado de IRC e qual é a
sua relação com o diabetes e a hipertensão arterial. Entretanto, demonstraram conhecimento satisfatório sobre
alimentação e prática de exercícios como vitais para a manutenção da qualidade de vida. Conclusão: A ação
foi impactante para as pessoas, pois obtiveram conhecimento do conceito e dos efeitos da IRC no organismo.
Os acadêmicos tiveram a possibilidade de realizar escuta e atitude ativa frente às dúvidas da população e de
colocar em prática a humanização médica. Percebeu-se a importância e a necessidade de continuidade dessa
intervenção em âmbito regional e espera-se que a população possa difundir o que foi transmitido na ação para
aumentar a prevenção de doenças crônicas, especialmente da IRC, de modo a reduzir os seus custos para a
saúde pública e os seus impactos sociais.

Palavras-chave: Nefrologia,Promoção da saúde,Educação

95 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A EDUCAÇÃO EM SAÚDE COMO INSTRUMENTO PARA A INTEGRAÇÃO ENSINO-SER-


VIÇO-COMUNIDADE PROPOSTA PELO PET-SAÚDE

Fernanda de Araújo Oliveira, Iana Bruna Parente Cardoso, Ademir Ferreira Sousa, Jackson Celso Pereira
Pires, Taianne Kaiena Frota Oliveira e Luiz Fernando Gouvêa e Silva
nanda.o1667@gmail.com
Universidade do Estado do Pará - UEPA

Resumo: Introdução: O Programa de Educação pelo Trabalho para a Saúde (PET-Saúde) tem como princípio
norteador a integração ensino-serviço-comunidade, que investe na qualificação em serviço dos profissionais
da saúde e na iniciação ao trabalho e vivências voltados aos acadêmicos da saúde para o fortalecimento da
atenção básica. Objetivo: relatar a experiência de acadêmicos do PET-Saúde na Unidade de Referência em
Saúde da Criança sobre as práticas adotadas para a integração ensino-serviço-comunidade. Metodologia: No
período de maio a outubro de 2017 realizaram-se reuniões com os grupos tutoriais onde houve a discussão de
artigos científicos com vistas a ter conhecimento sobre o PET-Saúde e auxiliar na elaboração de uma avalia-
ção diagnóstica para os usuários, que dentre suas questões continha uma questão sobre temas que gostaria de
informação. Após a organização e tabulação dessas informações definiram-se os conteúdos das palestras para
a elaboração dos banners juntamente com os tutores e preceptores para a posterior apresentação envolvendo
os acadêmicos dos cursos da saúde. Ao final de cada apresentação avaliou-se a satisfação do público pelo tema
através de carinhas de cor correspondente: verde se julgaram a palestra "boa", amarela se julgaram "regular"
e vermelha se julgaram "ruim". Resultados: O tema abordado nas atividades de educação em saúde foi “Qua-
lidade de Vida”, mais especificamente: Diabetes e Hipertensão, alimentação adequada, tratamento de água e
esgoto, bons hábitos posturais e atividade física. De acordo com a dinâmica das atividades, exposição dos aca-
dêmicos e interação com os usuários por meio do relato de experiência, notou-se que os conteúdos Diabetes
e Hipertensão tiveram maior relevância, pois a maioria intervia com perguntas sobre as complicações de tais
doenças. A interação entre a Universidade e a Comunidade foi satisfatoriamente alcançada visto que dos 331
usuários, 303 (91,55%) avaliaram a ação como excelente, 27 (8,15%) como regular e 1 (0,3%) como ruim,
demonstrando que a educação em saúde é um instrumento válido para a integração-ensino-serviço-comuni-
dade. Considerações Finais: A educação em saúde, envolvendo o princípio da integração ensino-serviço-co-
munidade, garantiu uma aprendizagem mútua no sentido de transmitir informações ao usuário e de conhecer
e adquirir experiências do Sistema Único de Saúde para o acadêmico.

Palavras-chave: PET-Saúde,Integração ensino-serviço-comunidade,educação em saúde.

96 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

RELATÓRIO EPIDEMIOLÓGICO DA DENGUE NO MUNICÍPIO DE SANTARÉM-PA, NO


PERÍODO DE JANEIRO 2000 A MARÇO DE 2017

Edilson Santos Silva Filho, Newton Lauer, Igor Rafael Silva Sarmento, David Sanches Figueiredo Viana,
Matheus Fernando Borges, Antonio Augusto Oliveira da Silveira e Grace Kelly Guimarães
edilsonnfilho@outlook.com
Universidade do Estado do Pará - UEPA

Resumo: Introdução: A dengue é uma doença consideravelmente grave, transmitida ao homem pelo repasto
sanguíneo de mosquitos fêmeas pertencentes ao gênero Aedes. A doença decorre da inoculação de vírus da
família Flaviviridae na circulação sanguínea. É uma doença febril, sistêmica e aguda, de características clí-
nicas variáveis que pode evoluir para um estágio hemorrágico e para a síndrome do choque da dengue. Sua
ocorrência está relacionada a precariedades no saneamento básico associado à conscientização populacional,
em que a infecção humana ocorre mediante a proliferação dos mosquitos transmissores, mediante a presença
de reservas de “agua parada” que favorecem a proliferação do vetor. Objetivo do Estudo: Fazer um levanta-
mento histórico epidemiológico da dengue no município de Santarém-Pa, de janeiro de 2000 a março de 2017.
Metodologia: Foi desenvolvido um estudo com apresentação de dados quantitativos relativos às informações
encontrados no banco de dados do SINAN sobre Dengue, de caráter quantitativo, documental, longitudinal
e retrospectivo. Após análise de dados, foi traçado o perfil epidemiológico do município, no período especi-
ficado, no qual foram encontrados dados de alta relevância para a saúde pública. Resultados: observou-se a
incidência maior no gênero feminino (53%), maior número de casos na zona urbana (86%), faixa etária mais
afetada de 20 a 39 anos, correspondendo a 40,33% do total de casos confirmados, média de confirmação de
60% dos casos e evolução para cura em 99,84% dos casos, estando assim em concordância com a taxa de
evolução nacional registrada pelo DATASUS. Conclusão: Através desse estudo é possível perceber que a vigi-
lância epidemiológica serve para indicar a adoção de medidas de controle efetivas no impedimento de novas
ocorrências. A prevenção da dengue implica em cuidar da constante necessidade de eliminar os criadouros do
vetor, fato esse que necessita de participação da população e uma boa interação dessa com serviços de saúde
para conhecer bem os procedimentos garantindo uma maior eficácia. Uma fiscalização por parte da adminis-
tração pública aumentaria os níveis de adesão às práticas preventivas da população diminuindo os casos de
dengue. Não basta apenas atribuir aos indivíduos a responsabilidade pela sua saúde, a culpabilidade também
cabe ao estado em prover suportes para conscientizar melhor a população.

Palavras-chave: Epidemiologia,Dengue,Saúde Publica

97 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

EFEITOS DA FISIOTERAPIA NA DOR CAUSADA PELA LOMBOCIATALGIA: ESTUDO DE


CASO

Fernanda de Araújo Oliveira, Iana Bruna Parente Cardoso, Matheus Eduardo Horta da Costa, Djúlia So-
raya Sena e Amanda Emanuele dos Santos Correa
nanda.o1667@gmail.com
Universidade do Estado do Pará - UEPA

Resumo: Introdução. A lombociatalgia é uma afecção dolorosa na coluna lombar, devido irritação na raiz
nervosa da região acompanhada por dor irradiada para o(s) membro(s) inferior(es) através do trajeto do nervo
ciático. Na maioria dos pacientes observa-se transtorno funcional, impossibilitando que o paciente realize suas
atividades rotineiras, como trabalhar, pegar objetos no chão, deitar.Uma das alternativas de tratamento para
este quadro doloroso é a fisioterapia. Objetivo do estudo. Verificar os efeitos de um protocolo de fisioterapia
na dor causada pela lombociatalgia. Metodologia. Esse estudo de caso foi realizado utilizando abordagem
quantitativa, com paciente de 46 anos, sexo masculino, mecânico, com diagnostico de lombociatalgia há
aproximadamente 2 meses, relatando dor intensa na região lombar irradiando para membro inferior esquerdo
acompanhado de dormência principalmente ao ficar muito tempo em mesmo posicionamento, seja em pé, sen-
tado ou deitado. Ao todo foram realizadas 20 sessões, sendo a primeira específica para a avaliação em que foi
utilizada a escala visual analogica (EVA) de dor e paciente relatou grau 9 (dor intensa) naquele momento e dor
constante de 4 (moderada). Nas primeiras 10 sessões o protocolo de atendimento empregado foi: alongamento
de coluna lombar e membros inferiores por 30 segundos em decúbito dorsal na maca, infravermelho por 15
minutos e Estimulação Elétrica Nervosa Transcutânea (TENS) por 30 minutos freqüência de 80 Hz, duração
de pulso de 275µs e intensidade confortável de acordo com o relato do paciente. As outros 10 sessões foram
constituídas pelos mesmos alongamentos, seguido por cinesioterapia com bola suíça, ponte e prancha, além
do TENS. Resultados. Após a realização das sessões, foi feita reavaliação na qual o paciente relatou não sentir
mais dor constante, porém sentir dor 2 (leve), segundo a EVA, depois de realizar movimentos de flexão da
coluna. Conclusão. Conclui-se então, que o protocolo fisioterapêutico traçado mostrou-se eficiente na melhora
da dor e conquentemente na melhora da qualidade de vida do paciente.

Palavras-chave: Fisioterapia, Dor Lombar; Nervo Ciático.

98 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

EXTENSÃO UNIVERSITÁRIA: A EXPERIÊNCIA DE ACADÊMICOS DE MEDICINA


ATUANDO NO GRUPO HIPERDIA DA COMUNIDADE QUILOMBOLA DO MURUMURU,
EM SANTARÉM-PA.

Edilson Santos Silva Filho, David Sanches Figueiredo Viana, Orestes Gastão de Toledo Bozza Neto, Ma-
theus Fernando Borges, Josiane Lilian de Sousa Lima, Nicole Guedes Barros e Tayrone Nayara Soares de
Oliveira
edilsonnfilho@outlook.com
Universidade do Estado do Pará - UEPA

Resumo: Introdução: Atualmente, as doenças crônicas não transmissíveis são o principal problema global de
saúde. Na última década, é marcante o crescimento da prevalência geral do Diabetes Melito e da Hipertensão
Arterial Sistêmica em meio à população brasileira, duas das condições crônicas mais preocupantes em se fa-
lando em Saúde Pública. Essas patologias por serem, na maior parte do seu curso, assintomáticas, seu diagnós-
tico e tratamento são frequentemente negligenciados. O grande impacto da morbimortalidade cardiovascular
na população brasileira, que tem o DM e a HAS como importantes fatores de risco, traz um desafio para o
sistema público de saúde: a garantia de acompanhamento sistemático dos indivíduos identificados como porta-
dores desses agravos, assim como o desenvolvimento de ações referentes à promoção da saúde e à prevenção
de doenças crônicas não transmissíveis. Objetivo do estudo: Promover educação em saúde e conscientização
sobre a importância do tratamento multimodal para o controle da hipertensão e do diabetes melito na comuni-
dade quilombola do Murumuru, em Santarém/Pa. Metodologia: Trata-se de um relato de experiência realizado
na reunião do grupão HIPERDIA na comunidade quilombola do Murumuru, em 15/03/2018. Os convidados
assistiram a uma série de palestras e vídeos educativos, que abordavam de maneira didática a hipertensão e
o diabetes. Comprovando o aprendizado, submeteu-se uma dinâmica na qual os idosos sentados respondiam
perguntas direcionadas aos hábitos de vida e complicações decorrentes da não adesão ao tratamento. Na reali-
zação da dinâmica, a vivacidade veio à tona, proporcionada pela realização de atividades físicas, aumentando
ainda mais a produtividade da ação. Resultados: Obteve-se uma participação voluntária e integral do grupo
de idosos durante toda a ação. Percebeu-se diante da dinâmica, animação e receptividade, os quais influenciam
de forma benéfica o bem estar biopsicossocial e a aceitação do tratamento. Verificou-se durante as palestras
vários questionamentos e relatos de hábitos por parte do grupo, grande adesão as propostas de mudança de ati-
tude e maior aprendizado. Constatou-se grande sentimento de gratidão por parte dos idosos e pedidos de retor-
no. Conclusão: A atenção primaria em saúde é um espaço prioritário e privilegiado de atenção, que atua com
a comunidade e a clientela adscrita nos programas de saúde, levando em conta diversidade racial, cultural,
religiosa e os fatores sociais envolvidos. E com a necessidade da existência de maior vínculo com a população,
as ações educativas são realizadas, desempenhando o papel fundamental de levar informações referentes ao
processo saúde-doença, expressadas de forma dinâmica, facilitando o aprendizado ao público-alvo.

Palavras-chave: Hipertensão,Diabetes Melito,Saúde Coletiva

99 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PRINCIPAIS DIAGNÓSTICOS DE ENFERMAGEM EVIDENCIADOS NOS PACIENTES


COM TROMBOSE VENOSA PROFUNDA RELACIONADO À DIABETES MELITUS

Lília Maria Nobre Mendonça de Aguiar, Jenifer Maria Da Silva Ribeiro E Caroline Alves Do Amaral
liliamaria388@gmail.com
Universidade Federal do Pará - UFPA , Universidade da Amazônia - , UNAMA2 e Universidade Da Amazo-
1

nia - e UNAMA3

Resumo: INTRODUÇÃO: A Trombose Venosa Profunda (TVP) se caracteriza pela formação de trombos que
oclui parcialmente ou totalmente a parede das veias profundas, causando uma reação inflamatória mais co-
mumente nos membros inferiores (80 a 95% dos casos). Sua etiologia costuma ser decorrentes de problemas
graves de circulação, doenças ateroscleróticas avançadas ou até mesmo diabetes, hipertensão dentre outras
causas. A enfermagem neste âmbito exerce um papel essencial na assistência à pacientes com TVP, com o
objetivo de alcançar um bom prognóstico, enfatizando a importância do reconhecimento dos sinais que levam
a complicações como à Embolia Pulmonar, sendo a mais incidente. REVISAO LITERÁRIA: Deve-se consi-
derar que o desenvolvimento de TVP em pacientes diabéticos já se define como uma complicação que deve
ser relevante para o enfermeiro no momento da sistematização dos cuidados. Ressaltando-se que dentre os
sintomas mais comuns o edema e a dor no membro inferior, são as queixas mais prevalentes na maioria dos
casos. METODOLOGIA: Trata-se de uma pesquisa descritiva, com abordagem qualitativa, do tipo revisão
bibliográfica. Utilizou-se o NANDA (Nursing diagnoses: definitions & classification) 2015-2017 para reali-
zar o levantamento dos principais diagnósticos de enfermagem evidenciados em um paciente com trombose
venosa profunda decorrente do diabetes melitus, além de artigos que abordassem sobre o tema para aquisição
de informações e conhecimento sobre o assunto. RESULTADOS E DISCUSSÃO: De acordo com o NANDA,
foram encontrados seis diagnósticos, sendo que dois deles eram de risco e quatro eram reais. Os mesmos es-
tavam associados tanto com a doença prévia (Diabetes) quanto à complicação descrita, sendo eles: proteção
ineficaz caracterizado por alteração da coagulação relacionado a perfil sanguíneo anormal; risco de glicemia
instável relacionado a controle ineficaz do diabetes; volume de líquidos excessivo caracterizado por edema,
hemoglobina e hematócrito diminuídos relacionado a mecanismos reguladores comprometidos; Deambulação
prejudicada caracterizada por comprometimento vascular em membros inferiores relacionada á trombose ve-
nosa profunda; Mobilidade física prejudicada caracterizada por dor relacionada a restrição dos movimentos;
Risco de sangramento relacionado ao uso de anticoagulantes. CONCLUSÃO: Sendo assim,os Diagnósticos
baseados no NANDA permitem correlacionar à causa e os efeitos que as alterações provocam ao paciente, que
a partir das intervenções buscam suprir as necessidades básicas afetadas do paciente assistido.

Palavras-chave: Assistência; Diabetes; Diagnósticos de enfermagem; Trombose Venosa Profunda.

100 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

APLICABILIDADE DO MÉTODO MONTESSORI NO ENSINO INFANTIL EM ESCOLAS


PÚBLICAS DE SANTARÉM

Emanuella Rebelo Camargo e Wilverson Rodrigo S. De Melo


manu_stm06@hotmail.com
Universidade Federal do Oeste do Pará - UFOPA

Resumo: O Método Montessori é o nome que se dá ao conjunto de teorias, práticas e materiais didáticos ideali-
zados inicialmente por Maria Montessori. O ponto mais importante de seu método é a possibilidade de criação
e aprendizagem criada pela utilização de materiais e métodos que possam ser observados, compreendidos, e
para que a educação se desenvolva com base na evolução da criança, e não o contrário. O presente artigo tem
como objetivo analisar a aplicação do método Montessori no ensino infantil das escolas públicas de Santarém
e quais os resultados dessa aplicação. Por ser uma pesquisa que está em andamento, neste primeiro momento,
este artigo visa trazer à discussão algumas impressões iniciais de cunho bibliográfico sobre a aplicação do
método Montessori em algumas escolas de Santarém. Posteriormente, os dados observados na pesquisa biblio-
gráfica, serão analisados e sistematizados e voltados a escrita deste texto, a fim de verificarmos a importante
contribuição do método Montessori que continua fortemente evidente até os dias atuais.

Palavras-chave: Método Montessori,crianças,escolas

101 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

UM OLHAR ANALÍTICO COMPORTAMENTAL PARA AS CONTINGÊNCIAS QUE FAVO-


RECEM A ADESÃO AO TRATAMENTO HEMODIALÍTICO A PARTIR DO INÍCIO DOS
TRANSPLANTES EM UM HOSPITAL DA REGIÃO NORTE

Cleide da Silva Basgal, Neila Maria Machado de Sousa Lourenço e Fernanda Tabita Zeidan De Souza
cleidybasgal@hotmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: A presente pesquisa teve como objetivo identificar a percepção dos pacientes renais sobre os fato-
res que favorecem a adesão ao tratamento de Hemodiálise a partir da realização dos transplantes renais no
Hospital Regional do Baixo Amazonas (HRBA) Dr. Waldemar Penna em Santarém – Pará. Configurou-se
em um estudo de campo de cunho descritivo e exploratório, de corte transversal, de abordagem qualitativa e
quantitativa e amostragem não probabilística, com 25 participantes na faixa etária entre 22 a 70 anos de idade
que estavam em tratamento hemodialítico na referida unidade de saúde há dois anos ou mais, inclusos na lista
de espera para o Transplante Renal por meio do Registro Geral da Central de Transplantes (RGCT) através
do Cadastro Técnico Único (CTU). Os instrumentos utilizados foram: Questionário de Percepção de Doen-
ças Versão Breve (Brief IPQ) e entrevista semiestruturada, analisados através do software SPSS versão 18.0
(IBM, Chicago, IL). A variáveis dependente foi o escore de percepção da doença Brief IPQ. Os resultados
demonstraram que os pacientes entrevistados tinham uma percepção relevante de ameaça imposta pela pato-
logia, todavia, possuíam uma considerável compreensão dos sinais e sintomas da DRC em consonância com
uma visão positiva atribuída ao tratamento, fatores que por sua vez implicam em uma maior compreensão e
controle da doença e consequentemente maior adesão. Além disso, o início dos transplantes renais no HRBA
foi percebido como um evento motivador para a manutenção e surgimento de comportamentos de aderência ao
tratamento de Hemodiálise, considerando os impactos positivos sobre adaptação e fortalecimento dos recursos
de enfretamento. Com base nos achados do estudo espera-se contribuir para o planejamento, divulgação e
implementação de ações de promoção de saúde em função da adesão ao tratamento hemodialítico em prol da
melhora na qualidade de vida e do reestabelecimento da autonomia.

Palavras-chave: Hemodiálise,Adesão ao Tratamento,Transplante.

102 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

O USO DO IMPERATIVO NO PORTUGUÊS FALADO SANTARENO: ANÁLISE DE NARRA-


TIVAS DE EXPERIÊNCIA PESSOAL.

Simone Santos de Souza e Ediene Pena Ferreira


simone-souza09@live.com
Universidade Federal do Oeste do Pará - UFOPA

Resumo: Pretende-se, nesta pesquisa, averiguar os usos de expressão de ordem realizados pelos falantes do
português santarenos. De forma específica, identificar em narrativas de experiência pessoal a preferência dos
falantes ao utilizar o verbo no modo indicativo ou subjuntivo na construção de enunciados imperativos, ten-
do em vista que tais modos encontram-se em variação no português brasileiro. Para tal fim, abrigamo-nos
no funcionalismo linguístico, proposta teórica que concebe a língua como instrumento de interação social
apoiando-nos em autores como Cunha (2008), Pena-Ferreira (2007) e Martelotta (2003,2008). Para alcançar
os objetivos propostos realizamos pesquisas bibliográficas sobre verbos, modos verbais, variação das formas
imperativas e outros assuntos pertinentes para a compreensão do objeto analisado, valendo-se de autores como
Mateus (2003), Borges (2005), Castilho (2010), Basílio (2011), Scherre (2007), Cardoso (2015), entre outros.
À vista disso, objetiva-se saber se fatores linguísticos e extralinguísticos condicionam a escolha do modo de
expressão de ordem na fala espontânea dos santarenos. Para isto, foi constituído um corpus de ocorrência
de sentenças imperativas extraídas de narrativas de experiência pessoal que compõem o Corpus de Textos
Orais do Português Santareno- CTOPS. Foram extraídas 108 ocorrências de verbos no imperativo, sendo que
87 (80,56%) encontravam-se associadas à forma indicativa e 21(19,44%) associadas à forma subjuntiva. Os
fatores como polaridade afirmativa, sentenças que expressam exclusivamente ordem, ausência dos pronomes
tu/você e o próprio gênero utilizado para esta pesquisa condicionaram a escolha verbal associada à forma in-
dicativa. O fato de o gênero favorecer a escolha verbal associada à forma indicativa ocorre porque o gênero
pesquisado é de registro informal, sendo assim não há um monitoramento por parte do falante. Consideramos
que a modalidade oral por encontrar-se em um contexto informal não demanda um uso prescritivo da língua,
por esse motivo dá-se a preferência à forma indicativa para a expressão do imperativo, segundo os dados em
análise

Palavras-chave: Variação,Imperativo,Português

103 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PROTOCOLO FISIOTERAPÊUTICO NA PARALISIA DE BELL: ESTUDO DE CASO

Matheus Eduardo Horta da Costa, Iana Bruna Parente Cardoso, Fernanda de Araújo Oliveira, Djúlia So-
raya Sena e Amanda Emanuele dos Santos Correa
matheushortacosta@gmail.com
Universidade do Estado do Pará - UEPA

Resumo: Introdução. A paralisia de Bell (PB) consiste na paralisia do sétimo par craniano (nervo facial) de
forma aguda, sem causa detectável. O acometimento deste nervo resulta em paralisia completa ou parcial da
mímica facial (MF) ipsilateral a lesão e pode ocorrer acompanhada de outros distúrbios, como de gustação,
salivação e lacrimejamento. Dentre as alternativas de tratamento mais relatadas na literatura para esse aco-
metimento está a fisioterapia com todos os seus recursos com a finalidade de restabelecer a expressão da MF.
Objetivo. Verificar a eficácia de um protocolo fisioterapêutico na PB. Metodologia. Esse estudo de caso foi
realizado com paciente de 29 anos, sexo feminino, universitária, com diagnostico de PB, com 10 dias de pa-
ralisia complete em hemiface direita, relatando dificuldade em fechar o olho direito, em se alimentar e beber
líquidos. A avaliação fisioterapêutica consistiu de observação visual subjetiva do movimento voluntário dos
músculos faciais através dos seguintes comandos: “Levante as sobrancelhas“ (músculo frontal); “Traga suas
sobrancelhas para baixo e juntas“ (músculo corrugador do supercílio); “Feche os olhos” (músculo orbicular
dos olhos); “Abra as narinas” (músculo nasal); “Feche e enrugue a boca” (músculo orbicular da boca); “Le-
vante o lábio superior” (músculo levantador do lábio superior e levantador do ângulo da boca); “Sorria sem
mostrar os dentes” (músculo risório); “Abaixe o canto da boca” (músculo abaixador do lábio inferior e abai-
xador do ângulo da boca); “Sopre enchendo suas bochechas” (músculo bucinador). Ao todo foram realizadas
15 sessões, sendo a primeira específica para a avaliação em que a paciente teve dificuldades para realizer a
todos os comandos. O protocolo de atendimento foi: MF de frente a um espelho, Facilitação Neuromuscular
Proprioceptiva (FNP) e Estimulação Elétrica Funcional (FES) por 20 minutos com frequência de 50 Hz, du-
ração de pulso de 250 μs, tempo on de 6 segundos, tempo off de 12 segundos e intensidade confortável para a
paciente, sendo utilizado os dois canais: um em músculo orbicular do olho e o outro em músculo orbicular da
boca. Resultados. Após a realização das sessões, foi feita reavaliação na qual a paciente teve que obedecer aos
mesmos comandos da avaliação, conseguindo realizar a todos. Além disso, após as 15º sessão a mesma rela-
tou que já conseguia se alimentar e beber líquidos normalmente, demonstrando satisfação com os resultados e
obteve alta fisioterapêutica. Conclusão. Conclui-se, então, que o protocolo fisioterapêutico traçado foi efetivo,
demonstrando a importância da abordagem funcional no tratamento de PB.

Palavras-chave: Fisioterapia; Paralisia Facial; Tratamento.

104 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

DIAGNOSTICO DE MALASSEZIOSE EM CANINOS E SUA CORRELAÇÃO COM SINAIS


CLINICOS DE OTOTPATIAS

fernando lucas gama da costa, LUANA LIMA DE OLIVEIRA e DENNIS JOSÉ DA SILVA LIMA
matheushortacosta@gmail.com
Faculdade da Amazônia - UNAMA

Resumo: A Malassezia sp. é um fungo leveduriforme pertencente à microbiota normal, é patógeno oportunis-
ta do meato acústico externo e tegumento de cães e gatos, podendo ser encontrado no reto, pele interdigital,
sacos anais e vagina, que pode causar dermatite e otite externa.Neste artigo propomoscorrelacionar os sinais
clínicos de otopatias com a presença de malassezia sp.de cães, utilizando dois métodos de exames citológicos
distintos: swab e imprint.Durante o período de abril a junho foi realizada a coleta de material otológico de 54
cães contabilizando 108 amostras analisadas buscando células leveduriformes compatíveis com a morfologia
da Malassezia sp, foram coletadas amostras de cães independentemente de sua raça, sexo ou estado de saúde
nas clinicas veterinárias Cães & Gatos e Animal Care.Inicialmente houve a elaboração de uma ficha clinica
para preenchimento de informações do animal e proprietário, e sintomas que animal apresentava no momento
da coleta do material, como presença de prurido, secreção otológica (cor e odor), eritema, dor e outros sinto-
mas crônicos como hiperpigmentação, hiperqueratose e liquenificação.Em relação aos exames de Imprint de
orelhas foi encontrado M. pachydermatis em 96,66% (n=58/60), destes animais 44 estavam asintomáticos e 16
estavam ssintomáticos no momento da colheita do exame, apenas duas fêmeas foram negativas.Em relação aos
exames de Swab otológico foi encontrado M. pachydermatis em 91,66% (n=44/48), destes animais 34 estavam
assintomáticos e 14 estavam sintomáticos no momento da colheita. Em relação ao sexo, 17 fêmeas e 27 ma-
chos foram positivos.Não foi observada predisposição em relação ao sexo, raça ou idade em ambos os exames.
Os animais apresentavam sinais clínicos leves a moderados tais como prurido, eritema, aumento de quantidade
de secreção otológica, hiperpigmentação e hiperqueratose.Embora não tenha se observado correlações entre
a presença de sintomas e a quantidade de leveduras, observamos que as análises feitas por Swab permitiram
identificar uma maior quantidade de leveduras por campo em comparação com o Imprint otológico.Não há
correlação entre a quantidade de Malassezia pachydermatis observada na citologia otológica com a presença
de sinais clínicos em ambos os métodos. É possível encontrar grandes quantidades de M. pachydermatis em
citologias de cães hígidos e ainda pequenas quantidades em animais clinicamente doentes, portanto, para a
realização de um diagnóstico adequado das otites externas em cães, devem-se associar os achados clínicos dos
animais com a avaliação microscópica da secreção otológica.

Palavras-chave: Malassezia sp.,Yeast,otitis externa,swab,imprint.,levedura,otite externa

105 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

EXPERIÊNCIA DOS ACADÊMICOS DO CURSO DE MEDICINA NA PROMOÇÃO DE SAÚ-


DE INFANTIL

Marina Gregória Leal Pereira, Adna Abigail da Costa Silva, Igor Ximenes Parente, Rafael Pedroso Bastos,
Valeska dos Santos Sarmento e Lene Safira Gonçalves Pinheiro
marina-glp@hotmail.com
Universidade do Estado do Pará - UEPA1, Universidade do Estado do Pará - , UEPA2, Universidade do
Estado do Pará - , UEPA3, Universidade do Estado do Pará - , UEPA4, Universidade do Estado do Pará - ,
UEPA5 e Universidade Camilo Castelo Branco - e UNICASTELO6

Resumo: Introdução: As atividades de educação em saúde são meios que visam melhorar a qualidade de vida
e promover a saúde na população. É perceptível na atualidade o desinteresse de muitos profissionais da saú-
de em propiciar ações com esse propósito. Porém, deve-se enfatizar a importância não só para a população,
que irá se beneficiar com informações acerca da saúde, mas também aos futuros profissionais de saúde, que
aprendem a lidar melhor com a comunidade e ainda se fazem educadores nessa perspectiva. Este estudo tem
por objetivo relatar as vivências da inserção dos discentes de medicina na atenção primária em saúde, através
de metodologias ativas de ensino. Metodologia: Este estudo trata-se de uma pesquisa de campo, descritiva
do tipo relato de experiência. Realizado como proposta de ações de extensão da Universidade do Estado do
Pará pelos discentes e docentes do curso de medicina, em meados de abril de 2017. No primeiro momento, foi
realizada uma visita na instituição de ensino pública, em que se realizou exames físicos nas crianças presen-
tes e verificou-se possíveis temáticas para ações de educação em saúde. Após a observação das necessidades
das crianças da instituição e conversa junto com os funcionários atuantes, optou-se pela realização em um
segundo momento da educação em saúde, tendo como eixo temático higiene corporal voltada para o público
infantil da instituição de ensino da rede pública municipal. Para facilitar a abordagem e dinamizar a experiên-
cia com as crianças optou-se por dividi-las em dois grupos menores e utilizou-se de dinâmicas lúdicas: teatro
de fantoche, músicas e brincadeiras socioeducativas. Resultados: Participaram desta ação cerca de 60 crian-
ças com idade variando de 2 a 5 anos. Observou-se a participação das crianças junto aos palestrantes devido
principalmente a abordagem utilizada que facilitou a interação com as mesmas e proporcionou momentos de
troca de experiências. Dentre os impactos observados na formação profissional dos discentes envolvidos na
implementação destas práticas foi notável a maior facilidade de interação com o público envolvido devido as
dinâmicas utilizadas e o prévio contato, além disso foi possível observar a importância do papel da universida-
de em desenvolver junto com discentes e docentes ações em prol da promoção da saúde na atenção primária.
Considerações finais: A inserção de acadêmicos de medicina na atenção primária é de suma importância para
a formação profissional visto que oportuniza experiências pautadas nas necessidades reais de saúde da comu-
nidade, contribuindo para a formação de profissionais mais capacitados e humanizados.

Palavras-chave: saúde coletiva, saúde da criança, práticas educativas

106 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

HUMANIZAÇÃO NO LABORATÓRIO DE ANÁLISES CLÍNICAS: DIREITOS E DEVERES

Sindel Rafaela Guimarães Da Silva, Lucas Da Costa Santos, Wemila Kossmann Pimentel e Keyla Pereira
Tiago
Sindel-rafaella@hotmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: Introdução: Pretende-se nesta pesquisa abordar a Humanização no Laboratório de Análises Clínicas,
ressaltando os direitos e deveres de funcionários e pacientes. Parece claro que humanizar é tornar-se humano,
portanto neste sentido, humanizar pode estar associado a uma visão humanista, humanística, humanitária e/
ou humanitarista das relações interpessoais, sempre levando em conta à ética, a dignidade e o bem-estar dos
indivíduos envolvidos. Humanizar, em análises clínicas, que, assemelha-se ao programa Humaniza SUS po-
deria ser chamado de HumanizaLab, é também tratar o paciente com atenção e respeito, sem que se perca, as
características próprias da relação profissional dessa especialidade. Objetivo: Atuar no melhor interesse do
paciente, respeitando sempre sua livre determinação, consolidando o interesse sobre a proteção daqueles que
utilizam dos serviços prestados pelos profissionais Biomédicos e a consolidação das normas de prevenção e
práticas de nossos profissionais, visando unicamente serem fiéis aos princípios éticos, e no domínio da ciência
servindo com lealdade ao cliente e a sociedade. Metodologia de pesquisa: A pesquisa realizou-se por meio de
cinco investigações Bibliográficas, localizadas em dados de bancos virtuais, como critérios de inclusão dois
artigos científicos que contêm as palavras-chave: Humanização, Laboratório, Ética, Direitos/Deveres, já como
critérios de exclusão, três artigos científicos, que obtém textos com mais de dez anos de publicação, assim
como, artigos sem autoria ou sem data. Resultados: Espera-se que os profissionais desta área se esforcem para
adquirir uma sólida formação humanística e cultural que permita conservar a visão do homem no seu conjunto,
realizando exames clínicos, preparação do paciente para a coleta do material biológico, coleta propriamente
dita do material biológico e preparo da amostra para a análise laboratorial com Dedicação e Educação. Con-
clusão: No centro dos laboratórios clínicos, estão os pacientes, portanto a humanização nestes estabelecimen-
tos permitirá que os mesmos ofereçam respostas [laudos] não apenas científicas ou técnicas, mas também
humanas, contendo acolhimento, proteção, respeito, atenção, compreensão, empatia, compaixão, dedicação,
competência, entre tantas outras formas de agir de modo ético e humanizado.

Palavras-chave: Humanização, Laboratório, Ética, Direitos/Deveres.

107 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PROPOSTA DE AVALIAÇÃO CLÍNICA DA CICATRIZAÇÃO DE FERIDAS EM MODELO


EXPERIMENTAL

Juliete Alcantara Silva, Josiane Lopes Pinto , Vanessa Santarém Silva e José Oliva Apolinário Segundo
juhhalcantara@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: A pele é o maior órgão do corpo humano e constitui uma importante barreira imunológica indis-
pensável para a vida humana. Ela está sujeita a sofrer agressões, oriundas de fatores patológicos intrínsecos
e extrínsecos, que irão levar ao desenvolvimento de alterações na sua constituição, como no caso das feridas
cutâneas, o que pode levar a sua incapacidade funcional. Para o tratamento de feridas, é necessário que pro-
fissional de saúde não tenha apenas o conhecimento do processo de cicatrização tecidual, mas também tenha
disponível uma metodologia que permita avaliar de forma segura e criteriosa o processo estabelecendo assim
o prognóstico de um paciente. Por outro lado, sabe-se que na perspectiva da segurança ao paciente, o processo
de assistência precisa ser balizado por protocolos clínicos que permitam tomar decisões efetivas. Este trabalho
tem por objetivo lançar uma proposta de avaliação clínica da cicatrização de feridas em modelo experimental
que possibilite utilizar parâmetros que tornem o acompanhamento da cicatrização de feridas. Para avaliar o
efeito cicatrizante de Bryophylum Pinnatum (Lam) em ratos machos wistar, organizados em grupos, foram
feitas lesões cutâneas padronizadas de 1 cm². Posteriormente, durante 14 dias, os animais receberam tratamen-
to tópico de um creme incorporado com extrato da espécie vegetal em questão. Para o acompanhamento do
tratamento, foi elaborada uma planilha com seis aspectos clínicos previamente elencados, como presença de
sangramento na ferida, formação de crosta total, formação de crosta parcial, formação de secreção purulenta,
epitelização da ferida e crescimento de pelos. Na avaliação desses parâmetros foi utilizado a descrição ausente
ou presente para cada animal tratado. A tabulação dos parâmetros avaliados, foi realizada através de descrições
de cunho qualitativo a partir do que foi observado durante o tratamento, possibilitando gerar informações de
cada grupo experimental tratado e assim avaliar o efeito da cicatrização ou ocasionamento de infecção em
relação ao produto tópico tendo em vista cada parâmetro de acordo com o tempo de tratamento. Os resultados
obtidos foram satisfatórios no que diz respeito a avaliação dos parâmetros pois não houve controvérsia do que
era esperado durante a terapêutica a qual os animais foram submetidos.

Palavras-chave: Pele, Feridas, Avaliação Clínica

108 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

APRESENTAÇÃO DA SÍNDROME DE GUILLAIN-BARRÉ

Juliete Alcantara Silva, Jaiane Cristina dos Santos Nascimento e Mirna Brito Malcher Pedroso
juhhalcantara@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: A síndrome de Guillain Barré (SGB) é uma polirradiculoneuropatia inflamatória, geralmente pós-
-infecciosa mediada pelo sistema imune com participação sinérgica entre imunidade celular e humoral, a
resposta contra o agente infeccioso resulta na produção de anticorpos que reconhecem epítopos semelhantes
aos microrganismos no nervo periférico. Estudos clínicos eletrofisiológicos e imunopatológicos caracterizam,
além da polineuropatia desminielinizante inflamatória aguda (PDIA)-variante clássica, neuropatia axonal mo-
tora aguda (NAMA), neuropatia axonal motora e sensitiva aguda (NAMSA) e a síndrome de Miller Fisher
(SMF). A SGB é uma patologia relativamente frequente, se comparada a outras doenças neurais. Apesar da
etiologia e fisiopatologia ainda não estarem completamente entendidas, sabe-se que a exposição a agentes
infecciosos, como Campylobacter jejuni, Mycoplasma pneumoniae, citomegalovírus, Epstein-Barr, vírus da
imunodeficiência, uma pequena percentagem parece ser precedida de intervenção cirúrgica, linfoma ou lúpus
eritematoso disseminado, provocando uma resposta imunológica por mimetismo molecular associada a fato-
res genéticos que são considerados determinantes na origem da doença. A evolução clínica aguda ou subagu-
da, com evolução monofásica, manifesta parestesias, formigamentos, fraqueza, dor ou combinação de algum
desses sintomas. O quadro típico é uma paralisia simétrica e ascendente que piora num período de 12 horas a
28 dias, seguido por um período de platô. Os pacientes apresentam hipo ou arreflexia, insuficiência respirató-
ria (necessitando de ventilação mecânica em alguns casos), por comprometimento dos músculos diafragma e
intercostal. O envolvimento dos nervos cranianos é frequente, resultando em paralisia facial. Disautomia com
alterações cardíacas, gastrointestinais e hiponatremia podem ocorrer. É frequente o acometimento de infecção
respiratória ou diarreia 3 dias a 6 semanas antes do início do quadro. É fundamental a percepção do contexto
sintomatológico da SGB, pois é escasso o conhecimento da progressão desta síndrome. Foi realizada uma
revisão de literatura utilizando o banco de dados: Scielo, BVS e Google Acadêmico, buscando referências
que abordassem sobre a Síndrome de Guillain Barré dentro do fator sintomatológico, foram excluídas aquelas
que não contemplavam a temática envolvida, a pesquisa bibliográfica incluiu artigos originais, de revisão,
diretrizes e protocolos escritos na língua portuguesa. Para os profissionais de saúde é de extrema importância
interar-se quanto ao desenvolvimento da síndrome, a detecção e o cuidado é responsabilidade de uma equipe
multiprofissional, que por muitas vezes desconhecem sua etimologia, podendo gerar equívoco e a síndrome
ser confundida com outra patologia.

Palavras-chave: Síndrome de Guillain-Barré, evolução clínica, profissionais de saúde

109 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

SAUDE MENTAL E QUALIDADE DE VIDA EM PACIENTES COM FERIDAS CRÔNICAS: O


PSICÓLOGO COMO COMPONENTE DA EQUIPE MULTIDISCIPLINAR

Bettsy Cristina Araújo Serednicki, Fernanda Camargo Silva, Eliana Andressa Sousa de Brito, FRANCIRE-
NE PALHÃO PICANÇO, Thainan Oliveira dos Anjos, Inglith Rodrigues de Lima e Edilmara Patricia Rocha
bettsy_serednicki@hotmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: Por muito tempo as concepções e práticas de saúde não possuíam um olhar voltado a integralidade
do ser humano, o cuidado era baseado somente na doença biológica, desconsiderando a influência dos fato-
res sociais e psicológicos. Após a reformulação do conceito de saúde pela Organização Mundial da Saúde
em 1948, ampliou-se o entendimento do processo saúde/doença, se efetivando uma prática de acolhimento
e respeito para o indivíduo com sentimentos. A percepção integral possibilitou reconhecer que as pessoas
sofrem psiquicamente por várias razões decorrentes do adoecimento físico, dentre elas, pode-se destacar a fe-
rida crônica, que compromete, sobretudo, a autoimagem e consequentemente, a qualidade de vida emocional
do lesionado. Diante disso, o presente trabalho tem por objetivo retratar a importância do acompanhamento
psicológico para pacientes submetidos ao tratamento de feridas crônicas. Trata-se de um trabalho de cunho
bibliográfico, com pesquisas realizadas nas bases indexadas: SCIELO, LILACS e PEPSIC em língua nacio-
nal, entre o período de 2008 a 2018, onde se resgatou onze artigos, utilizando-se apenas sete, que atenderam
aos objetivos esperados pelos pesquisadores. Para Marcon et al. (2011)é pertinente levar em consideração que
uma ferida crônica pode ocasionar algumas problemáticas no decorrer da vida, tanto de ordem física quanto
emocional. Isto posto, entende-se que o cuidar do indivíduo deve ser voltado para toda a sua dimensão en-
quanto ser humano, uma vez que a mudança no cotidiano do indivíduo com uma lesão reflete na sua funciona-
lidade, interferindo diretamente no processo saúde/doença. A literatura aponta que a equipe multiprofissional
mostra-se de extrema importância e eficaz no processo de cicatrização da ferida crônica, entre os componentes
de tal equipe, ressalta-se neste estudo, a contribuição do profissional da Psicologia. A saúde mental dessas
pessoas, a forma como funcionam e vivem, como entendem e significam essa experiência de vida, pode levar
ao sofrimento psíquico. Os artigos consultados são unânimes em reconhecer que os indivíduos que possuem
uma ferida crônica carregam consigo, além de uma doença visível, estampada na pele, uma tristeza que pesa
a alma, um sofrimento psíquico decorrente da perda da qualidade de vida e do bem-estar do meio em que se
vive. Considera-se necessário dentro da equipe multidisciplinar a existência de um profissional da Psicologia
que possa fornecer um suporte psicoemocional, admitindo que por trás de uma ferida, existe um ser humano
com medos, anseios, angústias, e que sofre, influenciando de modo negativo no processo de adesão ao trata-
mento e de cicatrização da sua lesão.

Palavras-chave: Psicologia; Saúde Mental,Qualidade de Vida,Feridas Crônicas,Saúde Mental

110 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

OS FAZERES DA PSICOLOGIA JUNTO AO SOFRIMENTO PSÍQUICO DO PROFISSIONAL


DA SAÚDE

Kelvia Laine Sousa do Carmo, ÁDRIAN GRECI FARIAS CASTRO e Fernanda Tabita Zeidan De Souza
kelviacarmo9@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: Os maiores mistérios que assolam o ser humano se referem ás suas origens, ao seu papel no mundo
e á sua finitude. Para tentar explicar e compreender esses mistérios, a humanidade vem buscando respostas
utilizando conhecimentos que em pouco ajudam frente á imensidão do que não se sabe. Dentre esses mistérios,
certamente a morte é o mais aterrorizante, porque implica no desaparecimento e a aniquilação do ser. Sobre
essas questões observa-se a necessidade do acompanhamento psicológico para os profissionais da área da saú-
de, que lidam diariamente com a dor e sofrimento do outro e os aspectos emocionais que podem ser gerados a
partir do cuidado ao doente e o suporte aos seus familiares. É sabido que o doente gera para o profissional da
saúde um desafio diário, pois na maioria das vezes esses são emissores de difíceis e más noticias e isso é uma
das mais penosas tarefas do profissional de saúde, porque aprendem em seu processo de formação a salvar
vidas e buscar a saúde, e não lidar com situações de perda da vitalidade, esperança e o temido óbito. Quando
esse profissional não possui um preparo adequado pode utilizar a mentira piedosa ou o silencio cheio de sig-
nificados dúbios o que favorece que esse viva em constante conflito, angústia e sensação de culpa podendo
assim ser inevitavelmente acometido por uma patologia de cunho psíquico apresentando sintomas de esgota-
mento físico, despersonalização, desrealização entre outros. Visando a promoção da saúde desse profissional
o presente estudo tem como o objetivo, avaliar a implicação do trabalho realizado por profissionais de saúde
e os impactos na saúde mental dos mesmos. Portanto, a metodologia utilizada foi levantamento de referencial
bibliográfico, tendo como base de dados os artigos científicos do SCIELO. Por conseguinte, os resultados
apontam a necessidade de investigar mais quais os meios e situações que podem gerar adoecimento psíquico
no ambiente de trabalho assim como os afastamentos consequentes por Transtornos Mentais relacionados a
ele. Diante disso é possível concluir que é de extrema importância que esses profissionais tenham um cuidado
assistencial, visando a preservação da saúde e integridade física e psíquica através de acolhimento feito por um
psicólogo que por conta da precariedade de muitas instituições hospitalares só vem o paciente como demanda
e prioridade para atendimento minimizando a importância de cuidados com os cuidadores.

Palavras-chave: Psicologia; Sofrimento psíquico; Profissionais da saúde.

111 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ENDODONTIA: PARTICULARIDADES, CAMPOS DE ATUAÇÃO E MERCADO DE TRABA-


LHO – UMA REVISÃO DE LITERATURA

Deivid Zeppenfeld Ravanelo, Adnaldo Lucas da Silveira Maia, Daniel de Carvalho Silva, Júlia da Silva Fer-
reira, Daniela Macambira e Verena Pereira Maia Miranda
deividzeppenfeld@hotmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: A endodontia visa à reparação dentária baseado no aspecto mais adequado e eficiente, recuperar
a aparência e funcionalidade do dente. Neste contexto, o objetivo deste trabalho é apresentar a endodontia,
como uma das especialidades da odontologia, abordando suas particularidades, campos de atuação e mercado
de trabalho, através de uma revisão bibliográfica realizada a partir de livros e periódicos. Suas particularidades
estão inseridas nas formas de tratamento aplicadas neste ramo, divididas em tratamento conservador que busca
a conservação da polpa do dente ou parte dela, e tratamento radical com a finalidade de remover totalmente o
tecido pulpar, cada aplicada de acordo com o caso clínico do paciente. No seu campo de atuação, o profissional
realiza processos que tem como intuito à reestruturação dentária, partindo da retirada da polpa com o auxílio
de materiais apropriados, para tal é necessário realizar uma abertura na coroa do dente para acessar ao tecido
pulpar, o espaço em que a polpa ocupava é preenchido, com o material obturador ou curativo. O mercado de
trabalho atual encontra-se competitivo, visto que este serviço é realizado principalmente em clinicas parti-
culares, logo, quem se sobre sai são profissionais que buscam o aprimoramento de suas técnicas. Portanto, a
endodontia apresenta particularidades e campos de atuação que a torna única neste ramo, e um mercado de
trabalho bastante amplo e diversificado, o que induz os profissionais a buscarem por mais conhecimento cien-
tífico através de cursos de capacitação e especialização de acordo com as suas afinidades, proporcionando um
mercado dinâmico e competitivo, mais preocupado e preparado para oferecer serviços de qualidade aos seus
pacientes e a sociedade como um todo.
Palavras-chave: Endodontia, tratamento, polpa.

112 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ASSISTÊNCIA DE ENFERMAGEM AO PACIENTE PORTADOR DE SÍNDROME DE FOUR-


NIER EM CLÍNICA CIRÚRGICA: PRINCIPAIS DIAGNÓSTICOS DE ENFERMAGEM

JENIFER MARIA DA SILVA RIBEIRO, Jéssica Freitas Reis e Lília Maria Nobre Mendonça de Aguiar
jenifer_ribeiro06@hotmail.com
Faculdade da Amazônia - UNAMA , Faculdade da Amazônia - , UNAMA2 e Universidade Federal do Pará -
1

e UFPA3

Resumo: INTRODUÇÃO: O presente relato foi desenvolvido em um hospital público durante o estágio su-
pervisionado em clínica médica do curso de Enfermagem da Faculdade da Amazônia (UNAMA). Durante o
estágio se oportunizou realizar uma Sistematização de Assistência de Enfermagem, identificando os principais
diagnósticos de enfermagem em um portador de Síndrome de Fournier, doença esta considerada rara, grave
e de rápida progressão clínica. REVISÃO DA LITERATURA: A Síndrome de Fournier (SF) é uma afecção
polimicrobiana necrotizante, que envolve a fáscia superficial e frequentemente a fáscia profunda dos órgãos
genitais e região perineal. Essa condição é desencadeada principalmente por bactérias gram-negativas que
invadem as genitais, gerando sinais clínicos como: odor fétido e edema na região genital. MATERIAL E
MÉTODOS: Trata-se de um trabalho de caráter descritivo, com abordagem qualitativa, tipo relato de expe-
riência. A pesquisa descritiva é aquela que o pesquisador apenas descreve os dados obtidos, sem alterá-los.
Utilizou-se o NANDA 2017 (Nursing Diagnoses: Definitions & Classifications) para construir os principais
diagnósticos de enfermagem evidenciados durante a assistência a esse paciente. RESULTADOS: Dentre os
principais diagnósticos encontrados há o “distúrbio de imagem corporal”, uma vez que, pacientes com a SF
apresentam alteração na anatomia da região genital, causando prejuízos emocionais ao mesmo. Além desse,
o outro diagnóstico observado foi o de “integridade tissular prejudicada”, devido a SF acometer os tecidos
da genital causando a necrose. Ainda, foi identificado o diagnóstico de “dor aguda”, sendo um achado clínico
comum nos pacientes que desenvolve a síndrome, pois acomete as terminações nervosas e expõe o tecido
conjuntivo. CONCLUSÃO: A experiência vivida no estágio foi de extrema importância e contribuiu de forma
significativa na formação acadêmica, devido essa síndrome ser considerada rara. Portanto, é necessário que a
equipe de enfermagem saiba quais condutas devem ser tomadas frente a essa patologia, e o plano assistencial
só será desenvolvido da maneira correta se os diagnósticos, que é a segunda etapa do processo de assistência
de enfermagem, forem construídos de maneira a elencar os principais prejuízos à sua saúde.

Palavras-chave: Assistência de Enfermagem,Diagnósticos de Enfermagem,Síndrome de Fournier

113 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

SÍNDROME DE SOBREPOSIÇÃO: RELATO DE CASO

Kalysta Borges, Georgia Traesel e Flávia Karoline Souza da Silva


georgia.traesel@gmail.com
Universidade do Estado do Pará - UEPA

Resumo: INTRODUÇÃO: As síndromes de sobreposição são raras e caracterizam-se pela ocorrência em


mesmo doente de duas ou mais doenças do tecido conjuntivo de natureza autoimune. Este trabalho propõe
fazer o relato de caso em um sujeito de pesquisa que desenvolveu esta síndrome, apresentando simultanea-
mente Lúpus eritematoso sistêmico (LES), Síndrome de Sjögren (SS) e dermatomiosite. REVISÃO DE LI-
TERATURA: O LES é uma doença autoimune sistêmica em que há produção de autoanticorpos, formação e
deposição de imunocomplexos e dano tecidual. A SS é uma doença autoimune sistêmica inflamatória crônica
que afeta principalmente as glândulas lacrimais e salivares. A dermatomiosite é uma doença sistêmica crônica
que se caracteriza por acometimento inflamatório da pele e dos músculos. METODOLOGIA: É uma pesquisa
de caráter descritivo do tipo Estudo de Caso, realizada no Hospital Regional do Baixo Amazonas (HRBA).
Após o aceite institucional do HRBA e assinatura do Termo de Consetimento Livre e Esclarecido (TCLE)
pelo sujeito da pesquisa, foram coletados os dados a partir do prontuário deste. Este trabalho foi realizado
cumprindo as Normas de Pesquisa Envolvendo Seres Humanos (Res. CNS 466/12) do Conselho Nacional de
Saúde. RESULTADOS: Paciente de 43 anos, feminino, parda, casada, natural de Santarém/Pará e procedente
de Santarém/ Pará (G3,P2,A1), vendedora. Em novembro de 2016, apresentou quadro de febre, cefaleia em
região frontal, artralgia, inapetência e edema nos membros inferiores. Referiu perda ponderal de cerca de
20kg. Evoluiu com piora clínica, sendo internada no HRBA com grave ascite. Para investigação desse caso,
exames laboratoriais e de imagem foram realizados. Os critérios que corroboraram o diagnóstico de LES
foram: presença de úlceras orais, alopécia não cicatricial, trombocitopenia 92.000 /mm3, Fator antinuclear
positivo; Anticoagulamnte lúpico presente, Complemento sérico reduzido na fração C4: 17 mg/dL, VHS: 52
mm/h, PCR 61,1 ng/L, B-2-microglobulina 8,2 mcg/mL. Para diagnóstico de SS levou-se em conta a xerof-
talmia, xerodermia, ressecamento ocular e Anticorpos contra ribonucleoproteínas: anti-Ro (SS-A) reagentes.
Na dermatomiosite, o diagnóstico foi dado pela observação das elevações dos seguintes exames laboratoriais
dos seguintes exames: CPK: 226 U/L, DHL 322 U/L, GGT 838 U/L, TGO 87/UL, Fosfatase Alcalina 543
U/L, associando-se com a clínica e achado de heliotropo. Paciente apresentou melhora clínica, tratada com
hidroxicloroquina e após alta hospitalar permaneceu em acompanhamento em ambulatório de Reumatologia
do HRBA. CONCLUSÃO: A Síndrome de sobreposição relatada constitui uma entidade clínica de rara ocor-
rência, com características distintas que a individualizam entre as doenças auto-imunes.

Palavras-chave: síndrome,sobreposição,lúpus

114 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ASSISTÊNCIA DE ENFERMAGEM A UM GRANDE QUEIMADO NO HOSPITAL REGIO-


NAL DO BAIXO AMAZONAS COM ÊNFASE A SEGURANÇA DO PACIENTE

Naiara Barroso da Conceicao, Giselle Diniz dos Santos , Erli Reis Silva e Franciane Aguiar Santana
nai.barroso51@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: A segurança do paciente foi definida, pela Organização Mundial de Saúde, como a redução do risco
de danos desnecessários associados ao cuidado de saúde ao paciente um mínimo aceitável. Para atendimento
desta segurança, a OMS propôs seis pontos importantes: a identificação do paciente, comunicação efetiva, se-
gurança de medicamentos de alta vigilância, cirurgia certa, no local certo e paciente certo, além da redução do
risco de lesões decorrentes de queda e do risco de infecção associada a saúde. Nessa perspectiva, Moreira et al.
(2012) relatam que paciente que sofreu um alto grau de complexidade de queimadura, apresenta comprome-
timento ocasionando vários distúrbios físicos, como por exemplo, perda de volume, mudanças metabólicas,
deformidades corporais e risco de infecção. O objetivo deste estudo foi descrever a assistência de enfermagem
prestada a um paciente vítima de queimadura na clínica médica de um hospital de alta complexidade em San-
tarém-PA com ênfase na segurança do paciente. Para isso, a metodologia baseou-se nos coleta de dados a partir
de artigos científicos e a observação da assistência ao paciente durante o período de estágio supervisionado na
clínica medica do hospital em questão. Os resultados mostraram que o paciente vítima de descarga elétrica em
ambiente de trabalho, sofreu queimadura de terceiro grau nos membros superiores, tórax anterior e posterior,
região sacra, região axilar direita e membro inferior direito, com diagnóstico de grande queimado, passou por
procedimentos cirúrgicos como: amputação dos membros superiores (antebraços) e debridamento do membro
inferior direito. Os cuidados de enfermagem mais relevantes foram as intervenções voltadas para a segurança
do paciente consistiram no uso dos equipamentos de proteção individual, higienização das mãos antes e após
procedimentos, banho no leito, curativo diário, administração de medicamentos, técnicas de alívio a dores
físicas e emocionais, proteção de controle quanto ao risco de queda e lesão por pressão. Conclui-se que a as-
sistência de enfermagem desenvolvida proporciona condições adequadas para a sobrevida do paciente visto
que esse tipo de acidente tem alto índice de mortalidade, requer cuidados rigorosos, adequados e imediatos
utilizando as metas de segurança para se obter bons resultados na recuperação do paciente.

Palavras-chave: Segurança. Queimadura. Assistência.

115 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

DENTÍSTICA RESTAURADORA E ESTÉTICA: UMA REVISÃO DE LITERATURA

Júlia da Silva Ferreira, Adnaldo Lucas da Silveira Maia, Daniel de Carvalho Silva, Deivid Zeppenfeld Ra-
vanelo, Ygor da Silva Rebelo e Verena Pereira Maia Miranda
juhferreira14.jf@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: O objetivo deste trabalho é apresentar a Dentística restauradora e estética como uma das especialida-
des da odontologia, abordando suas particularidades e mercado de trabalho. Para tal realizou-se uma revisão
bibliográfica em livros e periódicos acerca do tema. Em termos gerais, a Dentística aborda as alterações dos
dentes e dos tecidos circunvizinhos, trata da doença cárie e suas repercussões, e alia-se a mecanismos inova-
dores para promover uma forma, cor e textura adequada ao dente. Portanto, para compreender a dentística é
necessária a busca de tratamentos visando a indissociabilidade entre restauração e estética. As particularida-
des e competências que um cirurgião dentista especializado em dentística deve possuir, situam-se no âmbito
da cariologia. Quanto ao aspecto restaurador, nota-se que nos dias atuais há uma calorosa discussão que leva
ao princípio de prevenção para evitar, ao máximo, processos restauradores em excesso. Importante ressaltar
ainda que, atualmente, no que concerne a recuperação da forma e funcionalidade do dente, bem como em
termos estéticos, são utilizados materiais de qualidade superior aos empregados até o início dos anos 2.000,
servindo muito bem ao propósito do tratamento, além de auxiliar na autoestima do paciente. Em se tratando
de situações primordialmente estéticas, vários procedimentos fazem parte das competências do profissional
da dentística, como: clareamentos dentários, facetas de porcelana e lentes de contato. Sendo assim, enten-
de-se que o cirurgião dentista especializado em dentística deve possuir, além do conhecimento de técnicas
e matérias específicos, a capacidade de compreender a maneira como a cultura da beleza vem promovendo
grande impacto dentro das clínicas odontológicas, um sorriso bonito vai além de barreiras fúteis, e faz parte
da construção da imagem do indivíduo acerca de si mesmo e, automaticamente, da maneira como irá se reve-
lar no convívio social. Conclui-se que o campo estético possui uma tendência de crescimento indiscutível, o
aspecto preventivo e valorização de profilaxia favorecem a atuação do especialista em dentística, permitindo
sua atuação em diversas áreas, como: atendimento clínico, ensino e pesquisa e serviço público, enriquecendo
seu mercado de trabalho.

Palavras-chave: Dentística,Prevenção,Estética

116 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PESQUISA ETNOBOTÂNICA DE PLANTAS MEDICINAIS UTILIZADAS COMO ANTI-IN-


FLAMATÓRIAS EM SANTARÉM-PARÁ

RENATA ESTELA SOUZA VIANA, THAIS BARBOSA SILVA, FABIANA SANTARÉM DUARTE e Adjanny
Estela Santos de Souza
estela.renata@outlook.com
FACULDADE DA AMAZÔNIA - UNAMA1, UNIVERSIDADE DO ESTADO DO PARÁ - , UEPA2, UNIVER-
SIDADE DO ESTADO DO PARÁ - , UEPA3 e UNIVERSIDADE DO ESTADO DO PARÁ - e UEPA4

Resumo: Introdução: Em muitas comunidades da Amazônia o conhecimento sobre plantas medicinais sim-
boliza, geralmente, o único recurso terapêutico, pela dificuldade de acesso a uma Unidade de Saúde (US), e
em todo o mundo, há crescente interesse pela utilização da fitoterapia. Objetivo: O objetivo desse estudo foi
realizar uma pesquisa etnobotânica de plantas medicinais utilizadas como anti-inflamatórias em Santarém-
-Pará. Metodologia: Foi realizado um levantamento etnofarmacêutico, a fim de se resgatar o conhecimento
tradicional sobre o uso de plantas medicinais, por meio de entrevista. Após a realização da entrevista foi rea-
lizada análise dos dados buscando as plantas mais citadas pelos entrevistados com uso anti-inflamatório. Em
seguida, foi realizada pesquisa bibliográfica a fim de verificar a comprovação científica da atividade anti-infla-
matória na literatura. Resultados: Foram entrevistadas 40 pessoas, moradoras de Santarém, sendo 37 (92,5%)
do sexo feminino e 3 (7,5%) do sexo masculino. Os entrevistados tinham idade entre 19 e 88 anos de idade;
15 (37,5%) tinham baixa escolaridade, 20 (50%) tinham ensino médio e 5 (12,5%) tinham nível superior. 29
(72,5%) tinham renda de até dois salários mínimos e 11 (27,5%) tinham renda acima de dois salários mínimos.
As plantas mais citadas usadas como anti-inflamatórias foram: malvarisco (Althaea officinalis) (13 citações);
boldo (Peumus boldus), (11 citações); Jucá (Caesalpinia ferrea) (09 citações); gengibre (Zingiber officinale),
(08 citações); cumarú (Dipteryx odorata), (08 citações); elixir paregórico (Piper callosum), (07 citações);
andiroba (Carapa guianensis), (06 citações); babosa (Aloe vera), (06 citações) e hortelã (Mentha spicata),
(05 citações). Observou-se que as plantas citadas e comprovadamente anti-inflamatórias foram: o malvarisco
(Althaea officinalis); o boldo (Peumus boldus); o Jucá (Caesalpinia ferrea); o gengibre (Zingiber officinale); o
Cumarú (Dipteryx odorata); a andiroba (Carapa guianensis); a Babosa (Aloe vera); a hortelã (Mentha spicata).
Considerações finais: Embora haja relatos do uso do elixir paregórico (Piper callosum), na medicina popular
para combater febre e dores estomacais, não há dados que comprovem, através de análises sistemáticas os seus
efeitos.

Palavras-chave: Plantas medicinais,Etnofarmácia,Etnobotânica,Plantas Medicinais

117 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A MORTALIDADE DO CÂNCER DE OVÁRIO ENTRE 2012 E 2015 NA REGIÃO NORTE E


SUA EXPECTATIVA PARA 2018.

Andreza Karine Sousa Nogueira, Karine Rodrigues do Nascimento, Paola Rossetti Schommer, Nathalia Be-
lizario Sales e Albino Luciano Portela de Sousa
andrezakarine01@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: Um grave problema na saúde pública é o câncer de ovário, que corresponde a sétima neoplasia gine-
cológica letal mais diagnosticada na mulher brasileira, porém, ainda assim, poucas pessoas a conhecem, o que
prejudica o diagnóstico da doença e aumenta a sua taxa de mortalidade. O presente trabalho tem como objetivo
analisar a taxa de mortalidade por câncer de ovário entre 2012 e 2015 na Região Norte e sua expectativa para
2018. Foi realizado um estudo descritivo, retrospectivo de série temporal, baseado em dados secundários no
atlas de mortalidade do Instituto Nacional do Câncer (INCA). No período entre 2012 e 2015 houve 582 óbitos
por câncer de ovário na região, sendo 5 em mulheres de 10 a 14 anos, 10 em indivíduos do sexo feminino de
15 a 19 anos, 18 mulheres de 20 a 29 anos, 48 indivíduos do sexo feminino de 30 a 39 anos, 99 em mulheres
de 40 a 49 anos, 145 em indivíduos do sexo feminino de 50 a 59 anos, 112 em mulheres de 60 a 69 anos, 85
em indivíduos do sexo feminino de 70 a 70 anos e 60 em mulheres com mais de 80 anos. Para 2018, a expec-
tativa na Região Norte é de 270 casos para cada 100 mil indivíduos do sexo feminino, o que equivale a uma
taxa bruta de 2,96. O diagnóstico precoce e a divulgação de orientações quanto à doença, apenas reforçam a
importância dos profissionais da saúde e estudantes na disseminação de informações e no incentivo a exames
preventivos ao câncer de ovário, promovendo, dessa forma, a saúde na região Norte.

Palavras-chave: Câncer de Ovário,Mortalidade,Região Norte

118 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

EMPATIA COMO FACILITADORA NAS RELAÇOES AMOROSAS: UM ESTUDO BIBLIO-


GRÁFICO

ISABELA SILVA DE VASCONCELOS, Letícia Pinto da Silva e Edilmara Patricia Rocha


bella.vasconcelos05@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: A empatia é compreendida como a habilidade de sentir os sentimentos do outro como ele próprio e
tentar perceber suas causas como o próprio indivíduo às percebe, sendo ela um exercício a ser praticado dentro
das relações. A pesquisa teve como objetivo geral destacar a importância da empatia como uma habilidade
imprescindível na sustentação de relacionamentos amorosos. E como objetivos específicos buscou definir o
conceito de empatia nas relações; identificar se a liquidez dos relacionamentos amorosos na contemporanei-
dade existe como resultado da falta de empatia; investigar como a ausência da empatia nos relacionamentos
amorosos influencia no comportamento do indivíduo. Toma-se como hipótese que a empatia é uma habilidade
que proporciona ao relacionamento amoroso a facilidade de resolução de conflitos, que pode diminuir a inci-
dência de relacionamentos líquidos. Trata-se de uma pesquisa bibliográfica de cunho descritivo e exploratório,
de abordagem qualitativa. Foram analisados artigos científicos publicados em revistas e indexados ao Scielo,
BVSpsi, além de livros. Dentro dos resultados alcançados pode-se constatar que atualmente ser autêntico nos
relacionamentos contemporâneos vem se tornando algo dispensável, resultando em vínculos instáveis, o que
Freire et al. (2010) reflete que as pessoas não querem mais sofrer com a possibilidade de ter que terminar um
relacionamento, que passar pela vida de alguém se tornou algo efêmero. A sociedade impõe tantos temores que
apegar-se a alguém parece a maneira mais rápida de se chegar ao sofrimento. Uma pessoa que carrega histó-
rias, sentimentos, traumas é tratada como um produto, passível de descarte. Assim, para Rogers (1985/2001)
a empatia não é considerada apenas como uma resposta reflexa ao comportamento do outro, mas como uma
habilidade que poderia ser aprendida e desenvolvida sendo importante para o estabelecimento de vínculos en-
tre os indivíduos, os quais, a partir desse processo, se permitem deliberadamente, sensibilizar-se e envolver-se
com a vida privada do outro. Concluindo assim que a empatia vem a ser uma habilidade que facilita a com-
preensão dos sentimentos e emoções do outro dentro de um relacionamento, onde os indivíduos conseguem se
comunicar visando resolução de conflito.

Palavras-chave: Relacionamentos Amorosos, empatia, liquidez

119 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO DO RISCO DE LESÃO POR PRESSÃO EM PACIENTES IDOSOS ACAMADOS


ATRAVÉS DA ESCALA DE BRADEN

Matheus Eduardo Horta da Costa, Fernanda de Araújo Oliveira, Kárita Juliana Sousa Silva e Alessandra
Couto de Camargo Ferreira
matheushortacosta@gmail.com
Universidade do Estado do Pará - UEPA

Resumo: Introdução: As lesões por pressão (LPP) são lesões localizadas na pele e/ou tecido adjacente sobre
uma proeminência óssea decorrente de pressão externa.É considerado um problema de saúde pública que aco-
mete sobretudo pacientes hospitalizados. Dessa forma, medidas preventivas devem ser adotadas pelos profis-
sionais da área da saúde, entre elas a utilização da escala de Braden é muito válida, pois fornece escores que in-
dicam ao avaliador a classificação de risco ao desenvolvimento das LPP, em: risco muito alto, alto, moderado
e brando. Objetivo: Analisar o risco de desenvolvimento de lesão por pressão em pacientes idosos internados
em um Hospital Público. Metodologia: Trata-se de um estudo quantitativo, descritivo e transversal, realizado
no Hospital Municipal de Santarém, no período de abril a outubro de 2014, aprovado pelo Comitê de Ética e
Pesquisa da Universidade do Estado do Pará – Santarém, parecer n° 553.690. Foram avaliados pacientes que
estavam com no mínimo 48 horas de internação através da escala de Braden, dos 623 pacientes avaliados, 102
já apresentavam LPP e 62 estavam em risco de desenvolver LPP, dos quais 21 pacientes apresentavam faixa
etária superior a 60 anos, dos quais foram inclusos na pesquisa e coletado dados sociodemográficos, clínicos
e realizado orientações e distribuição de folders para prevenção das LPP. Resultados: Dos 21 pacientes a faixa
etária variou entre 61 a 86 anos, 43% eram do gênero feminino e 57% masculino, o tempo médio de interna-
ção foi de 6,1±5,9dias, das causas de internação 33,33% foram decorrentes de erisipela bolhosa ou amputação
MMII, 19,04% fraturas, seguido de 9,52% doenças neurológicas, das doenças associadas 53% apresentavam
hipertensão arterial e diabetes mellitus. Em relação a escala de Braden, 71,4% apresentavam risco baixo, com
pontuação acima de 15 pontos, 23,8% risco moderado, com pontuação entre 13 e 14 e 4,8% risco alto com
pontuação abaixo 12 pontos. Constatou-se que os pacientes que obtiveram menores pontuações possuíam
como fatores determinantes o baixo nível de atividade física, provavelmente decorrente das suas patologias
limitantes como AVE e Fratura transtrocantérica, além de idade elevada e diabetes mellitus, quando compa-
rados aos idosos com risco brando. Conclusão: Apesar do pouco tempo de internação foi constatado que pa-
cientes acima de 60 anos, que possuem patologias limitantes e que realizavam pouca atividade física possuem
maior risco de desenvolverem lesão por pressão em ambiente hospitalar.

Palavras-chave: Lesão por pressão, Avaliação, Prevenção.

120 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A IMPORTÂNCIA DOS “MIL DIAS DE OURO” NO ÂMBITO DO PLENO DESENVOLVI-


MENTO DA CRIANÇA, UMA ABORDAGEM EM UMA COMUNIDADE REMANESCENTE
QUILOMBOLA NO INTERIOR DA AMAZÔNIA.

Matheus Fernando Borges, Edilson Santos Silva Filho, David Sanches Figueiredo Viana, Josiane Lilian de
Sousa Lima, Orestes Gastão de Toledo Bozza Neto, Nicole Guedes Barros e Tayrone Nayara Soares de Oli-
veira
matheusborgesb@hotmail.com
Universidade do Estado do Pará - UEPA

Resumo: INTRODUÇÃO: Os chamados “mil dias de ouro” correspondem aos 270 dias da gestação acrescidos
dos 730 dias referentes aos dois primeiros anos de vida de uma criança. Trata-se do período mais determinante
no que tange ao crescimento e ao desenvolvimento do ser humano, devendo ser cercado dos mais pontuais
cuidados em saúde. Dado o isolamento geográfico e o precário acesso à informação por parte das comunidades
remanescentes quilombolas, decidiu-se pela elaboração do projeto de extensão com o intuito de melhorar o
panorama da saúde e o acompanhamento do desenvolvimento infantil dessa população. OBJETIVO DO ES-
TUDO: Promover educação em saúde e conscientização a respeito da importância dos “mil dias de ouro” em
relação ao pleno desenvolvimento físico, emocional e psicossocial das crianças. METODOLOGIA: Trata-se
do relato de experiência da ação intitulada “Mil Dias de Ouro”, realizada no dia 22 de março de 2018 na UBSF
Quilombo Tiningu, localizada no município de Santarém-PA, sob orientação do médico responsável pela
unidade, com notável experiência em saúde de família. Em par com os agentes comunitários de saúde locais,
solicitou-se a presença de todas as gestantes e mães de filhos menores de 2 anos moradoras da comunidade.
Reunidas em uma sala da UBSF e sob a forma de conversa interativa, as participantes receberam orientações
gerais sobre os mais diversos temas relacionados, com enfoque especial para a o aleitamento materno, a transi-
ção alimentar e o acompanhamento dos marcos do desenvolvimento infantil. Ao final do diálogo, todas foram
convidadas a responderem a um breve questionário a fim de que se obtivesse a fixação dos principais pontos
da temática, depois do que houve resolução conjunta das questões e sorteio de brindes. RESULTADOS: Ob-
teve-se uma participação voluntária e integral do grupo durante toda a ação, com perceptível receptividade às
orientações dispensadas pelos acadêmicos envolvidos no diálogo. Foram tecidos numerosos questionamentos,
relatos de experiência e sugestões práticas por parte das participantes, prenunciando uma grande melhoria no
que diz respeito ao acompanhamento infantil durante os chamados “mil dias de ouro”. CONCLUSÃO: A
atenção primária em saúde é um espaço prioritário de atenção social, atuando de forma privilegiada junto à
comunidade na determinação de melhorias na qualidade de vida da população. É em face de projetos como o
acima descrito que os órgãos de saúde podem melhor se fazer sentir presentes, auxiliando na estruturação do
atendimento primário, na redução de gastos hospitalares futuros e no bem-estar da comunidade como um todo.

Palavras-chave: Pediatria,Prevenção,Educação

121 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ASPECTOS EPIDEMIOLÓGICOS DA MALÁRIA NO ESTADO DO PARÁ NO PERÓIODO


DE 2015 A 2017

João Portela Azevedo, Karina Mafra Parente, Francisca Limeira Gomes, Alessandro Sousa Pinto, Jessica
Maiany Silva, Jéssica Pena Silva, Leonardo Freitas Viana e Antenor Matos Junior
portelasantarem@gmail.com
Faculdade da Amazônia - UNAMA

Resumo: INTRODUÇÃO: A maláriahumanaé uma doença infecciosa, febril aguda, causada por cinco espé-
cies protozoários do gênero Plasmódio, transmitida ao homem por mosquitos do gênero Anopheles. A malária
tem tratamento e cura, mas pode evoluir para a forma grave e para o óbito, caso o paciente não receba o diag-
nóstico oportunamente e o tratamento adequado. Atualmente no Brasil, em 2017, foram registrados 193.863
casos positivos de malária. A maioria dos casos de malária no Brasil está concentrado na região Amazônica. O
Amazonas (81.302 casos), Pará (36.826 casos), Acre (36.728 casos), Amapá (15.505 casos), Roraima (14.074
casos) e Rondônia (7.809 casos), foram os Estados que mais registram casos de malária neste ano de 2017.
OBJETIVO: descrever os aspectos epidemiológicos da malária no Pará no período de 2015 a 2017. METO-
DOLOGIA: O estudo é do tipo epidemiológico transversal descritivo, retrospectivo de abordagem quantitati-
va. RESULTADOS: foram registrados em 2015 no Pará, 9.389 casos de malária, sendo 6.950 autóctones (do
próprio Pará); em 2016, foram registrados 14.495 casos, sendo 11.680 autóctones; e em 2017, foram registra-
dos 36.826 casos positivos de malária, sendo 31.477 casos autóctones. DISCUSSÃO: no período 2015 a 2017
ocorreu um aumento expressivo no registro de casos autóctones de malária no Pará correspondente a 452,9%.
A malária não se distribui de forma homogênea no Estado, está concentrada, principalmente, nos municípios
da Ilha do Marajó, que contribuem com mais de 60% de toda a malária registrada no Pará, em 2017. A espécie
que mais causou malária em 2017 foi, predominantemente, o Plasmodium vivax com mais de 95% em rela-
ção ao Plasmodium. falciparum e infecção conjunta destas espécies referidas. CONSIDERAÇÕES FINAIS:
ocorreu elevação dos casos de malária no período em estudo, na ordem de 452%. Em 2017 a maioria dos
casos encontram-se concentrados nos municípios da Ilha do Marajó, em mais de 60%. Diante dos resultados
encontrados, ressalta-se que se faz necessário um serviço de vigilância mais eficiente e de detecção de casos
precocemente, com disponibilidade de tratamento imediato e gratuito nas áreas onde ocorrem a malária. Pa-
lavras-Chave: Epidemiologia, malária, prevenção, vigilância.

Palavras-chave: Epidemiologia,malária,prevenção,vigilância

122 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A ESCOLA NA ERA DIGITAL: GAMIFICAÇÃO COMO METODOLOGIA ATIVA EM SALA


DE AULA

Emanuella Rebelo Camargo e Beatriz Santos Oliveira


manu_stm06@hotmail.com
Universidade Federal do Oeste do Pará - UFOPA

Resumo: Sabe-se que o surgimento das tecnologias provocaram significativas mudanças nos espaços sociais
e principalmente nos espaços educacionais onde ferramentas tradicionais utilizadas nas escolas aos poucos
foram sendo substituídas pelas Tecnologias de Informação e Comunicação (Tic’s). Atualmente não se discute
se a escola deve ou não utilizar a tecnologia como ferramenta educacional, pois já é uma realidade em seu
contexto. A questão a ser debatida é como usar essas novas tecnologias de forma eficiente e proveitosa de
forma a despertar no aluno interesse e possibilitar uma forma de aprendizagem diferenciada e motivadora.
O presente trabalho busca refletir sobre o papel da escola em meio a era digital e como a gamificação como
exemplo de metodologia ativa pode contribuir para um aprendizado inovador dentro da sala de aula. O uso
de metodologias diferenciadas em sala de aula, podem contribuir para a mudança da forma convencional de
transmissão de conteúdo e facilitar a aprendizagem do aluno. As metodologias ativas podem ser entendidas
como uma concepção educacional que coloca o aluno como principal agente de seu aprendizado, ou seja, o
aluno de maneira ativa desenvolve competências e habilidades. A gamificação e o uso de jogos digitais como
metodologias ativas, colocam o aluno como protagonista e responsável pelo seu processo de aprendizagem.
Em termos educacionais, o uso de uma proposta que inclui problemas e desafios em uma perspectiva de jogos
e, dessa forma, tende a promover entretenimento, engajamento, motivação, entre outros aspectos, pode ser
interessante em uma sociedade na qual muitos jovens estão envolvidos com jogos digitais. Contudo, apesar
dos benefícios apontados, alguns questionamentos têm sido levantados, como, por exemplo, em relação à
prática constante de recompensas que podem provocar certo condicionamento por prêmios do que a satisfação
do querer aprender. Para evitar esses esses aspectos negativos, como desafios pedagógicos nesta era digital, a
escola e os professores devem estar preparados para mudanças cada vez mais gradativas adequando-se para
receber os alunos imersos nessa cultura. Concluímos que a inserção de jogos gamificados em sala de aula,
além de trazer benefícios promove a socialização e integração dos alunos, contribuindo para o processo ensino
e aprendizagem, trazendo para a sala de aula, não somente o professor como detentor do conhecimento, mas
o próprio aluno.

Palavras-chave: gamificação,metodologia ativa,aprendizado

123 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

HANSENÍASE: DIFICIL DIAGNÓSTICO

Taiana Cristina Alves Canto, Ederly Santos Silva , Luziele Miranda De Miranda e Josivânia de Almeida
Lima
mirandaluziele@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: A hanseníase é uma doença crônica granulomatosa causada pelo bacilo de Hansen, o Mycobacteriun
leprae, descoberto pelo cientista norueguês Gerhard Amauer Hansen. A maior incidência é registrada nos
países subdesenvolvidos, sendo que o Brasil está entre aqueles com maior número de casos. A doença pode
ser classificada em paucibacilar de 1 a 5 manchas não contagiosa, e multibacilar de 6 ou mais manchas, conta-
giosa. Essa patologia, é caracterizada por lesões na pele esbranquiçadas ou avermelhadas com diminuição ou
perda de sensibilidade, acometimento dos nervos periféricos, edemas e nódulos. O objetivo deste trabalho foi
descrever as dificuldades do diagnóstico para uma detecção precoce da hanseníase. Para localizar, selecionar
e sintetizar as informações obtidas nessa revisão de literatura, procedeu-se uma busca sistemática por meio
da consulta aos indexadores de pesquisa nas bases de dados eletrônicos: Google acadêmico, Livros e Scielo.
O levantamento foi realizado com os seguintes descritores: Hanseníase, Técnicas, Diagnostico. Foram defi-
nidos como critérios de inclusão: artigos de revisão, editoriais e artigos originais, realizados e publicados em
periódicos, não havendo restrição a data de publicação. A escassez de sintomas no início da doença, contribui
para o difícil diagnóstico, ao qual a doença pode ser detectada tardiamente, além dos erros no diagnóstico ou
subdiagnóstico. As técnicas descritas para o diagnóstico clínico são: anamnese, dermatoneurológico, prova
histamina, prova pilocarpina e o exame de baciloscopia, sendo que este último é o exame mais útil no diag-
nóstico da hanseníase, pois o mesmo é de execução simples e baixo custo, porém, necessita de laboratório e
de profissionais treinados. A baciloscopia, quando positiva, demonstra diretamente a presença do M. leprae,
no entanto, a baciloscopia negativa não afasta o diagnóstico para a hanseníase, já que o período de incubação
da doença é longo e seus sintomas insidiosos, associados ao despreparo técnico dos profissionais de saúde, que
favorecem às dificuldades no diagnóstico dos casos iniciais, bem como de casos mais avançando.

Palavras-chave: Hanseníase,Dificuldades,Diagnóstico

124 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ESTUDO EPIDEMIOLÓGICO DOS CASOS DE DENGUE NO MUNICIPIO DE ITAITUBA,


ESTADO DO PARÁ, BRASIL

Sâmara Oliveira Almeida e Jossehan Galúcio da Frota


samaraoliveiraalmeida22@gmail.com
Faculdade de Itaituba - FAI e Secretaria Municipal de Saúde - e SEMSA2 e Faculdade de Itaituba - e FAI3
1

Resumo: A dengue tem se tornado um problema de saúde pública no Brasil em consequência do crescente
número de casos notificados da doença. É caracterizada como uma doença infecciosa de curso agudo, de ori-
gem viral da família flaviviridaeetransmitida pela picada do mosquito Aedes aegypti. Esse estudo tem como
objetivo conhecer o número de casos positivos da dengue no Município de Itaituba, além de descrever o perfil
epidemiológico (faixa etária, sexo e evolução dos casos)entre os anos de 2010 a 2016. O Município de Itaituba
localiza-se no Estado do Pará. Os dados foram obtidos do Sistema de Informação de Agravos de Notificação.
Foram coletados dados sobre o número total de casos de pessoas infectadas, a faixa etária, o sexo e a evolução
desses casos. Foram diagnosticados nesse estudo 1.554 casos positivos, com o menor índice no ano de 2014
com 29 casos e maior índice no ano de 2010 com 484 (31,1%) casos. A faixa etária predominante registrada
foi entre 20 a 39 anos 39,6%. As mulheres foram as mais acometidas com 53,8% dos casos e os homens com
46,2%. Durante esse período todos os casos evoluíram para a cura, não sendo registrado nenhum óbito em
decorrência dessa doença. Todos os casos notificados da dengue evoluíram para a cura, não sendo registrado
óbito entre o ano de 2010 e 2016. Esses resultados auxiliam a vigilância epidemiológica do município na pre-
venção e combate efetivo de novas ocorrências, e indicam ainda a necessidade de fazer o acompanhamento
dos sorotipos circulantes. A vigilância da doença e de suas complicações constitui uma ferramenta importante
na comparação e avaliação das medidas de controle utilizadas pelo setor de endemias, fornecendo informações
para possíveis alterações e maneira como a doença é encarada no município. Acabar com a dengue não é uma
tarefa individual, e sim uma ação coletiva. Necessita de um trabalho intersetorial para atingir os objetivos
propostos para o seu enfrentamento.

Palavras-chave: Dengue,Aedes aegypti,Itaituba

125 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

QUERATOCISTO ODONTOGÊNICO

Gabriel Zwink, Danillo Emanoel Riker Campos, Thayane Magalhães de Oliveira Birro, Letícia Cunha
Aguiar, Karine Rodrigues do Nascimento, Jaqueline Maria Cunha Portela, Verena Pereira Maia Miranda e
Daniel Berreta Moreira Alves
samaraoliveiraalmeida22@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: O queratocisto odontogênico é de um cisto de desenvolvimento que acomete somente o complexo


maxiliomandibular, correspondendo cerca de 5,4 a 18,7% de todos os cistos odontogênicos. Ocorre principal-
mente na região posterior da mandíbula e frequentemente está associado a um dente incluso. Esta lesão de-
senvolve-se em um curso assintomático provocando extensa reabsorção óssea antes de ser diagnosticada. Os
aspectos clínicos manifestam-se com aumento de volume na região afetada, e, radiograficamente é percebida
uma imagem radiolúcida ou multiloculada. O objetivo deste trabalho é relatar um caso de queratocisto odon-
togênico e realizar uma breve revisão de literária sobre o assunto, utilizando como metodologia a pesquisa
sobre o tema em artigos científicos e obras da área odontológica. As características histopatológicas estão bem
definidas e são fundamentais para um correto diagnóstico, na microscopia, o QO, apresenta um forro estreito,
uniforme e corrugado, do tipo pavimentoso estratificado paraqueratinizado, com 6 a 10 camadas sobrepostas.
Radiograficamente, apresenta-se com uma radiotransparência bem evidente com margens regulares e limites
radiopacos delgados, em lesões maiores é comum serem vistas multiloculações. O tratamento procede por
intervenção cirúrgica, que pode estar associada a cauterização com agentes químicos, osteotomia periférica,
curetagem ou marsupialização. O caso do presente estudo refere-se a uma paciente, sexo feminino, 22 anos,
encaminhada do município de Uruará para realização de exame por tomografia computadorizada na cidade
de Santarém, onde foi identificado uma lesão na região anterior da mandíbula, com presença de imagem hi-
podensa, bem delimitada, de aspecto cístico. Após os exames de imagens a paciente foi submetida ao proce-
dimento de biópsia na lesão encontrada, o exame histopatológico realizado na paciente evidenciou múltiplos
fragmentos provenientes de curetagem revestidos por epitélio odontogênico semelhante com os aspectos de
queratocisto odontogênico. Além disso, foi possível notar também intenso infiltração inflamatória crônica
atingindo a cápsula fibrosa. Por meio desde foi possível confirmar a presença de um queratocisto odontogê-
nico através das características histopatológicas. O tratamento procedeu por curetagem e marsuprialização,
após os procedimentos terapêuticos observou-se por novos exames de imagens que houve crescimento ósseo
enfatizando que a lesão regrediu.

Palavras-chave: Queratocisto Odontogênico,Reabsorção Óssea,Cisto Odontogênico

126 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PERCEPÇÕES E CAPACITAÇÃO DE AGENTES COMUNITÁRIOS DE SAÚDE EM SUPOR-


TE BÁSICO DE VIDA PARA ATUAÇÃO NA COMUNIDADE

Domingas Machado da Silva, Antenor Matos de Carvalho Junior, Eloane Hadassa de Sousa Nascimento e
Sâmella Silva de Oliveira
enfadomingassilva@gmail.com
UNIVERSIDADE FEDERALDO OESTE DO PARÀ - UFOPA1, Universidade Federal do Pará - , UFPA2,
UNIVERSIDADE DA AMAZONIA - , UNAMA3 e Universidade do Estado do Amazonas - e UEA4

Resumo: A Parada Cardiorrespiratória - PCR é uma Emergência Clínica, sendo que o Suporte Básico de Vida
em Ressuscitação Cardiopulmonar imediato visa preservar a vida, restabelecer a saúde, aliviar o sofrimento
e diminuir incapacidades, tal procedimento é prioritário para os profissionais de saúde, como o Agente Co-
munitário de Saúde - ACS que faz parte de um sistema essencial para a saúde da população, uma vez que
sua atuação é na comunidade. O presente estudo propôs identificar as percepções e capacitações de Agentes
Comunitários de Saúde em Suporte Básico de Vida para atuação na Comunidade. Trata-se de uma pesquisa
descritiva, do tipo exploratório, com abordagem qualitativa, realizada por meio da aplicação de um questio-
nário semiestruturado à 8 ACS de uma Unidade de Atenção Primária à Saúde, localizada no Município de
Santarém - Pará. As percepções encontradas foram delineadas de elementos perceptíveis sendo: O desafio da
formação de vínculo entre o profissional ACS e a comunidade. A aceitação do ACS pela comunidade, as con-
dições ideais para desempenhar suas atividades (materiais adequados), almejam capacitações mais frequentes
e sentem a necessidade de realização de trabalhos acadêmicos mais intensos na comunidade.

Palavras-chave: Capacitação,Agente Comunitário de Saúde,Suporte Básico de Vida

127 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A IMPORTÂNCIA DA LIGA ACADÊMICA DE URGÊNCIA E EMERGÊNCIA NA MELHO-


RIA DO ATENDIMENTO EM SAÚDE DA POPULAÇÃO DE UM MUNICÍPIO NO INTERIOR
DA AMAZÔNIA, UM RELATO DE EXPERIÊNCIA.

Matheus Fernando Borges, David Sanches Figueiredo Viana, Edilson Santos Silva Filho, Newton Lauer,
Igor Rafael Silva Sarmento, Grace Kelly Guimarães, Rodrigo Ruan Costa de Matos e Adriane Cristina Viei-
ra dos Santos
matheusborgesb@hotmail.com
Universidade do Estado do Pará - UEPA

Resumo: INTRODUÇÃO: As ligas acadêmicas são projetos de formação complementar embasados no tripé
acadêmico composto por ensino, pesquisa e extensão. A Liga Acadêmica de Urgência e Emergência do Oeste
do Pará (LAUEP) é uma equipe composta por acadêmicos do curso de medicina da Universidade do Estado
do Pará (UEPA) e sob atual supervisão do Dr. Carlos Alberto Sinimbú de Carvalho. Atualmente ela dispõe de
21 ligantes ativos, eleitos por processo seletivo, aos quais são disponibilizadas aulas teórico-práticas, eventos
temáticos, estágios hospitalares e projetos extensivistas que intentam melhor preparar os alunos para os desa-
fios da terapia intensiva. OBJETIVO DO ESTUDO: Demostrar o impacto da Liga de Urgência e Emergência
na maior capacitação do atendimento médico em uma cidade no interior da Amazônia. METODOLOGIA:
Estudo do tipo relato de experiência, formulado com base nas atividades da Liga de Urgência e Emergência
no primeiro semestre do ano letivo de 2018. Em par com o princípio universitário do ensino, a Liga possui um
calendário de aulas teórico-práticas com o intuito de revisar os principais temas em urgência e emergência,
dada a seriedade e complexidade da temática no âmbito da prática médica. Outro componente fundamental da
formação complementar, os estágios são frutos da parceria entre a UEPA e o Hospital Municipal de Santarém,
com disponibilização de vagas na Sala de Reanimação e na Sala de Sutura, sob supervisão voluntária dos pro-
fessores orientadores implicados na colaboração com a Liga Acadêmica. Por último, há o planejamento para
um projeto de Campus Avançado ainda no ano letivo de 2018, embasado no espírito de intervenção social que
permeia a equipe que compõe a LAUEP. RESULTADOS: Observou-se participação entusiasmada dos ligantes
no decorrer do semestre, com a realização de anamneses, exames físicos, procedimentos supervisionados e
discussão interativa de casos clínicos no decorrer dos estágios. Os benefícios implicados vão desde a maior
atenção em saúde prestada à população usuária dos serviços públicos até ao notório acúmulo de experiências
por parte dos estudantes implicados. CONCLUSÃO: A LAUEP exerce papel fundamental na melhoria do
atendimento público em saúde da região, na medida em que disponibiliza aos acadêmicos de medicina do
município a possibilidade de assimilação teórico-prática das principais temáticas que envolvem a terapia
intensiva, com enfoque especial para a humanização da relação médico-paciente. De fato, a melhoria no de-
senvolvimento estudantil no âmbito da formação médica prenuncia com segurança um considerável impacto
na qualidade dos serviços públicos em saúde prestados em toda a região.

Palavras-chave: Urgência e Emergência,Formação Complementar,Saúde Pública

128 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

O DESENCADEAMENTO DA SÍNDROME DE REYE

Jaiane Cristina dos Santos Nascimento, Juliete Alcantara Silva e Andréa de Sousa Costa
jaianenasci94@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: A Síndrome de Reye é uma condição caracterizada por encefalopatia não inflamatória aguda e in-
suficiência hepática, fazendo com que este órgão não trabalhe corretamente, deixando substâncias químicas
prejudiciais acumularem no sangue. Por sua vez, essas substâncias afetam diretamente o cérebro, aumentando
a pressão dentro do mesmo, sua causa é desconhecida, mas alguns casos parecem acompanhar infecções por
influenza A, B ou varicela associado ao uso de salicilatos (geralmente ácido acetilsalicílico), aumentando 35
vezes o risco. A hipótese mais provável é que esteja associada a uma disfunção mitocondrial que resulte em
inibição da fosforilação oxidativa e beta oxidação dos ácidos graxos, as principais anormalidades encontradas
nos exames são séricos e hipoglicemia (WEINER, 2012). O estudo objetiva descrever a sintomatologia da
síndrome de Reye, para se tomar a conduta adequada mediante os sintomas, pois ela é facilmente confundida
com outras patologias, o que pode resultar em óbitos. Para realização da pesquisa foi realizada uma análise
qualitativa através de pesquisa bibliográfica na biblioteca virtual de saúde e com busca na base de dados LI-
LACS e SCIELO, referente ao desencadeamento e manifestações clínicas, foram excluídas aquelas que não
contemplavam a temática envolvida, a pesquisa incluiu artigos originais, de revisão, diretrizes e protocolos
escritos na língua portuguesa. A síndrome de Reye afeta crianças e adolescentes de 4 a 12 anos, a incidência
das doenças em adultos é algo raríssimo, mas que pode acontecer. Em crianças com menos de 2 anos, os pri-
meiros sinais podem incluir diarreia e respiração rápida já nas crianças mais velhas e adolescentes, os sinais
e sintomas mais precoces são vômitos persistentes, sonolência ou letargia incomuns. Posteriormente, surgem
comportamento irritável agressivos ou irracional, confusão mental, desorientação e/ou alucinações, fraqueza
ou paralisia de braços e pernas, convulsões, letargia excessiva e diminuição do nível de consciência. Devido
a semelhança dos sintomas ela pode ser facilmente confundida com meningites, diabetes, overdose de drogas
ou envenenamentos, é importante que o diagnóstico e o tratamento sejam iniciados imediatamente após os
primeiros sintomas da doença. Como esta patologia acomete principalmente crianças em fase de desenvolvi-
mento, é de suma importância investigar o agravamento de algumas infecções virais, que aparentemente são
simples e levam os pais/responsáveis a prática da automedicação, assim prorrogando a descoberta da síndrome
em questão, podendo lesar órgãos vitais e causar até a morte.

Palavras-chave: Síndrome de Reye, sintomatologia, desenvolvimento.

129 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A UTILIZAÇÃO DE SIMULAÇÃO COMO METODOLOGIA DE ENSINO NA PERCEPÇÃO


DE MONITORAS DE LABORATÓRIO DE ENFERMAGEM.

Jaiane Cristina dos Santos Nascimento, Juliete Alcantara Silva, Mirna Brito Malcher Pedroso e Naiara
Barroso da Conceicao
jaianenasci94@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: Uma fase importante na formação acadêmica é a utilização da simulação das práticas no laboratório
como requisito para a prática hospitalar. Na enfermagem a simulação tem sido uma modalidade de ensino uti-
lizada já há algum tempo, sob a forma de manequins estáticos, manequins de ressuscitação, cenários clínicos,
estudos de caso, entre outras técnicas (Sanford, 2010). O estudo teve como objetivo apresentar os benefícios
da utilização da simulação em práticas no laboratório de enfermagem. Trata-se de um relato de experiência,
realizado a partir da percepção de três monitoras sobre a utilização de simulação como metodologia de ensino
no curso de Enfermagem do Instituto Esperança de Ensino Superior-IESPES na cidade de Santarém-Pará. O
processo de monitoria e acompanhamento das simulações ocorreu no período de março a junho de 2017, no
qual as monitoras relatam que a utilização da simulação favoreceu o desenvolvimento da autoconfiança no
aluno frente às práticas que ele irá desenvolver ao adentrar no campo hospitalar, relatam ainda que os alunos
mostram-se apreensivos e inseguros inicialmente, porém com a repetição simulada obtiveram a segurança ne-
cessária, passando por avaliações posteriores. Dentre os aspectos negativos relatam a dispersão em conversas
paralelas e a utilização do celular no momento da prática simulada. Quanto à importância da simulação, todas
relatam que é perceptível a melhora psicomotora do graduando no decorrer das monitorias, ressaltando desta
forma o quão é importante para a qualidade do serviço prestado ao paciente a utilização da simulação como
base na formação acadêmica, visto que neste momento o graduando percebe os erros que jamais poderá co-
meter na prática hospitalar. Conclui-se quea aplicação da simulação como metodologia de ensino na enferma-
gem, favorece uma postura proativa e segura dos discentes, elevando sua capacidade de decisão e garantindo
segurança no ambiente de trabalho. O estudo corrobora com contribuições de Hawkins et al., (2008), os quais
afirmam que a simulação é apontada como uma excelente estratégia para a aprendizagem experimental, crian-
do oportunidades para a prática de resolução de problemas e desenvolvimento de competências psicomotoras,
num ambiente seguro e controlado.

Palavras-chave: Simulação. Enfermagem. Monitoria.

130 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

RELATO DE UMA INTERAÇÃO SOCIAL NO ASSENTAMENTO AGROEXTRATIVISTA DA


COMUNIDADE PONTE ALTA, REGIÃO DO EIXO FORTE – MUNICÍPIO DE SANTARÉM

Gustavo da Silva Flexa e WILSON SABINO


gustavoflexa_13@hotmail.com
Instituto Esperança de Ensino Superior - IESPES1 e Universidade Federal do Oeste do Pará - e UFOPA2

Resumo: O presente relato tem seu foco na experiência de vida das famílias da Comunidade de Ponte Alta,
do Munícipio de Santarém, Estado do Pará. Este trabalho teve como método de pesquisa a entrevista com os
comunitários, a fim de se adquirir dados que proporcionem o alcance de nosso objetivo: relatar a experiência
de uma interação social no assentamento agroextrativista da comunidade acima descrita. O relato descritivo e
reflexivo foi utilizado após a coleta de dados, acompanhada de observação e aproximação da realidade vivida
pelas pessoas em foco, onde pudemos aprender a ouvir os participantes e conhecer as histórias locais. A rele-
vância desta interferência justifica-se pela importância de aprender a ouvir lideres, famílias, etc. para que, a
partir deste conhecimento, seja possível pensar-se em novas estratégias ou reforçar e aprimorar as já existentes
que possam criar ou reforçar métodos inerentes às práticas de saúde na comunidade. No decorrer dos encon-
tros, através das conversas e do contato com o ambiente familiar estabeleceu-se um vínculo afetivo entre os
sujeitos, onde buscamos ouvir e compreender melhor as peculiaridades de vida de cada um. Esta experiência
proporcionou, como resultado, a transformação de nossa maneira de pensar, agir e até mesmo de como nos
portar diante dos estudos, reconsiderando a maneira de viver e atuar na área da saúde.

Palavras-chave: aproximação,ouvir,saúde,comunidade

131 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PROGRAMAÇÃO NEUROLINGUÍSTICA APLICADA AO ENSINO E A APRENDIZAGEM

Raimundo Sátiro Dos Santos Ramos


satiroramos@gmail.com
Instituto Federal de Educação, Ciência e Tecnologia do Pará - IFPA

Resumo: Grande parte dos estudantes brasileiros possui algum tipo de dificuldade de aprendizagem, fato facil-
mente constatado em sala de aula pelos professores. Estes, por sua vez, muitas vezes não utilizam estratégias
eficientes de ensino para promover a aprendizagem dos alunos. Neste contexto, a programação neurolinguís-
tica através de suas técnicas e ferramentas, surge como opção para promover novas formas de ensino, bem
como fornecer aos estudantes novas formas para adquirirem um aprendizado eficaz. O objetivo geral deste
trabalho foi realizar uma revisão bibliográfica referente ao tema programação neurolinguística e sua aplicação
no ensino e aprendizagem, com o intuito de explicitar as potencialidades da aplicação da PNL na educação.
Especificamente, procurou-se analisar algumas técnicas e ferramentas da PNL, a saber: os níveis neurológi-
cos, os metaprogramas, o metamodelo de linguagem, os sistemas representacionais, a modelagem, o rapport,
as metáforas, as posições perceptuais e os mapas mentais e como eles podem contribuir tanto no processo de
ensino como o de aprendizagem. A pesquisa foi caracterizada como qualitativa, a coleta de dados para este
estudo abarcou análise e compilação bibliográfica. Para isso, foram pesquisadas teses, dissertações, mono-
grafias, artigos, livros, sites da internet, bem como documentos que possam estar relacionados aos objetivos
aqui explicitados. Foi utilizada a internet e bibliotecas físicas como fonte primeira de consulta. O período de
levantamento de dados compreendeu os meses de abril, maio junho, julho, agosto e setembro de 2017. As
técnicas e ferramentas da PNL utilizadas para este trabalho foram aquelas que mais apareceram na literatura
quando relacionou-se a PNL e sua aplicação no processo de ensino e aprendizagem, sendo esse o critério de
escolha. A programação neurolinguística através de suas diferentes técnicas e ferramentas pode ser aplicada
em diversas áreas do conhecimento, entre elas a educação. Nesta, pode ser muito útil no processo de ensino
e aprendizagem na educação profissional e tecnológica melhorando, sobretudo a comunicação interpessoal.
Como o foco maior da PNL está no como e não no que está sendo aprendido ou ensinado, pode ser aplicada
em qualquer disciplina curricular. Para isso, basta existir uma política de formação continuada de professores
que utilize a PNL como elemento inovador no processo educacional.

Palavras-chave: Programação neurolinguística,aprendizagem,Ensino

132 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

BRINCAR: EXPERIENCIA NECESSÁRIA PARA O DESENVOLVIMENTO INTEGRAL NA


INFÂNCIA

KÁREM LARISSA SOUSA PISA e DALCINEY DOS SANTOS BATISTA


larissasousapisa@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: O ser humano com um ser ludos traz na sua história a necessidade de viver experiências lúdicas as
quais são fundamentais para seu crescimento social, emocional, intelectual e cultural. Assim, o presente ar-
tigo tem como objetivo evidenciar a importância do brincar no desenvolvimento integral da criança, a partir
da prática pedagógica do professor. O referido trabalho é uma pesquisa bibliográfica. Portanto, foi utilizado
no referencial teórico os autores Craid, Kaecher e Silva (2001), Dohme (2003), Brasil(1998), Maluf(2007),
Santos(2008), Xabregas(2015) e Wajskop(2009). A coleta das informações sobre a temática se deu a partir dos
estudos destes autores. Eles mostram o conceito da importância do brincar no desenvolvimento do ser humano
desde a infância, clarificam sobre o lúdico infantil, detalham os estágios do brincar, evidenciam o jogo como
recurso rico no ensino e na aprendizagem das crianças e no processo de socialização, ressaltam o brinquedo e
a brincadeira como necessários a infância com ludicidade, e revelam o cuidado e a preocupação que o profes-
sor deve ter na escolha e preparo dos espaços onde ocorrem as brincadeiras com as crianças. Após realizada o
estudo bibliográfico constatou-se que o brincar precisa ser visto, tanto pelos professores quanto pela família,
como uma ação que deve acontecer com planejamento, seriedade e muita afetividade, lembrando sempre que
o foco principal desse processo é a criança.

Palavras-chave: Brincar, Desenvolvimento Integral, Criança

133 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PERFIL EPIDEMIOLÓGICO DAS PRINCIPAIS CAUSAS DE TRAUMA RAQUIMEDULAR


IDENTIFICADAS NAS DIFERENTES REGIÕES BRASILEIRAS

Lorena Iara Mota de Leão, Jaiane Cristina dos Santos Nascimento, Géssica Silva Sarmento e Marcos Fábio
Ribeiro de Abreu
lorenamleao@gmail.com
Instituto Esperança de Ensino Superior - IESPES1, Liga Acadêmica de Urgência e Emergência do Tapajós -
, LAUET2, Instituto Esperança de Ensino Superior - , IESPES3, Liga Acadêmica de Urgência e Emergência
do Tapajós - , LAUET4, Instituto Esperança de Ensino Superior - , IESPES5 e Liga Acadêmica de Urgência e
Emergência do Tapajós - e LAUET6 e Instituto Esperança de Ensino Superior - e IESPES7, Liga Acadêmica
de Urgência e Emergência do Tapajós - , LAUET8

Resumo: O trauma raquimedular (TRM) é a lesão de qualquer componente da coluna vertebral, associado à
lesão medular podendo causar danos neurológicos e problemas na parte motora, sensitiva, visceral e funções
sexuais do indivíduo. Essa lesão pode ser de origem traumática (acidentes automobilísticos, ferimentos por
arma de fogo, mergulho em águas rasas) ou não traumática (tumores, processos degenerativos ou compressi-
vos). No Brasil, estima-se 6.000 a 8.000 casos anualmente. Entretanto, o trauma não é de notificação compul-
sória, o que acarreta sua subnotificação (VIÚDES; COSTA; NUNES, 2015). O respectivo estudo teve como
objetivo apresentar os principais mecanismos do TRM. Realizou-se uma revisão de literatura com abordagem
exploratória, utilizando os bancos de dados SciELO, BVS e Google Acadêmico, cuja elaboração incluiu arti-
gos originais, de revisão e protocolos escritos em língua portuguesa. Foram excluídas da pesquisa produções
que não contemplassem a temática envolvida. Nos estudos brasileiros que retratam a ocorrência de casos em
hospitais ou centros de reabilitação é unânime que a maioria é de origem traumática (BRASIL, 2013). Na
cidade de Belém, segundo Pereira, Gomes e Rodrigues (2015), foram identificados 195 casos de TRM, dos
quais 9,7% foram causados por arma de fogo (FAF) e 90,7% não foram especificados na pesquisa. Viúdes,
Costa e Nunes (2015), em pesquisa realizada em Belo Horizonte, identificaram 8 casos, dos quais 50% fo-
ram por FAF, 37,5% por quedas e 12,5% por acidentes automobilísticos. Em Teresina, Lemos et al. (2017)
identificaram 66 casos sendo FAF (43,9%), acidentes automobilísticos (33,3%), quedas (6%), mergulho em
águas rasas (3%) e outros (13,6%). Veronezi (2016) identificou em Goiânia, 265 casos, sendo eles: 40,8% por
acidentes automobilísticos, 22,6% por FAF, 22,3% por quedas, 5,3% por atropelamento, 3% por agressões,
0,4% por mergulho em águas rasas, 4,9% por outras causas e 0,8% não foram identificados. Em Porto Alegre,
Frison et al. (2013) identificaram 40,4% de casos por quedas, 25,8% por acidentes automobilísticos, 4% por
FAF e 29,8% não identificados. A lesão medular é considerada um problema social relevante que afeta uma
parcela da população economicamente ativa. Sabe-se que os adultos jovens do gênero masculino são os mais
acometidos, em uma proporção de 4:1 (LEMOS et al., 2017). Observando-se os dados apresentados, é notório
o maior índice de TRM ocasionado por acidentes automobilísticos e ferimentos por armas de fogo. Diante
desse quadro, torna-se extremamente relevante a abordagem dessa temática, visto que o Brasil vivencia uma
fase em que a violência está cada vez mais presente.

Palavras-chave: Epidemiologia,Trauma raquimedular,Brasil

134 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

INTERCORRÊNCIAS NA GESTAÇÃO DAS MÃES DE CRIANÇAS COM ATRASOS NEURO-


MOTOR ATENDIDAS EM UM CENTRO DE REFERÊNCIA NO OESTE DO PARÁ

Greice Nara Viana dos Santos, Simone Aguiar da Silva Figueira , Greice Nivea Viana dos Santos, Samila de
Sousa Sales, Silvia Caroline de Sousa Aguiar, Isabella Clarissa Vasconcelos Rêgo, Rodrigues Ferreira de
Souza e Joseph Simões Ribeiro
greicenaraviana@gmail.com
Universidade do Estado do Amazonas - UEA1, Universidade do Estado do Pará - , UEPA2, Universidade
Federal do Oeste do Pará - , UFOPA3, Universidade do Estado do Pará - , UEPA4, Universidade do Estado
do Pará - , UEPA5, Universidade Federal do Oeste do Pará - , UFOPA6, Universidade do Estado do Amazo-
nas - , UEA7 e Universidade Federal do Oeste do Pará - e UFOPA8

Resumo: Introdução: A saúde da criança deve ser assistida preferencialmente desde o período pré-natal para
que se conheçam as prováveis condições de saúde da mesma e assim dar oportunidade de identificar inter-
venções resolutivas. Assegurar a plenitude do desenvolvimento infantil significa proporcionar ao indivíduo
as condições mínimas e essenciais para sua realização como ser humano. Objetivos: Identificar as principais
intercorrências ocorridas na gestação das mães das crianças com atrasos de desenvolvimento neuromotor. Me-
todologia: quantitativa, descritiva, retrospectiva, por meio de um levantamento estatístico documental, con-
tendo 192 prontuários de pacientes de 0-5 anos com diagnósticos de atraso neuromotor atendidas no Centro de
Referência de Saúde da Criança em Santarém-PA nos anos de 2010 a 2013. Critério de inclusão: As crianças
na faixa etária pré estabelecida e que possuíam os prontuários preservados. E exclusão: todos os prontuários
analisados que não contemplassem pacientes com atrasos no desenvolvimento neuromotor e que apresentas-
sem dados confusos e/ou incompreensíveis que inviabilizassem o seu uso apropriado. Resultados e discussão:
As intercorrências mais evidenciadas foram Infecção do Trato Urinário (ITU) 13,8%, seguida de sangramento
6,6% e Hipertensão Arterial sistêmica (HAS) 6,2%. O resultado total dessa amostra foi de 211 intercorrências
devido a identificação de mais de uma por mãe. As infecções por toxoplasmose 0,9% e citomegalovírus 0,5%,
mesmo não sendo dados de maior destaque, estão diretamente relacionadas aos atrasos detectados.Todas as
intercorrências que ocorreram durante a gravidez, tiveram relação direta com algum atraso neuromotor en-
contrado nas crianças. Apesar de todas as intercorrências nas gestações encontradas neste estudo e a grande
relação delas com os atrasos neuromotores presente nas crianças, encontrou-se um número elevado daquelas
que não apresentaram nenhuma intercorrência na gestação 26,1%, evidenciando dados positivos. Porém o
número de prontuários sem registros sobre esse dado foi elevado 25,6%, o que preocupa, uma vez que não
se sabe se as mãe das crianças com atrasos neuromotores apresentaram ou não alguma patologia durante o
período gestacional. Considerações finais: Destacou-se intercorrências gestacionais totalmente possíveis de
intervenção precoce e o enfermeiro ator que trabalha na prevenção, torna-se um profissional indispensável já
que acompanha essa criança durante seu desenvolver desde o pré-natal até seu desenvolvimento, favorecendo
possível tratamento e visando à cura materna e/ou prevenção da infecção fetal.

Palavras-chave: Intercorrência gestacional,Desenvolvimento infantil,Atraso Neuromotor

135 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ALTERAÇÕES POSTURAIS DE PACIENTES EM TRATAMENTO PARA NEOPLASIA MA-


MÁRIA: UMA REVISÃO DE LITERATURA

Djúlia Soraya Sena, Amanda Emanuele Correa, Fernanda de Araújo Oliveira, Matheus Eduardo Horta da
Costa e Iana Bruna Parente Cardoso
djuliasena@hotmail.com
Universidade do Estado do Pará - UEPA

Resumo: Introdução: O câncer de mama (CM) vem ocupando lugar de destaque por apresentar crescentes
índices de incidência e mortalidade principalmente entre as mulheres. Um dos tratamentos para a cura desse
tipo de neoplasia envolve a retira total ou parcial da mama. Dentre as consequências advindas dessa etapa
do tratamento destacamos as alterações posturais, cuja falta de intervenção eficaz e preventiva, pode resultar
em deformidades irreversíveis. Objetivo do Estudo: Por meio desta pesquisa busca-se através de uma revisão
das literaturas expor as principais alterações posturais advindas do CM e das terapêuticas envolvidas para
seu tratamento. Metodologia: Trata-se de um estudo descritivo de revisão bibliográfica realizado por meio
de um levantamento retrospectivo de artigos científicos pesquisados nas bases de dados: Pubmed (National
Library of Medicine National Institutes of Health), Scielo (Scientific Electronic Library) e Bireme (Portal de
Revistas Científicas em Ciências da Saúde). Os critérios de inclusão adotados foram os artigos em português
e inglês, publicados no período entre janeiro de 2009 e dezembro de 2017 e estarem relacionados com o tema
proposto. Os critérios de exclusão foram trabalhos incompletos e artigos com mais de 10 anos de publicação.
Resultados: Foram encontrados 17 trabalhos dentro da temática proposta, sendo 7 artigos nacionais, 6 inter-
nacionais e 3 artigos foram excluídos dessa pesquisa por apresentarem-se incompletos. No que concerne à
postura corporal as consequências do tratamento e a ausência do peso da mama contribuem negativamente na
biomecânica corporal das pacientes e podem gerar deformações irreversíveis se não forem tratadas a tempo.
As principais alterações posturais citadas são anteriorização da cabeça, protrusão de ombro, acentuação das
curvas da coluna (lordose e cifose), elevação do ombro e escápula para o lado operado, rotação da pelve e
inclinação da cabeça para o lado contralateral à cirurgia. Considerações finais: Modificações da postura de
pacientes em tratamento para CM são observadas desde o pré-operatório imediato, a origem dessas alterações
é explicada por diversos fatores desde questões psicológicas a ausência do peso da mama. É com base nessas
informações que a reabilitação torna-se crucial para a prevenção de futuros agravos e melhora da qualidade
de vida desses pacientes.

Palavras-chave: câncer, mama, alterações, postura.

136 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PERCEPÇÃO DOS PACIENTES QUE SOFRERAM AMPUTAÇÃO TRAUMÁTICA ACER-


CA DA ASSISTÊNCIA DE ENFERMAGEM EM UM HOSPITAL PÚBLICO DE SANTARÉM
PARÁ

Greice Nivea Viana dos Santos, Jessica Priscila da Silva Lima, Isabella Clarissa Vasconcelos Rêgo, Ander-
son da Silva Oliveira, Greice Nara Viana dos Santos, Soraia Baia dos Santos, Jociléia da Silva Bezerra e
Adriene Silva Freire
greicenivea@gmail.com
Universidade Federal do Oeste do Pará - UFOPA1, Universidade do Estado do Pará - , UEPA2, Universi-
dade Federal do Oeste do Pará - , UFOPA3, Universidade do Estado do Pará - , UEPA4, Universidade do
Estado do Amazonas - , UEA5, UNIVERSIDADE FEDERALDO OESTE DO PARÀ - , UFOPA6, Instituto Es-
perança de Ensino Superior - , IESPES7 e Universidade do Estado do Pará - e UEPA8

Resumo: Introdução: O trauma ortopédico é considerado um problema se saúde pública e tem sido umas das
condições mais mórbidas existentes nos dias atuais. Ele gera incapacidade funcional, temporária ou permanen-
te, que impõe dificuldades aos indivíduos e familiares, provocando um custo social agregado a esta limitação.
O enfermeiro como profissional de saúde, geralmente está presente no momento do acolhimento do indivíduo
de trauma ortopédico, presenciando o momento o qual o mesmo vivencia no processo da assistência. Logo,
através dessa aproximação o profissional acaba vivenciando momentos difíceis dos indivíduos, que por conse-
quência de um trauma, tiveram seus membros amputados. Objetivo: Este trabalho tem como principal objetivo
conhecer a percepção do paciente que vivenciou o processo de amputação por trauma ortopédico acerca da
assistência de enfermagem prestada durante o período de internação no Hospital público de Santarém Pará.
Metodologia: Trata-se de um estudo qualitativo, de campo e descritivo. Foi realizada uma entrevista semi
estruturada com os 05 pacientes. O presente estudo baseou-se na Resolução 466/2012 da Comissão Nacional
de Ética em Pesquisa (BRASIL, 2012). O projeto seguiu com entrada no Comitê de ética e Pesquisa – CEP /
UEPA e obteve parecer aprovação: 1100529. Resultados e Discussão: O estudo comprovou que a amputação
de membros é um acontecimento que muda completamente a vida do indivíduo e que acarreta em frustações
durante o período de internação e a vivência da perda de um membro. Em relação a equipe de enfermagem,
observou-se que os indivíduos amputados tiveram a percepção positiva acerca dos cuidados recebidos pelos
profissionais, bem como tiveram relatos de insatisfação acerca dos cuidados prestados. Considerações finais:
É importante conhecer a percepção dos indivíduos acerca da assistência de enfermagem e levar em considera-
ção, a importância da relação humana e não somente a relação profissional/paciente relacionado a vivência da
amputação como consequência do trauma ortopédico. Assim, percebe-se que há uma necessidade de um olhar
holístico e escuta acolhedora por parte do profissional de enfermagem.

Palavras-chave: Ortopedia,Enfermagem,Amputação traumática

137 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PERFIL CLINICO-FUNCIONAL E RISCO CARDIOVASCULAR EM PACIENTES HEMIPA-


RÉTICOS PÓS-AVE

Adjanny Estela Santos de Souza , DIEGO SARMENTO DE SOUSA e ALEXANDRINA FURTADO DE AMO-
RIM SILVA
adjannyestela@hotmail.com
UNIVERSIDADE DO ESTADO DO PARÁ - UEPA

Resumo: Introdução: O Acidente Vascular Encefálico (AVE) é a principal causa de incapacidade física entre
populações adultas, e o indivíduo, torna-se dependente de cuidados de terapeutas, levando a comprometimen-
tos da função motora, cognitiva, sensorial, psicológica e social. Objetivo(s): O objetivo desse estudo foi iden-
tificar o risco cardiovascular e o perfil clinico-funcional em pacientes hemiparéticos pós-AVE. Metodologia:
Trata-se de um estudo epidemiológico do tipo descritivo-transversal, realizado com pacientes com diagnóstico
de AVE em Santarém, no ano de 2016. Foram selecionados para compor a amostra, 9 pacientes, dos quais
foi realizada avaliação antropométrica, cardiorrespiratória, dosagens bioquímicas, independência funcional,
perfil de atividade humana, características clinicas, e uma entrevista para caracterização das demais variáveis
independentes (fatores de risco). Com base nessas informações, foram estimadas o risco cardiovascular dos
participantes através dos escores Framingham e da Michigan Heart Association. Resultados: Observou-se que
apenas um paciente encontrava-se obeso, e apenas 3 levemente acima do peso. 5 dos participantes tiveram
AVE isquêmico sendo que 4 acometendo o lado direito e apenas 1 o lado esquerdo, 4 participantes sofreram
AVE hemorrágico, sendo 3 acometendo o lado direito e apenas 1 o lado esquerdo, comprometendo assim o
desenvolvimento de suas atividades, já que as lesões quase sempre ocorrem no lado dominante. Considerações
finais: Evidenciou-se a necessidade de mudança no protocolo de atendimento do paciente hemiparético, sendo
ele hospitalar ou ambulatorial, buscando o retorno total, ou parcial de sua independência nas atividades diárias
e sociais.

Palavras-chave: Hemiparesia,Risco cardiovascular,Acidente vascular encefálico

138 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

INVESTIGAÇÃO DE FATORES DE RISCO PARA DOENÇA ARTERIAL CORONARIANA


(DAC) EM PACIENTES ATENDIDOS EM UNIDADES DE SAÚDE (US) NO MUNICÍPIO DE
SANTARÉM-PA SEGUNDO O ESCORE DE FRAMINGHAN E INCIDÊNCIA DE SÍNDROME
METABÓLICA

Adjanny Estela Santos de Souza , NATHALIA THAIS DA SILVA PORTUGAL, ANA PAULA LEMOS ARAÚ-
JO e DANYELLE SARMENTO COSTA
adjannyestela@hotmail.com
UNIVERSIDADE DO ESTADO DO PARÁ - UEPA

Resumo: Introdução: As doenças cardiovasculares são as principais causas de morbidade e mortalidade no


Brasil e no mundo. Objetivo(s): Investigar fatores de risco para Doença Arterial Coronariana (DAC) em pa-
cientes atendidos em Unidades de Saúde (US) no município de Santarém-PA segundo o escore de Framinghan
e determinar a incidência da síndrome metabólica. Metodologia: Trata-se de uma pesquisa epidemiológica
descritivo-transversal com abordagem quantitativa, com as seguintes etapas: pesquisa bibliográfica, pesquisa
de campo, análise bioquímica, determinação do escore de Framinghan e incidência de síndrome metabólica
e análise estatística descritiva. Resultados: Foram selecionados 68 participantes, nos quais se destacaram as
seguintes características: 77,95% gênero feminino; 54,42% adultos; 86,76% pardos; 47,05% com nível de
escolaridade fundamental; 95,59% com renda familiar de até dois salários mínimos; 52,95% realizavam lazer
fisicamente ativo e 60,29% não gostavam de fazer atividade física; 97,05% não eram tabagistas e 88,24% não
ingeriam bebidas alcoólicas; 55,88% tinham histórico familiar de DAC e 57,35% tinham histórico familiar
de diabetes; 54,42% apresentavam sobrepeso ou obesidade; 86,76% apresentavam níveis normais de glicose;
57,35% baixos níveis de HDL; 60,27% apresentaram dislipidemia; 38,2% apresentavam síndrome metabóli-
ca. Em relação ao risco de desenvolver DAC nos próximos 10 anos, 80,88% apresentaram baixo risco; 10,30%
médio risco e 08,82% apresentaram alto risco. Considerações finais: Observou-se na maioria dos participantes
da pesquisa a presença de fatores que podem contribuir para o aumento do risco de DAC. O conhecimento de
fatores que predispõem ou agravam as DAC’s, bem como, a determinação do risco individual constitui instru-
mento importante para a prevenção primária, abordagem diagnóstica, tratamento e controle dessas doenças.

Palavras-chave: Doenças Cardiovasculares,Fatores de risco,Prevenção

139 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO COMPARATIVA DO USO DE HIPOCLORITO DE SÓDIO EM ÁGUA DE CON-


SUMO HUMANO ORIUNDA DE POÇO ARTESIANO E DE MICROSSISTEMAS EM SANTA-
RÉM PARÁ

Greice Nivea Viana dos Santos, Ruy Bessa Lopes, Isabella Clarissa Vasconcelos Rêgo, Joseph Simões Ri-
beiro, Greice Nara Viana dos Santos, Soraia Baia dos Santos, Silvia Caroline de Sousa Aguiar e Rodrigues
Ferreira de Souza
greicenivea@gmail.com
Universidade Federal do Oeste do Pará - UFOPA1, Universidade Federal do Oeste do Pará - , UFOPA2,
Universidade Federal do Oeste do Pará - , UFOPA3, Universidade Federal do Oeste do Pará - , UFOPA4,
Universidade do Estado do Amazonas - , UEA5, UNIVERSIDADE FEDERALDO OESTE DO PARÀ - ,
UFOPA6, Universidade do Estado do Pará - , UEPA7 e Universidade do Estado do Amazonas - UEA8

Resumo: Introdução O uso de hipoclorito de sódio em água de consumo humano é importante, principalmente
por ser responsável pela eliminação de microrganismos responsáveis pela maioria das doenças de veiculação
hídrica (OLIVEIRA et al, 2012). De acordo com ministério da saúde a quantidade de uso do hipoclorito de
sódio é de 2 a 4 gotas por litro (BRASIL, 2011). Nos últimos anos o uso dessa substância na água tem sido
preocupante. Estudos apontam que o uso exacerbado dessa solução em água de consumo pode levar a forma-
ção de substâncias tóxicas, tais como os Trihalometanos (THM´s) que são consideradas cancerígenas (ARJO-
NA et al, 2012). Este trabalho tem como objetivo comparar o uso de hipoclorito de sódio em água de consumo
humano oriunda de poço artesiano e de microssistemas em áreas urbanas de Santarém Pará. Metodologia:
É uma pesquisa de campo onde houve aplicação de questionário para 46 pessoas residentes dos domicílios
que usam água para consumo de 8 bairros urbanos de Santarém Pará. Este estudo adotou os preceitos éticos
obtendo parecer de aprovação nº003353/2017. Resultados: Dos domicílios visitados 24 utilizam água para
consumo de poço artesiano próprio e 22 consomem água advindo de microssistema. Em relação ao número
de gotas por litro, observou-se que a maioria da população, utilizam de 1 a 2 gotas de hipoclorito de sódio,
18 (75%) de poço, e 14 (64%) de microssistema. 100% dos entrevistados que usam água do microssistema
armazenam água na caixa dágua, e 96% que usam água de poço artesiano, também utilizam esse sistema de
armazenamento de água. Sobre a higienização do sistema de armazenamento, observou-se que 21 (88%) que
utilizam água de poço e que 22 (100%) que consomem água de microssistema higienizam a caixa d’água, pelo
menos 2 vezes ao ano. Sobre o uso de filtro na torneira, observou-se que somente 3 (14%) utilizam, dos 22 que
têm água oriunda do microssistema, e que os entrevistados da água de poço artesiano não fazem uso de filtro.
Conclusão: Percebe-se que não há muitas diferenças nos aspectos que envolvem o uso de hipoclorito de sódio
em água de consumo para quem utiliza água oriunda de poço artesiano próprio e microssistema.

Palavras-chave: Hipoclorito de sódio,Água,Trihalometano

140 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ANÁLISE ECTOPARASITÁRIA DE ORTHEMIS DISCOLOR (ANISOPTERA-ODONATA)


EM CORPOS HÍDRICOS COM DIFERENTES NÍVEIS DE CONSERVAÇÃO NA REGIÃO
OESTE DO PARÁ

Tainã Silva da Rocha, Everton Cruz da Silva e José Max Barbosa de Oliveira Junior
tainasilva.tr@gmail.com
Universidade Federal do Oeste do Pará - UFOPA1, Universidade Federal do Oeste do Pará - , UFOPA2 e
Universidade Federal do Oeste do Pará - e UFOPA3

Resumo: Os Odonata são os principais hospedeiros de ácaro aquáticos do gênero Arrenurus spp. Apesar da
riqueza de espécies de Odonata existentes no Brasil, e de sua importância ecológica, trabalhos sobre variedade
de ectoparasitas nesses animais, são incipientes ou ausentes. Neste contexto, a pesquisa teve como objetivo
analisar os ectoparasitos da espécie Orthemis. discolor (Anisoptera: Odonata) em corpos hídricos com dife-
rentes níveis de conservação. Para o desenvolvimento da pesquisa foram utilizados oito (08) igarapés com
diferentes níveis de conservação, avaliados com o Índice de Integridade do Hábtat (IIH). Com uma rede ento-
mológica foram coletados adultos de Orthemis discolor (Anisoptera: Odonata) no período das 6:00 ás 18:00
horas. Foram realizadas três coletas em cada igarapé, durante os meses de outubro de 2016 (período de estia-
gem), abril e maio de 2017 (período chuvoso) totalizando um esforço amostral de 24 coletas em cada estação.
Após a captura dos indivíduos, os mesmos foram colocados em tubos individuais com álcool absoluto para
conservação de suas estruturas. Um pincel com cerdas finas foi passado na superfície do corpo do indivíduo
para facilitar a retirada dos ectoparasitas. Os ácaros removidos dos Orthemis díscolor, foram prensados em
lâmina e lamínula, fixados em solução de montagem de Hoyer como conservante, essas lâminas foram exa-
minadas sobre microscopia ótica de luz (5X e 10X). Os Valores do IIH, demonstraram que existe variação em
relação a integridade dos igarapés (IIH variando de 0.3 a 0,9), isso demostra que os igarapés apresentam dife-
rentes níveis de conservação. Foram amostrados 49 indivíduos de Orthemis discolor, desses apenas seis (06)
apresentaram contaminação por ácaro (ectoparasitos) do gênero Arrenurus spp, aderidos na lateral do tórax,
ou no fêmur do animal. Para os indivíduos analisados obteve-se uma prevalência de 12.24%. A intensidade
média de infecção observada foi de um ectoparasita para um indivíduo infectado, enquanto que a abundância
de ácaro é de 0,12. Ectoparasitas mostram preferência pelo tórax, principalmente na parte ventral e entre os
segmentos do abdômen, porém, com menor intensidade. Estudos anteriores afirmam que a infecção por ec-
toparasitas principalmente ácaros aquáticos está diretamente relacionada com o comportamento e hábitat do
hospedeiro. Autores propõem que o comportamento de oviposição de espécies de Odonata teoricamente às
tornam mais propensas a serem infectadas, no entanto, estudos que fazem a relação entre o sexo do hospedeiro
e o nível de infecção, não encontraram diferenças significativas.

Palavras-chave: libelulas,Ectoprasitas,Orthemis discolor

141 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ANÁLISE DE DESEMPENHO DE DISTRIBUIÇÕES LINUX VIRTUALIZADAS EM SISTE-


MA HOSPEDEIRO WINDOWS UTILIZANDO VIRTUALBOX

Ricardo Alvaro Gouveia Gomes Filho, Laurene Mitie Rodrigues Okada e Roberto Pereira do Nascimento
ricardogouveia3_@hotmail.com
Universidade Federal do Oeste do Pará - UFOPA

Resumo: Atualmente, a maioria dos computadores domésticos é utilizado a partir de um sistema operacional
e, por isso, o mercado de S.O.s tem crescido exponencialmente. Este trabalho foi desenvolvido a partir de
testes de desempenho - benchmarking - em sistemas operacionais Linux virtualizados dentro de um sistema
Windows usando a ferramenta VirtualBox, afim de apontar, para usuários comuns, qual o melhor S.O. em ter-
mos de desempenho de processador, memória RAM e sistema operacional. O sistema Linux Mint apresentou
o melhor desempenho médio.

Palavras-chave: Benchmarking, Virtualização, Linux,Benchmarking,Linux,Virtualização,Avaliação de De-


sempenho

142 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

FAZERES DO PSICÓLOGO DA SAÚDE: A ESPIRITUALIDADE COMO RECURSO DE EN-


FRENTAMENTO DO PACIENTE COM DOR

Erick Rosa Pacheco, Mylena Socorro Corrêa De Sousa, Súsane Miranda de Souza, Fernanda Tabita Zeidan
De Souza e Eloísa Amorim De Barros
erp_97@hotmail.com
Instituto Esperança de Ensino Superior - IESPES1, Instituto Esperança de ensino superior - , IESPES2, Ins-
tituto Esperança de ensino superior - , IESPES3, Instituto Esperança de Ensino Superior - , IESPES4 e HOS-
PITAL REGIONAL DO BAIXO AMAZONAS - e HRBA5

Resumo: A Psicologia da Saúde é a área da Psicologia que estuda o comportamento humano no contexto da
saúde e da doença, buscando compreender o papel das variáveis psicológicas sobre a manutenção da saúde,
o desenvolvimento de doenças e comportamentos associados à ela. Uma vez que a psicologia da saúde busca
prevenir a doença e promover a saúde, a espiritualidade de formas particulares atua na promoção de qualida-
de de vida; o ser humano está engajado na busca de significar e simbolizar aspectos de sua vida. O objetivo
deste estudo é demonstrar como a espiritualidade pode ser importante instrumento de confronto a situação de
dor, partindo sempre do pressuposto de que a espiritualidade se constitui em algo inerente a pessoa humana
baseada em seu desenvolvimento sociocultural. Como metodologia, utilizou-se de uma revisão da literatura,
na qual se pesquisou em bases de dados os temas relevantes ao trabalho a fim de analisar e pensar criticamente
acerca do tema proposto. O processo de contato com algum tipo de espiritualidade se faz útil, pois, a partir
dele o paciente pode simbolizar os aspectos de sua vida, e neste sentido, muitas vezes o faz no seu âmbito
místico pessoal. Tanto a espiritualidade quanto a religiosidade são processos importantes no adoecimento,
pois trazem subsídios essenciais para a reorganização do campo mental do paciente. A dor pode ser entendida
como um resultado entre o meio físico, mental, emocional e espiritual, desta forma, percebe-se a importância
de olhar o ser humano de uma forma totalizadora, buscando entender suas particularidades e representação no
mundo e suas situações de sofrimento nele, sofrimento este que não acontece somente fisicamente, deve-se
acentuar que o sofrimento de alguma forma requer o corpo, é um movimento que totaliza as instâncias do ser
e necessita de todas elas para acontecer, a doença pode se repetir nos sujeitos, mas cada um recebe os efeitos
desta de maneira diferente, a dor é carregada de subjetividade, assim como é carregada de cultura, padrões e
espiritualidade Desta forma, demonstra-se a importância da espiritualidade como enfrentamento do lugar de
dor e urge portanto, a necessidade de se ter um cuidado que seja holístico, ou seja, que possua um olhar to-
talizador ao indivíduo, analisando todos os aspectos biopsicossocioespiritual do seu ser e especificamente da
existência de cada pessoa humana.

Palavras-chave: Psicologia da Saúde,Espiritualidade,Enfrentamento,Dor

143 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

O FENÔMENO RELIGIOSO: REFLEXÕES SOB O PONTO DE VISTA ÉTICO E PSICOLÓ-


GICO

Rosângela Neves Sena, Rubinei Valente Coelho, Maria Clara Pedroso Araújo, Elaíse Raileny da Silva Me-
deiros e Fernanda Tabita Zeidan De Souza
nevessenarosangela@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: O objetivo desse estudo de revisão teórica visa refletir o fenômeno religioso a partir dos conceitos
de ética e psicologia. Nas antigas civilizações, a religião era vista como naturalista pois os gregos entendiam
que viver em harmonia com a natureza seria estar em paz consigo e respeitar os deuses. Os Judeus acreditam
na existência de uma Divindade que esta acima do bem e do mal. Entende-se que o indivíduo se relacionava
direto com a divindade e que a prática do amor cristão seria viver de maneira ética. Jesus, o cristo de Deus, não
nega a lei, mas lhe outorga pleno cumprimento, sobrepondo o amor, superando dessa maneira o pensamento
de judeus e dos gregos. Torna-se inegável o progresso moral que a religião trouxe a humanidade. Já em termos
de Psicologia o salto qualitativo na fé, que supera os estádios estético e ético com olhar existencial, quer com-
preender o ser de forma holística através do relacionamento com o cosmos, contribuindo na minimização do
sofrimento humano. Diante disso foi utilizado como métodos o levantamento sistemático de obras e textos nas
bases de dados SCIELO e LILAC´s que apresentassem os descritores: Religião e Psicologia, Ética e Psicolo-
gia e Ética e Religião. Os resultados indicam que nos aspectos éticos são encontrados a ética laica e religiosa.
A ética laica diz respeito a todos os professos ou não de um credo religioso, e a ética religiosa concerne aos
membros de uma congregação. A ética laica entra no cenário educacional brasileiro na década de noventa, com
caráter ideológico político, sem violar o que é assegurado aos pais na educação da prole, ofertando-se um en-
sino público religioso opcional. Já a ética religiosa aparece no contexto familiar de credos heterogêneos com
o homem buscando experiências com o divino desejando alcançar a espiritualidade e no repasse de valores a
seus descendentes. A Psicologia comparece no sentido de firmar a ética como sendo uma ciência que conduz
os comportamentos humanos através da moral, lançando mão da religião como forma de enfrentamento do
sujeito para com seu pensar e sua singularidade. Por conseguinte, a religiosidade não depende apenas de dou-
trinas, mas de múltiplos saberes culturais, experienciados e inter-relacionais. A ética e a psicologia corroboram
junto a este pensamento no sentido de entender que jamais se apartará do homem o que lhe é inerente.
Palavras-chave: Fenômeno Religioso, Ética, Psicologia.

144 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

CARACTERÍSTICAS GERADORAS DE ESTRESSE OCUPACIONAL EM ENFERMEIROS


DO SETOR DE URGÊNCIA E EMERGÊNCIA DO HOSPITAL MUNICIPAL DE ITAITUBA,
ESTADO DO PARÁ, BRASIL

Camila Araújo Sá e Jossehan Galúcio da Frota


kmillalove0@gmail.com
Faculdade de Itaituba - FAI

Resumo: Apesar de não haver um conceito exclusivo, a saúde mental trata-se de um conjunto de desejos, von-
tades e crenças, sendo necessário que haja sintonia entre eles para que o indivíduo permaneça em equilíbrio
biopsicossocial. Quando o trabalhador está inserido em um setor de grande procura e livre acesso, como é o
caso da urgência e emergência, ele está vulnerável a qualquer risco que o setor ofereça, o que pode resultar em
pressão psicológica e como consequência, a manifestação do estresse ocupacional. pretende-se conhecer se
a rotina de trabalho interfere na vida pessoal dos enfermeiros do setor de urgência e emergência do Hospital
Municipal de Itaituba frente as situações que geram maior grau de estresse durante sua atuação. Esse estudo
foi realizado no Hospital Municipal de Itaituba, no Município de Itaituba, Estado do Pará, no período de 11 de
setembro a 16 de outubro de 2017. A amostra foi composta de cinco enfermeiros que atuam no setor de urgên-
cia e emergência. A coleta dos dados ocorreu por meio de um formulário estruturado com 14 questões. Dos
enfermeiros entrevistados 60% (n= 3) são do sexo masculino e 40% (n= 2) do sexo feminino. A faixa etária
variou entre 27 a 38 ( = 30,4) anos. A maioria (80%; n =4) dos entrevistados alegaram haver uma interferên-
cia em sua vida pessoal ocasionada pela rotina de trabalho. O número reduzido de funcionários foi apontado
como fator principal para o surgimento do estresse trabalhista e todos relataram não receber apoio por parte da
gestão de caráter motivacional ou para seu aperfeiçoamento, enfatizaram ainda, que as condições do ambiente
hospitalar não eram favoráveis para sua atuação; e não era disponibilizado a eles as condições adequadas de
repouso em seus plantões noturnos. Todos os entrevistados nesse estudo souberam de um modo geral, definir
saúde mental, de acordo com os preceitos básicos publicados pela OMS e relataram a necessidade da inserção
de um psicólogo para o auxílio e manutenção de sua saúde psicológica. A jornada de trabalho do profissional
enfermeiro emergencista foi descrito pelos próprios como estressante e perigosa.

Palavras-chave: Estresse ocupacional,Enfermeiros,Hospital Municipal de Itaituba

145 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PERFIL EPIDEMIOLÓGICO DOS PACIENTES ATENDIDOS EM UM CENTRO DE TESTA-


GEM E ACONSELHAMENTO EM SANTARÉM PARÁ

Gleicy lima sousa, Risonilson Abreu da Silva e Adjanny Estela Santos de Souza
lima.gleicy@yahoo.com.br
Instituto Esperança de ensino superior - IESPES

Resumo: Introdução: As Infecções Sexualmente Transmissíveis (IST’s), apresentam elevada incidência e pre-
valência sobretudo na população jovem. Objetivo: O objetivo desse estudo foi traçar o perfil epidemiológico
dos pacientes atendidos pelo CTA – URE (Unidade de Referência Especializada) Dr. Ismael Araújo em Santa-
rém/PA, para detecção das IST’s, através de testes rápidos por imunocromatografia para HIV, Sífilis, Hepatite
B e Hepatite C, desde a implantação do serviço nesta unidade - 2011 até 2016, fazendo uma análise dos casos
positivos detectados. Metodologia: Trata-se de um estudo descritivo com abordagem quantitativa e retros-
pectiva com o emprego da pesquisa documental dos prontuários do serviço. Resultados: Foram atendidos
5.185 usuários, sendo realizados 14.644 testes. Notou-se expressivo atendimento na população residente na
área urbana do município, bem como de usuários do sexo feminino, assim também os casos reagentes são em
sua maioria de residentes da área urbana do município. Observou-se um percentual de positividade de 1,86%
(272) do total de testes realizados. 2.114 (40,77%) usuários atendidos estavam na faixa etária de 31 a 50 anos.
A sífilis foi a infecção com maior incidência, chegando a 77,9% de todos os testes reagentes. A quantidade
de testes positivos para HIV e HC foram equivalentes, 23 para ambos, apesar de terem sido realizados 5.124
testes para HIV e 2.913 para Hepatite C. Considerações finais: O CTA da URE Dr. Ismael Araújo proporciona
à população do município de Santarém-Pará e região, acesso rápido a testes para IST`s, além de contribuir com
a secretaria de vigilância sanitária na obtenção de dados epidemiológicos a nível regional, que servem de base
para planejamento estratégico de implantação de políticas de saúde pública.

Palavras-chave: Perfil epidemiológico, IST’s, AIDS.,Perfil epidemiológico, IST’s, AIDS.

146 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

APLICAÇÃO DA TERAPIA MANUAL NO REJUVENESCIMENTO FACIAL

Aline De Souza Massulo Garcia e Jorge Carlos Menezes Nascimento Júnior


linnydnmassulo@hotmail.com
Instituto Esperança de ensino superior - IESPES

Resumo: Introdução: Através dos movimentos faciais, o ser humano expressa sentimentos e emoções como:
preocupação, raiva, alegria, dor, angústia, sendo um contato mais direto com o mundo. Com o processo de
envelhecimento ocorrem alterações da pele, dos músculos da mímica facial e pelas fáscias musculares o que
leva a flacidez dos tecidos e a formação de rugas (CARREIRO et al., 2011). A fisioterapia para minimizar
sinal de envelhecimento utiliza técnicas de terapia manual, por meio de mobilização passiva, massagem de
tecidos moles, facilitação neuromuscular proprioceptiva, estabilização segmentar, manipulação de alta velo-
cidade, mobilização articular e mobilização de fáscia (SILVA et al., 2013).O envelhecimento cutâneo ocorre
por uma série de modificações sendo um processo contínuo que atinge a arquitetura facial, sendo algo espe-
rado e irreversível, relacionado com a idade, ocasionado por fatores intrínseco e extrínseco, gerando perda da
elasticidade, diminuição do metabolismo, flacidez, ressecamento, atrofia da pele (SANTOS, MEIJA, 2013).
A terapia manual influencia desde a circulação até o metabolismo, melhora a elasticidade, os tônus da pele e
relaxa os músculos. Tem como finalidade mobiliza essas estruturas, estimulando os sistemas a transportarem
os nutrientes com mais facilidade e em maior quantidade para a pele e estruturas adjacentes (PRADO; OLI-
VEIRA, 2013). Objetivo do estudo: Averiguar a eficácia da terapia manual na atenuação de rugas e flacidez
facial. Metodologia: O levantamento de dados procedeu nas principais bases científicas como: Pubmed, Bi-
reme e Scielo, foram relacionados 5 artigos e, após a leitura dos artigos, foi excluído 1 que não referenciava
a aplicação buscando artigos e teses dos anos de 2012 a 2018. O estudo possui uma abordagem quantitativa
e se caracteriza como revisão de literatura do tipo integrativa. Resultados: Houve suavização de rugas, ptose
de pele, marcas de expressão e a melhora na definição de contornos que contribuem para o rejuvenescimento
do rosto. Essa afirmação correlaciona com os resultados encontrados no trabalho em relação à melhora clínica
e a redução do sulco nasogeniano, atingiu um resultado significativo. Não foram encontrados outros estudos
relacionados ao objetivo traçado por esta pesquisa, ou seja, uma relação entre a Terapia Manual com o Re-
juvenescimento Facial. Conclusão: Terapia Manual no rejuvenescimento facial apresentou alguns resultados
satisfatórios, podendo ser mais um recurso utilizado na área da Fisioterapia Dermatofuncional. Porém, as evi-
dências até o momento são insuficientes para determinar sua eficácia para o rejuvenescimento facial. Sendo
necessário mais pesquisas antes que as conclusões possam ser tiradas.

Palavras-chave: Terapia Manual; Rejuvenescimento; Facial; Envelhecimento.

147 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

DESENVOLVIMENTO DE FUNÇÕES COGNITIAS ATRAVÉS DE MÉTODOS BASEADOS


NA TEORIA CONSTRUTIVISTA

Dayana Trevisan, Gabriel Rodrigues Gomes, Hugo Ricardo Aquino e Cleudiane Lima Ferreira
dayana._trevis44@hotmail.com
Universidade Luterana do Brasil - ULBRA

Resumo: Este presente trabalho tem como objetivo destacar a importância de métodos baseados na teoria
construtivista para o desenvolvimento de funções cognitivas dos alunos, focando em dois métodos didáticos
em específico, a Aprendizagem Baseada em Problemas que visa a implementação de problemas ligados ao
cotidiano, podendo ser utilizado até mesmo estudo de caso como exemplo de problemas ligado ao dia a dia.
O outro método é chamado de Instrução por pares, e tem como principal função proporcionar a interação en-
tre alunos, com o intuito dos mesmos trocarem informações, discutirem a resposta questões entre si tentando
convencer e ensinar um ao outro do porquê chegaram à conclusão de suas respectivas respostas, desenvol-
vendo desta forma o senso crítico entre ambos. Estes métodos proporcionam o aprimoramento das faculdades
mentais dos alunos, colocando o foco na absorção do conhecimento gerada pelo estudo individual do aluno, e
não na transferência de conhecimento feito través de professor-aluno. Os objetivos específicos baseiam-se no
questionamento do modo de ensino tradicional das escolas e universidades comparado com o modelo cons-
trutivista para o desenvolvimento das funções cognitivas dos alunos. Percebe-se que o atual modelo escolar e
acadêmico tradicional brasileiro ainda é um empecilho para a inserção de novas didáticas. Em contrapartida,
o construtivismo traz uma nova ideia a respeito da aprendizagem nas escolas e faculdades, tal teoria baseia-se
na ideia de que conhecimento é construído através da interação do indivíduo com o meio físico social, com o
simbolismo humano, com interações sociais, e principalmente é constituído por força de sua ação e não por
dotações prévias transmitidas. O conhecimento precisa ser adquirido de forma que o educando consiga solu-
cionar problemas ligado ao seu cotidiano e que não seja um mero conhecimento figurativo ou decorativo, mas
que seja operativo, ou seja, que traga a verdadeira compreensão do conteúdo abordado, envolvendo desde o
conhecimento empírico até o mais técnico. Com base nisto, os métodos supracitados fornecem todos os quesi-
tos necessários para que haja o desenvolvimento cognitivo dos educandos. Com uma metodologia que coloca
o professor como agente facilitador do conhecimento dos alunos, agindo em sala de aula como um tutor, o
mesmo será responsável por aplicar os métodos e instruir os alunos a buscar seu próprio conhecimento. A
aprendizagem baseada em problemas e a instrução por pares são métodos lúdicos e dinâmicos que despertam
a atenção dos alunos e proporcionam um intercâmbio entre alunos que é o principal objetivo da teoria cons-
trutivista.

Palavras-chave: Consrutivismo,Cognitivo,Aprendizagem

148 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A CONTAÇÃO DE HISTÓRIA E O LÚDICO E SUAS INFLUÊNCIAS NO DESENVOLVI-


MENTO DA CRIANÇA

Jacqueline Farias Galvão, karina da silva rui, Victoria Alessandra Soares Damasceno, Christian Diniz Gui-
marães e Fabiane Mota Rabelo
jacquelinesilvafarias@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: A contação de história no desenvolvimento da criança é de suma importância, ela por si só conduz
a criança para um mundo onde a fantasia e a imaginação se afloram, através da narração, dramatização e do
teatro, que são atividades voltadas para que a criança sinta novas e diferentes emoções, possibilitando uma
visão mais ampla do mundo, aumentando suas possibilidades de fuga do cotidiano por meio da fantasia que
o lúdico desperta no imaginário infantil. Pensando nisso, o projeto de extensão intitulado teatro de fantoches:
uma forma lúdica de incentivar a leitura e falar de inclusão, usa a contação de histórias através do uso de
fantoches, envolvendo a ludicidade para interagir com as crianças através da musicalização, brincadeiras e
alegria, levando uma nova vivencia e abordando nas histórias assuntos de extrema relevância para sociedade
como o respeito, humanização, igualdade, solidariedade e a inclusão, a realização do projeto se dá por meio
de ações realizadas em escolas, creches e eventos. Segundo Pinto, citado por Rufino e Gomes (1999) a con-
tação de histórias influi em todos os aspectos da educação da criança: na afetividade: desperta a sensibilidade
o amor a leitura; na compreensão: desenvolve o automatismo da leitura rápida e a compreensão do texto; na
inteligência: desenvolve a aprendizagem de termos e conceitos e a aprendizagem intelectual.Através do lúdico
pode-se levar o desenvolvimento pessoal e cognitivo da criança como a autodescoberta que ao mesmo tempo
desenvolverá suas potencialidades através da vivencia expressas dentro do ambiente escolar, que é o ponto
de partida para o processo de internalização e sistematização da criança. De acordo com Vygotsky (2000),
é justamente interagindo com os outros que isso acontece. Ou seja, quanto maior for a estimulação para a
criança, maior será seu desenvolvimento e sua construção de mundo. A experiência vivenciada nos mostrou a
importância do lúdico no âmbito educacional e, principalmente voltado para o público infantil, é importante
salientar que temos percebido um resultado satisfatório. Nas ações realizadas com as crianças percebemos que
elas se interessam muito pelas histórias que contadas, interagem com os fantoches, perguntam quando sentem
alguma dúvida, realizam as atividades propostas com entusiasmo e dedicação e se mostram extremamente
felizes durante as atividades do projeto.

Palavras-chave: Criança, Lúdico, Desenvolvimento

149 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

QUALIDADE DE VIDA DE MULHERES EM TRATAMENTO DE NEOPLASIA MAMÁRIA:


UMA REVISÃO DE LITERATURA

Djúlia Soraya Sena, Amanda Emanuele Correa, Iana Bruna Parente Cardoso e Silvia Caroline de Sousa
Aguiar
djuliasena@hotmail.com
Universidade do Estado do Pará - UEPA

Resumo: Introdução: O diagnóstico e tratamento da doença oncológica traduzem-se em profundas sequelas


físicas, sociais e psicológicas. Proporcionar mais anos de vida não significa necessariamente aproveitá-la com
qualidade, em especial, quando se aborda a qualidade de vida (QV) das pacientes em tratamento para câncer
de mama (CM) observamos alterações negativas advindas do câncer e suas terapêuticas que podem interferir
de forma preponderante na recuperação das mesmas. Objetivo do Estudo: Por meio desta pesquisa busca-se
através de uma revisão das literaturas expor os fatores advindos do CM e das terapêuticas envolvidas que po-
dem influenciar na QV das pacientes. Metodologia: Trata-se de um estudo descritivo de revisão bibliográfica
realizado por meio de um levantamento retrospectivo de artigos científicos pesquisados nas bases de dados:
Pubmed (National Library of Medicine National Institutes of Health), Scielo (Scientific Electronic Library)
e Bireme (Portal de Revistas Científicas em Ciências da Saúde). Os critérios de inclusão adotados foram os
artigos em português e inglês, publicados no período entre janeiro de 2009 e dezembro de 2017, relacionados
com o tema proposto, e os critérios de exclusão foram trabalhos incompletos e artigos com mais de 10 anos de
publicação. Resultados: Foram encontrados 14 trabalhos referentes ao tema, sendo 5 artigos e 7 dissertações (6
teses de mestrado e 1 de doutorado), 2 artigos foram excluídos da pesquisa por apresentarem mais de 10 anos
de publicação. Em suma, os principais entraves associados à QV estão relacionados à cirurgia para retirada de
mama, efeitos da hormonioterapia, quimioterapia e radioterapia, que implicam principalmente na queda dos
pêlos, dores e dentre outros desconfortos. Observamos também, grandes índices de depressão grave nessas
mulheres o que pode dificultar a continuidade e/ou adesão ao tratamento. O medo da recidiva, o desconforto
físico, a redução das atividades, o distúrbio do sono e as dificuldades sexuais também são fatores que irão
comprometer o cotidiano dessas pacientes, restringir a execução de atividades físicas, laborais e domésticas
causando impactos emocionais e sociais na vida das mesmas. Considerações Finais: Compreender que o cân-
cer afeta mais do que apenas o corpo das mulheres, é uma das formas de proporcionar o bem estar físico, social
e emocional para essas pacientes.

Palavras-chave: qualidade de vida, câncer, mama.

150 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PERFIL EPIDEMIOLÓGICO DA MICROÁREA 04 DA ESTRATÉGIA DE SAÚDE DA FAMÍ-


LIA II DO BAIRRO SANTARENZINHO NO MUNICÍPIO DE SANTARÉM – PARÁ

Jéssica Freitas Reis, Jenifer Maria Da Silva Ribeiro, Fabriane Ramos Oliveira E Maria Da Conceição Ca-
valcante Farias
djuliasena@hotmail.com
FACULDADE DA AMAZÔNIA - UNAMA1, Faculdade da Amazônia - , UNAMA2, FACULDADE DA AMA-
ZÔNIA - , UNAMA3 e Faculdades Integradas do Tapajós - FIT4

Resumo: INTRODUÇÃO: A Estratégia de Saúde da Família (ESF) antes chamada Programa de Saúde da
família, foi criada em 1994 pelo Ministério da Saúde a fim de atender as demandas impostas pela Política Na-
cional de Atenção Básica. A ESF propôs modificações no modelo tradicional de assistência à saúde com visão
hospitalocêntrica e focada apenas na doença. Para tanto, cada ESF possui sua própria equipe multiprofissional
que atende a uma delimitada quantidade de família. O Ministério da Saúde estabelece que cada equipe de saú-
de da família seja responsável por, no máximo, 4.000 pessoas, sendo a média 3.000, podendo ser modificado
dependendo do fator de vulnerabilidade de cada família, sendo que, quanto maior o grau de vulnerabilidade,
menor deverá ser a quantidade de pessoas por equipe. OBJETIVO: Caracterizar o perfil epidemiológico de
uma microárea da ESF II do Bairro Santarenzinho no município de Santarém – PA. MATERIAL E MÉTO-
DOS: Trata-se de uma pesquisa descritiva, bibliográfica, com abordagem quantitativa. Utilizou-se como meio
de obtenção de dados o formulário preenchido pela Agente Comunitária de Saúde responsável pela microárea
04 da ESF II do bairro Santarenzinho. RESULTADOS: O total de famílias pertencentes a essa microárea é
de 209, sendo que o número total de pessoas é de 721. Dentre essas pessoas, a faixa etária prevalente é a ju-
venil de 17-24 anos, correspondendo a 28%, seguido de adolescentes de 13-16 anos (24%) e adultos/idosos
acima de 44 anos (21%). Em relação às pessoas deficientes, que correspondem a 3,60% da população geral
da microárea, observou-se que há mais pessoas com transtornos mentais (46%) seguido de deficiência física
(39%), e em terceiro lugar os deficientes auditivos (11%), além de outras deficiências (4%). As doenças crô-
nico-degenerativas também estão presentes nessa população numa porcentagem de 10,54%, sendo hipertensos
(67%), diabéticos (28%) e diabéticos/hipertensos (0,5%). CONCLUSÃO: O reconhecimento do perfil epide-
miológico de uma microárea dentro de uma Estratégia de Saúde da Família é imprescindível para a garantia de
uma assistência qualificada e abrangente, pois somente conhecendo as potencialidades e fragilidades de uma
população, se torna possível formular ações e desenvolver atividades que beneficiem a todos.

Palavras-chave: Atenção primária a Saúde,Estratégia de Saúde da Família,Perfil epidemiológico

151 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

EFEITOS DA SUPLEMENTAÇÃO DA FARINHA EXTRUSADA DE AMARANTO E QUIRE-


RA DE ARROZ SOBRE O NÍVEL DE PROLACTINA EM RATOS ADULTOS DESNUTRIDOS

Marcello de Lima Baima, Daniel Santos de Castro, Maria Auxiliadora Menezes de Souza, Waldiney Pires
Moraes e Xaene Maria Furtado Duarte Mendonça
cellobaima@gmail.com
Universidade Federal do Oeste do Pará - UFOPA

Resumo: Introdução: a desnutrição está entre as maiores ameaças sobre a saúde, na infância, está associa-
da à maior morbi-mortalidade, menor desenvolvimento cognitivo e a menor capacidade produtiva na idade
adulta, sendo o período entre 0 e 5 anos de idade o de maior vulnerabilidade do ciclo de vida no ser humano.
Diversas alterações estão presentes na desnutrição (antropométrica, bioquímicas e funcionais). A prolactina
é um hormônio adeno hipofisário, responsável pelo preparo do organismo materno para a lactação possuindo
também funções metabólicas e imunológicas. A busca por alimentação balanceada tem levado pesquisadores a
estudarem o enriquecimento de alimentos a fim de proporcionar melhor aproveitamento de nutrientes dos ali-
mentos de uso habitual da população. Optou-se pela suplementação com o amaranto (Amaranthus cruentus),
um pseudocereal, por seu conteúdo relativamente alto de proteínas (considerada de alta qualidade biológica
devido ao seu conteúdo em lisina cerca de 5% e 4,4% de aminoácidos sulfurados). Objetivo: avaliar os níveis
de prolactina em ratos desnutridos alimentados com dieta indutora de desnutrição suplementada da farinha
extrusada de amaranto e quirera de arroz na proporção de 30%-70%. Metodologia: foram realizados ensaios
biológicos com 30 ratos machos da linhagem Wistar (Rattus norvegicus albinus), os quais foram submetidos
à desnutrição. Ela foi induzida através do uso contínuo desde o pós-parto imediato até os 60 dias de vida. Os
ratos foram divididos em 3 grupos (n=10), CR (22,0% proteínas), DN (7,8% proteínas) e DN+AA (11,3%
ptn). O consumo da dieta e o peso foram monitorados. No 60º dia os animais foram eutanasiados para a co-
leta de sangue e dosagem da prolactina. Resultado: o consumo das dietas foi estatisticamente diferente (p ≤
0,01) entre os animais do grupo CR (19,8 ± 1,9 g) e DN+AA (13,8 ± 1,5 g) e (p ≤ 0,01) entre os DN+AA e os
DN (23,3 ± 3,3 g).Aos 60 dias de uso das dietas é possível verificar que o peso foi estatisticamente diferente
entre todos os grupos (p ≤ 0,01), Maior no grupo CR (180 ± 2,0 g) e menor no DN (54,9 ± 5,4 g). A análise
da dosagem de prolactina, mostram uma diferença significativa entre o grupo desnutrido e tratado (p ≤ 0,05).
Conclusão: foi concluído que os níveis séricos de prolactina são afetados pela desnutrição na idade adulta dos
animais desnutridos e pode estar envolvida no maior consumo da dieta pelo grupo DN.

Palavras-chave: Amaranto,Desnutrição,Prolactina

152 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO DAS AUTORIZAÇÕES DE INTERNAÇÃO HOSPITALAR (AIH) DE CARATÉR


ELETIVO E DE URGÊNCIA APROVADAS NO HOSPITAL MUNICIPAL DE SANTARÉM-PA

Lídia dos Santos Carvalho, Jaiane Cristina dos Santos Nascimento, Juliete Alcantara Silva e Lucio Thadeu
Macedo Meireles
lidiacarvalhoiespes@gmail.com
Instituto Esperança de ensino superior - IESPES

Resumo: O Sistema Único de Saúde (SUS) financia serviços de atenção hospitalar e ambulatorial em todo o
país, além de exercer funções de saúde pública típicas do estado, tais como vigilância sanitária e epidemiológi-
ca. Por definição constitucional, o Sistema Único de Saúde deve assistir a toda a população brasileira de forma
universal, igualitária e hierarquizada. As políticas de saúde influenciam a organização do sistema de saúde, as
formas de financiamento, a conformação da participação do setor privado, a composição tecnológica e a loca-
lização geográfica dos hospitais. Esses fatores, associados à cultura médica local, à natureza jurídica de cada
prestador de serviço e ao seu modelo de gestão, interferem no tipo, na quantidade e na qualidade dos serviços
disponibilizados para a população, bem como no tipo e na quantidade de recursos humanos e tecnológicos.
Com isso o objetivo deste estudo foi analisar as autorizações de internação hospitalar aprovadas no Hospital
Municipal de Santarém-PA. Trata-se de uma pesquisa descritiva, documental e retrospectiva, através do Sis-
tema de Informações Hospitalares do SUS (SIH-SUS) acessadas pela plataforma do Departamento de Dados
do SUS (DATASUS) e a partir de artigos de revisão bibliográfica e diretrizes, foram utilizadas as seguintes
variáveis: quantidade de AIHs aprovadas, custo total das AIHs, caráter de atendimento das AIHs, custo médio
das AIHs e média de permanência por caráter de atendimento. No ano de 2017, chegou-se a um total de 13.245
AIHs aprovadas totalizando um custo total de R$ 7.006.007,26 e um valor médio por AIHs de R$ 528,95;
sendo que 655 foram classificadas quanto ao caráter de atendimento como eletivas e 12.590 de urgência e em
relação ao tempo médio de permanência por caráter de atendimento, verificou-se que as eletivas em média
permanecem internadas 2.8 dias enquanto que os de urgência 5.8 dias. Corroborando com Castro (2004) os
fatores capacitantes no nível da comunidade podem ser entendidos como as características do sistema de saúde
naquele local, diante disso, o hospital representa um suporte e apoio maior, pois a responsabilidade é transfe-
rida aos profissionais de saúde dessa instituição. Portanto é evidente que as AIHs classificadas com o caráter
de atendimento de urgência geraram um custo alto para os cofres públicos e consequentemente verifica-se o
fortalecimento dos níveis de atenção à saúde para melhor resolutividade dos problemas da comunidade no
âmbito da atenção básica para minimizar os gastos nos atendimentos de urgência.

Palavras-chave: Autorizações de internação hospitalar (AIH),Atendimento,Hospital

153 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

VANTAGENS EDUCACIONAIS PROPORCIONADAS POR UM GRUPO DE ESTUDOS DE


ROBÓTICA E AUTOMAÇÃO

Luan Moraes Ferreira, César Ferreira Fernandes Filho, Jéferson Daniel Ferreira Pessôa, Rômulo Pereira
Sampaio de Lima, Sâmya Maria Brito Carneiro, Victória Sousa de Sena , Charles Eduardo Repolho Fernan-
des do Carmo e Marialina Corrêa Sobrinho
voxstm2@gmail.com
Colégio Dom Amando - CDA

Resumo: O trabalho apresenta, as vantagens didáticas e as habilidades trabalhadas por um Grupo de Estudos
de Robótica e Automação (GERA), bem como modelos de projetos realizados pela equipe. Os resultados apre-
sentados baseiam-se no GERA-CDA (Grupo de Estudos e Robótica e Automação do Colégio Dom Amando).
Hoje, o crescimento econômico e social das comunidades vincula-se de modo íntimo com seu nível tecnoló-
gico, especialmente nas áreas de robótica e automação de processos. Nesse cenário, o GERA é uma equipe
de trabalho prático que, além de prover a organização para desenvolver os projetos, se preocupa também com
a divulgação científica dos trabalhos desenvolvidos pelos integrantes da equipe. Desta forma, o objetivo do
trabalho é apresentar, a alunos e professores, o GERA como ferramenta viável e importante para a educação
moderna. A abordagem da temática proposta foi realizada através da execução de três experimentos pelo GE-
RA-CDA, equipe composta por doze estudantes da 3ª série do ensino médio e coordenada pelos professores
Márlison Santos de Sá e Marialina Corrêa Sobrinho, os quais visam demonstrar as habilidades e conhecimen-
tos que podem ser trabalhados pela equipe. Os três experimentos consistem em: 1º) construção de um braço
robótico controlado via rádio controle; 2º) construção de um motor solenoide; e 3º) construção de um sistema
de controle de leds com a plataforma Arduino. Os projetos foram realizados entre janeiro e março de 2018.
No primeiro experimento, os estudantes puderam conhecer aspectos do funcionamento de servo-motores e do
controle via ondas de rádio (áreas de Estática e Ondulatória); no segundo, foram trabalhados conceitos sobre
eletroímãs e bobinas (Eletromagnetismo), bem como noções sobre as partes e o funcionamento de um motor
(Dinâmica e transmissão de movimento); no terceiro, houve contato com aspectos importantes de programa-
ção e automação de processos com o uso da plataforma Arduino (Computação). Portanto, em vista dos fatos
apresentados, conclui-se que, com as devidas adaptações às realidades de cada grupo, as unidades GERA
podem funcionar como centros importantes de desenvolvimento de pesquisas e estudos relacionados às áreas
de robótica, programação e automação.

Palavras-chave: Educação,Robótica,Automação,Arduino,Tecnologia,Computação,Programação,Grupo de
Estudo

154 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ANÁLISE DO EQUILÍBRIO POSTURAL ESTÁTICO APÓS A COLOCAÇÃO DE PEÇAS PO-


DAIS EM ADULTOS MILITARES.

Ana Vasconcelos de souza, Marina Vasconcelos Souza, Pedro Odimar dos Santos e Marissol Rabelo de Al-
meida
anavasconcelosdesouza@gmail.com
Universidade do Estado do Pará - UEPA

Resumo: Introdução: O organismo utiliza os sistemas visuais, vestibulares e proprioceptivos para a manuten-
ção do equilíbrio, onde estes enviam informações para o sistema nervoso central sobre as condições do corpo
com o propósito de estabilizá-lo. Objetivo: O presente estudo tem como objetivo analisar o efeito imediato
da colocação de peças podais no equilíbrio postural de adultos militares. Metodologia: Trata-se de um estudo
com 23 militares do sexo masculino (35±7 anos) com parecer do CEP UEPA-Campus XII n° 1. 963. 489.
Usou-se do protocolo CNT para a escolha das peças podais (cunha de 3, 6 e 9 milímetros, barra retrocapital e
infracapital, hemicúpula menor e maior, ponto inframetatarsal e elevação medial longitudinal Podaly®) alo-
cadas nas regiões plantares (antepé, mediopé e retropé a depender da peça selecionada) de cada militar. Após,
foi realizado o exame de estabilometria, onde o voluntário ficou em pé e parado por 30 segundos na plataforma
de pressão S-plate Medicapteurs®e analisado o equilíbrio postural estático do baricentro do corpo por meio
das seguintes variáveis: desvio ântero-posterior em milímetros (mm) desvio látero-lateral (mm) e velocidade
do centro de pressão (CP) em milímetros por segundo (mm/s) antes e após a colocação das peças. Resultados:
Não houve diferença estatisticamente significante dos desvios ântero-posterior e látero-lateral do baricentro
do corpo antes e após a colocação de peças podais correspondendo a p=0.5135 e p=0.1672, respectivamente.
Já a velocidade do centro de pressão (CP) teve redução estatisticamente significante com p = 0.0136 avaliados
através do teste de Wilcoxon e considerando p < 0.05. Logo, observa-se um resultado evidente para a velocida-
de do CP mesmo sem alterações significativas nos desvios. Este fato sugere que a colocação de peças podais
favorece a eficiência da estabilização corporal de militares ao proporcionar uma base de suporte mais estável.
Considerações finais: As peças podais proporcionaram uma redução da velocidade do centro de pressão do ba-
ricentro do corpo em adultos militares, mesmo sem diferença estatística para os desvios, fato este que se pode
inferir pela relação que as peças podais causam na orientação corporal ao equilibrar a base de suporte, formada
pelos pés, oferecendo uma potencialização da estabilização postural. Desse modo, estas são consideradas uma
terapêutica de prevenção, quando associadas às palmilhas proprioceptivas, contra as lesões decorrentes de
forças transientes que causam desequilíbrio postural e que estão relacionadas às atividades laborais onde há a
permanência de longos períodos em ortostatismo, como no militarismo.

Palavras-chave: órtese,equilíbrio postural,militares

155 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ANÁLISE DA DIÁSTASE DOS MÚSCULOS RETO-ABDOMINAIS (DMRA) ENTRE GES-


TANTES PRIMÍPARAS E MULTÍPARAS ATENDIDAS NO CENTRO DE REFERÊNCIA EM
SAÚDE DA MULHER EM SANTARÉM-PA.

Isabel Silva Santos, Marcela Godinho Miranda do Vale, Marissol Rabelo de Almeida, Marina Vasconcelos
Souza, Gabriela Silva dos Santos, Taianne Kaiena Frota Oliveira e Thayse Hage Gomes Machado
isabel_santhos@hotmail.com
Universidade do Estado do Pará - UEPA

Resumo: Introdução: A gravidez promove alterações fisiológicas e anatômicas associadas às mudanças no


organismo materno necessárias ao crescimento e desenvolvimento fetal queocasionam alterações anátomo-
-funcionais como a que ocorre nos Músculos Retos Abdominais (MRA). Objetivo: Verificar a incidência da
diástase dos músculos reto-abdominais (DMRA) supra e infraumbilical relacionando com a condição de pa-
ridade. Metodologia: Estudo transversal, incluindo 79 gestantes que estavam no terceiro trimestre gestacional
e possuíam idade entre 14 e 45 anos aprovado pelo Comitê de Ética em Pesquisa da Universidade do Estado
do Pará (UEPA) nº CAAE 67637917.0.0000.5168. Foi considerada como presença de DMRA um afastamento
≥2,5 cm na região supra-umbilical e infra-umbilical avaliada a 4,5 cm acima e abaixo da cicatriz umbilical
com a gestante em posição supina, o quadril fletido e joelhos flexionados a 90º, pés apoiados no leito e mem-
bros superiores estendidos paralelos ao corpo. Nessa posição, foi solicitada a flexão anterior do tronco em
direção aos joelhos até que as espinhas das escápulas saíssem da maca. Assim, a DMRA foi analisada por meio
do teste de correlação de Pearson para verificar a correlação das variáveis do afastamento entre os MRA nos
grupos de primíparas e multíparas. Resultados: Foi obtida uma amostra de 79 gestantes, com idades de 14 a 45
anos, sendo a média de idade 27,4 anos. O presente estudo obteve um grau de diástase equivalente a valores
de 2,5 a 6,5 cm. Dessa forma, a análise demonstra que as grávidas necessitam de uma intervenção durante o
período gestacional, por apresentarem um percentual de 89,7% de diástase considerada prejudicial. Acerca da
distância média da DMRA na região supraumbilical, esta foi semelhante ao comparar o grupo das primíparas
e multíparas que tiveram os valores de 4,09 (±1,05) centímetros (cm) e 4,45 (±0,75) cm, respectivamente, sem
diferença estatisticamente significante (p=0,173). Por conseguinte, também, não houve diferença estatística
significativa (p=0,502) para a região infraumbilical entre as multíparas com média de 3,68(±0,94) cm e as pri-
míparas 3,47(±1,19) cm, considerando p<0,05. Considerações finais: Percebe-se que a diástase é significativa
entre as gestantes e independente da paridade. Desse modo, as terapêuticas para estas também devem dar o
enfoque para a região abdominal com a realização do exame físico no abdome durante as consultas pré-na-
tais para a identificação do afastamento da musculatura retoabdominal, iniciando de imediato a recuperação
precoce ou ainda trabalhando na prevenção da diástase desde o início da gravidez, independente da paridade.

Palavras-chave: Diástase,Reto do Abdome,Gestante.

156 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

TRAJETÓRIA DA LIGA ACADÊMICA DE FISIOTERAPIA DESPORTIVA DO OESTE DO


PARÁ (LAFID)

Jackson Celso Pereira Pires, Gabriela Amorim Barreto, Tamires Pereira Martins, Marcos Araújo Nunes Fi-
lho e Taianne Kaiena Frota Oliveira
jackson.pereira14@gmail.com
Universidade do Estado do Pará - UEPA

Resumo: Introdução: As Ligas Acadêmicas (LA) são entidades particulares, sem fins lucrativos, apartidárias,
não-religiosas, de duração ilimitada e de caráter multiprofissional, organizadas por discentes universitários,
buscando incentivar o estudo de um determinado assunto, incentivar o desenvolvimento de projetos científicos
e a atividade assistencial à comunidade. A Liga Acadêmica de Fisioterapia Desportiva (LAFID) da Universi-
dade do Estado do Pará (UEPA) foi fundada em vinte e quatro de abril de dois mil e dezessete (24/04/2017)
por acadêmicos do curso de Fisioterapia da UEPA Campus-XII, no município de Santarém-Pará. A Resolução
do Conselho Federal de Fisioterapia e Terapia Ocupacional (COFFITO) n° 336 de 08/11/2007 dispõe sobre as
especializações profissionais da Fisioterapia e sobre registros profissionais de títulos de especialidades. Reco-
nhece, ainda, a especialidade de Fisioterapia Esportiva. Cabe ao Fisioterapeuta, então, atuar desde a promoção
de atenção básica direta a saúde do paciente bem como na sua eleição e execução de métodos fisioterapêuticos
pertinentes a este. Em vista disso, a LAFID tem como objetivo colaborar com estudos e discussões na área des-
portiva, propondo avanços com embasamento científico. Metodologia: Participação dos membros em estudos
de casos clínicos, realização de cursos para aprimoramento de conhecimento, estágio em clubes de futebol e
clínicas de reabilitação desportiva, realização de eventos científicos dentro da universidade, produção e publi-
cação de artigos relacionados com as vivências, além da realização de aulas abertas de cunho teórico-prático a
cada quinze dias. Resultados: Maior integração do curso de Fisioterapia com a comunidade externa, realização
de projetos de pesquisa, constituindo novas fontes de conhecimento pertinentes, maior domínio técnico dos
acadêmicos a cerca da Fisioterapia Desportiva e suas ramificações e na aquisição de experiência dos mesmos
na abordagem a pacientes no desporto, além do incremento curricular. Conclusão: Portanto, a LAFID, projeto
essencialmente acadêmico, surgiu da necessidade de maior conhecimento em traumato-ortopedia e desporto.
Ela se propõe a melhorar o embasamento teórico-prático do estudante de fisioterapia, através de atividades
orientadas por especialistas na área. Suas atividades contribuirão com o amadurecimento acadêmico e am-
pliará a transferência de conhecimentos entre docente e discente. O que enriquecerá o currículo do último e
ajudará na futura escolha da área de atuação (especialização) com maior precisão.

Palavras-chave: Fisioterapia Desportiva,Liga Acadêmica,Especialização

157 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ADOLESCENTES EM CONFLITOS COM A LEI:MEDIDAS SOCIOEDUCATIVAS

Rafaela Almeida Amorim, Roberta Silva Pereira , Natalia Jesus Sarmento E Maria Das Dores Carneiro Pi-
nheiro
jackson.pereira14@gmail.com
Instituto Esperança de ensino superior - IESPES

Resumo: ADOLESCENTES EM CONFLITOS COM A LEI:MEDIDAS SOCIOEDUCATIVAS Rafaela de


Almeida Amorim¹ Roberta Silva Pereira ² Natalia de Jesus de Sarmento³ Maria das Dores Carneiro Pinheiro4
Estatuto da Criança e do Adolescente – ECA criado em 13 de julho de 1990, formulado com o intuito de bus-
car resultados mais concretos para as formas de responsabilização da criança e do adolescente infrator,tendo
como proposta primordial as garantias da criança e adolescente, propondo uma politica que atenda a infância
e juventude, e como a mesmo está inserida na sociedade apropria-se do conceito de comunidade e sua ideolo-
gia de dominação, sujeitando os aspectos familiarescomo intermediadores ou possíveis culpados.O presente
estudotem como finalidade de discutira respeito das medidas socioeducativas aplicadas para o adolescente
infrator. quanto á sua reintrodução na sociedade.Metodologicamente o estudo caracterizou-se como descritivo
exploratório e, se apoia em uma base teórica, por meio da pesquisa bibliográfica constituída pela análise de
textos publicados, tanto na literatura especializada, como em meios eletrônicos.Quanto aos resultados ressal-
ta-se que perante o ato infracional cometido o adolescente, será responsabilizado por meio de processo legal,
que poderá estabelecer sanções, sob a forma de medidas socioeducativas, cuja aplicação deverá levar em conta
a sua inerente situação de desenvolvimento físico, social e psicológico. Desta forma aovincula-se o propósito
de tais medidas, que visa possibilitar ao jovem infrator, um despertar para a sua responsabilidade social, sus-
citando um novo projeto de vida que o liberte do crime, através da sua reintegração familiar e social. Palavras
– Chave: Ato infracional, medidas socioeducativas, sociedade, adolescente. 4Psicóloga e Pedagoga.
Docente do Instituto Esperança de Ensino Superior – IESPES, pinheirodas@yahoo.com.br

Palavras-chave: ato infracional,medida socioeducativas,sociedade,adolecentes

158 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

DENTES SUPRANUMERÁRIOS: REVISÃO DA LITERATURA E RELATO DE CASO

Thayane Magalhães de Oliveira Birro, Aldenir Ferreira Silva, Jaqueline Maria Cunha Portela, Andressa
Kassiane Oliveira Sousa Palmitesta, Maria Thayna Xavier Oliveira, Vinícius Fernandes Pedroso, Vivian
Pereira Maia Teixeira e Verena Pereira Maia Miranda
tbirro20@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: Uma arcada dentária completa de um adulto deve conter 32 dentes no seu total, portanto, se houver
mais, pode-se dizer que este paciente possui um (ou mais) dentes supranumerários. Os dentes supranumerários
também podem ser conhecidos como dentes extranumerários. Neste contexto, o objetivo do presente trabalho
é de realizar uma revisão de literatura em livros e periódicos acerca do tema, e relatar um caso de múltiplos
elementos supranumerários. A forma mais comum de dente supranumerário é o mesiodente, que fica posi-
cionado entre os dentes da frente na arcada superior, seguida da presença de quatro molares e pré-molares
extranumerários. A presença de dentes supranumerários pode ocorrer tanto na dentição decídua, não sendo
muito comum na segunda, podendo causar problemas na erupção e correto posicionamento dos dentes da série
normal. A literatura relata que a etiologia para esses casos ainda não é muito bem compreendida e permanece
obscura. Os dentes supranumerários podem ser únicos ou múltiplos, sendo a ocorrência de múltiplos consi-
derada pela literatura como um fenômeno pouco comum. O caso em questão, trata-se de um paciente do sexo
masculino, de 23 anos de idade, que procurou tratamento ortodôntico queixando-se da estética e alinhamento
dos dentes, e após o exame radiográfico constatou-se que este possuía 5 dentes supranumerários inclusos,
sendo dois molares superiores (quartos molares), um localizado no lado direito e outro no lado esquerdo, um
pré-molar inferior do lado direito e dois pré-molares inferiores do lado esquerdo. O paciente negou ter conhe-
cimento de tal condição. O tratamento foi realizado por uma equipe multidisciplinar, sendo removidos todos
os 5 dentes supranumerários por um cirurgião buco-maxilo-facial, seguido de tratamento, conclui-se que o
exame radiográfico prévio à qualquer tratamento odontológico é imprescindível, pois é capaz de diagnosticar
patologias assintomáticas, bem como a atuação de equipe multiprofissional no âmbito da odontologia é de
suma importância para o sucesso do tratamento odontológico.

Palavras-chave: Dentes supranumerários, radiografias, diagnóstico clínico

159 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

OSTEDISTROFIA RENAL ASSOCIADO COM TUMOR MARROM DO HIPERPARATIREI-


DISMO NA MANDÍBULA: RELATO DE CASO

Thayane Magalhães de Oliveira Birro, Jaqueline Maria Cunha Portela, Letícia Cunha Aguiar, Gabriel
Zwink, Danillo Emanoel Riker Campos, Karine Rodrigues do Nascimento, Daniel Berreta Moreira Alves e
Verena Pereira Maia Miranda
tbirro20@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: A osteodisfagia renal (OR) é o termo usado para descrever as alterações ósseas decorrentes dos dis-
túrbios do metabolismo mineral nos pacientes com doença renal crônica (DRC). São divididas em alterações
como: doenças de alta e baixa remodelação óssea. A OR se desenvolve quando o paratormônio é produzido
continuamente em resposta aos níveis baixos de cálcio sérico da DRC. Independente da etiologia, do tempo
de doença renal, da modalidade dialítica, os pacientes com DRC sempre apresentam algum grau de alteração
óssea. A persistência da OR permite o desenvolvimento de outras lesões ósseas, tal como o tumor marrom
do hiperparatireoidismo (TMH). A osteodistrofia renal pode levar a expansão localizada ou difusa dos ossos
maxilares, podendo apresentar radiograficamente a imagem de “vidro despolido”, devido a diminuição da
densidade do trabeculado ósseo. O TMH apresenta radiograficamente imagens radiolucidas bem delimitadas
uni ou multiloculadas, podendo gerar expansão de corticais ósseas. O objetivo desse trabalho é relatar um
caso de OR associada com TMH na mandíbula e realizar uma breve revisão de literatura sobre o assunto,
utilizando como metodologia a pesquisa sobre o tema em artigos científicos e livros específicos da área odon-
tológica. O presente trabalho relata o caso de uma paciente do sexo feminino, 16 anos de idade, melanoderma,
que se submete a hemodiálise à 3 anos, encaminhada pelo Hospital Regional do Baixo Amazonas (HRBA)
para a clínica de odontologia da Fundação Esperança devido a presença de lesão nodular associada ao dente
36, caracterizada pela presença de tecido mole hiperplásico e mobilidade dental Ao exame físico a paciente
apresenta aparente expansão maxilofacial, Na radiografia panorâmica e tomografia computadorizada de feixe
cônico, apresenta expansão e alteração da densidade óssea maxilomandibular com aspecto de vidro despolido,
impacção dos dentes 13, 23, 33 e 43, e área osteolística na região retromolar envolvendo a região do dente
37, apical do dente 36 e germe do 38. O tratamento medicamentoso dos níveis de paratormônio de paciente,
evoluindo para a melhora do quadro. Ainda que alguns autores recomendem o tratamento cirúrgico, sugere-se
cautela na tomada da decisão, pois o controle das alterações sistêmicas da doença pode evitar o procedimento
cirúrgico. O cirurgião dentista deve reconhecer as manifestações orais da OR para trabalhar integrado com a
equipe multiprofissional e conduzir de forma adequada a conduta terapêutica desses pacientes.

Palavras-chave: Osteodistrofia renal, tumor marrom do hiperparatireoidismo, radiografia panorâmica, tomo-


grafia computadorizada de feixe cônico

160 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

BRINCADEIRAS E JOGOS: INSTRUMENTOS QUE DESENVOLVEM HABILIDADES NA


EDUCAÇÃO INFANTIL

Ingrid Mendes Pantoja e Maelly Larissa Mendes Pantoja


ingridmendesstm@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: As brincadeiras e jogos são práticas comuns entre as crianças. O Aprender e o Brincar torna-se com-
plementares quando conduzido de maneira direcionada seguindo o objetivo de aprender alguma habilidade
Este ensaio teórico, teve como objetivo mostrar a importância das brincadeiras e jogos no desenvolvimento da
criança na Educação Infantil. A faixa etária das crianças que fazem parte da Educação Infantil são 0 a 5 anos,
o que caracteriza a inserção das crianças antes do ensino obrigatório. Nesta fase, a criança precisa ser estimu-
lada para desenvolver suas potencialidades, por meio de um ambiente seguro para interagir da maneira mais
autônoma possível, e todo esse processo culmina a partir do auxílio de um professor. A utilização de brincadei-
ras e jogos desenvolve o imaginário das crianças, o movimento ritmado, a coordenação motora, a atenção, o
estímulo ao conhecimento, a inteligência emocional, ou seja, influencia a formação do aluno de modo integral
no aspecto físico, intelectual e social. Mas, para que isso ocorra de maneira satisfatória no ambiente escolar na
educação infantil faz-se necessário a sistematização dos conteúdos com as brincadeiras e os jogos pelo profes-
sor, para que sejam planejados e direcionados de forma lúdica e inter-relacionada com o cotidiano escolar, no
intuito de desenvolver habilidades dos alunos; e que acima de tudo, se torne prazeroso para os alunos. Dessa
forma, é fundamental a prática pedagógica dos professores da educação infantil incluir de forma mais efetiva
o brincar, algo que flui com naturalidade, no âmbito de ensino-aprendizagem das crianças, não apenas com o
intuito de dinamizar a aula, e sim uma técnica direcionada para estímulo e aprendizagem das crianças.

Palavras-chave: Psicopedagogia, Educação Infantil, Jogos e Brincadeiras.

161 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ASSISTÊNCIA MULTIPROFISSIONAL AOS PACIENTES ACAMADOS DA ESTRATÉGIA


DE SAÚDE DA FAMÍLIA II DO BAIRRO SANTARENZINHO NO MUNICÍPIO DE SANTA-
RÉM- PARÁ

Eliane Da Silva Gambôa, Jenifer Maria Da Silva Ribeiro, Darlene De Silva Guimarães, Fabriane Ramos
Oliveira E Maria Da Conceição Cavalcante Farias
elianegamboa@yahoo.com.br
FACULDADE DA AMAZÔNIA - UNAMA

Resumo: INTRODUÇÃO: O presente relato foi desenvolvido durante o estágio supervisionado em Saúde
Coletiva I, do Curso de Graduação em Enfermagem da UNAMA – Faculdade da Amazônia, em uma unidade
básica de saúde, no município de Santarém-PA. Durante o período de realização dessa atividade se oportuni-
zou participar de visitas domiciliares a pacientes acamados, salientando a importância do aprendizado a partir
de experiências vivenciadas na comunidade. REVISÃO DA LITERATURA: A atenção prestada aos pacientes
acamados na Estratégia de Saúde da Família (ESF) se caracteriza por um conjunto de ações de promoção a
saúde, prevenção, tratamento de doenças e reabilitação prestada a domicílio. Para que haja a garantia de uma
assistência qualificada é necessário que vários profissionais estejam envolvidos nesse processo, compondo
assim uma equipe multiprofissional. METODOLOGIA: Trata-se de um estudo qualitativo, exploratório, do
tipo relato de experiência. RESULTADOS: Durante as visitas domiciliares, observou-se como é realizada a
assistência multiprofissional aos acamados em âmbito domiciliar. A equipe é composta por médico, enfermei-
ro, técnico de enfermagem e Agentes Comunitários de Saúde (ACS), para cada um compete uma função espe-
cífica e as visitas seguem um roteiro pré-definido pela enfermeira responsável pela ESF. Ao médico compete
realizar a consulta, avaliando aspectos indicativos de agravos à saúde, solicitação e interpretação de exames,
e prescrições de medicamentos. O enfermeiro, por sua vez, se responsabiliza por avaliar a moradia e buscar
agravantes à saúde, bem como, realizar orientações para a promoção à saúde, e auxilia o médico nos proce-
dimentos a serem realizados. Já o técnico de enfermagem realiza a verificação de pressão arterial, glicemia
capilar, peso e demais medidas antropológicas dos integrantes das famílias. Aos ACS compete a função de
orientar toda a equipe no trajeto e esclarecer questões referentes ás famílias, pois este profissional é o que está
mais em contato com a comunidade. CONCLUSÃO: A assistência de enfermagem prestada diretamente nos
domicílios possibilita o reconhecimento real da situação de saúde das famílias dentro das microáreas demar-
cadas, além disso, facilita o acesso da comunidade ao serviço de saúde.

Palavras-chave: Assistência multiprofissional,Estratégia de Saúde da Família,Pacientes acamados

162 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

CARACTERIZAÇÃO E EPIDEMIOLOGIA DOS CASOS DE MALÁRIA NO MUNICÍPIO DE


ITAITUBA, ESTADO DO PARÁ, BRASIL

Dyoliane Paz Sousa e Jossehan Galúcio da Frota


enf_dyulipaz@hotmail.com
Faculdade de Itaituba - FAI

Resumo: A malária é uma doença infecciosa e endêmica, causada por uma espécie parasitária chamada de
Plasmodium. No Brasil só há registros de infecção por três espécies, são eles: P. vivax, P. falciparum e P. ma-
lariae. Esta patologia é conhecida ainda como um grande problema de saúde pública mundialmente. Os dados
encontrados no Município de Itaituba são apenas primários, não existindo informações relacionadas à epide-
miologia dessa doença. O presente estudo tem como objetivo principal conhecer o número de casos e o perfil
epidemiológico das pessoas com malária no Município de Itaituba, Estado do Pará. O estudo foi realizado no
Município de Itaituba, Estado do Pará. No qual foram utilizados dados do Sistema de Informação de Vigilân-
cia Epidemiológica (SIVEP - malária), entre os anos de 2000 a 2016, disponibilizado pelo setor de endemias
do município. No período estudado, Itaituba notificou 84.469 casos positivos de malária. O maior número de
casos registrado foi em 2012 (n= 14.381) e o menor número de casos registrados foi em 2016 (n = 1.907). Em
relação ao sexo, o maior índice detectado foi no sexo masculino (71,0%;n= 59.760). Quanto aos agentes etio-
lógicos, a maioria foi causada pelo Plasmodium vivax (63,8%; n= 50.879), seguido de P. falciparum (36,1%;
n= 28.916). Dentre as localidades, duas apresentaram um maior número de incidência pela malária, que foi o
Garimpo do Mamoal e o Garimpo Tocantins. Para o número de óbitos em Itaituba, foram registrados dados
de 2000 a 2016, com total de 54 casos. O ano de 2004 apresentou o maior índice de óbito (26,0%; n = 14). O
presente estudo vem contribuir com o conhecimento da malária e mostrar que apesar dos dados terem dimi-
nuído, é importante que mantenha o seu controle através de aplicação de meios profiláticos, com diagnóstico
e tratamento precoce, para que essa doença não volte a se intensificar.

Palavras-chave: Plasmodium,Itaituba,Malária

163 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

LEARNING EXPERIENCE: UMA ABORDAGEM SOBRE NOVAS METODOLOGIAS DE


APRENDIZAGEM

Aloísio Costa Barros e Andrik Guimarães Ferreira


aloisio.stec@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: Conforme a sociedade evolui, novos métodos de aprendizagem surgem a fim de dinamizar as trocas
de experiências e conhecimento entre as pessoas. A partir daí fica visível o conceito de educação aberta, onde
sua referência traz a reflexão de uma educação livre onde boas ideias são compartilhadas entre educadores,
estudantes e comunidade em geral. Segundo Perestroika (2015) esta metodologia de educação é construída
sobre a premissa de que todos devem ter a liberdade de usar, personalizar, melhorar e redistribuir os recursos
educacionais, sem restrições. Baseado neste contexto, o presente trabalho tem por objetivo investigar a evolu-
ção dos novos métodos educacionais através da ação global do Learning Experience (Experiência de Apren-
dizado), apoiado em uma revisão bibliográfica como percurso metodológico para esta produção. A Learning
Experience é um processo criativo e mais fluído, se comparado aos métodos tradicionais, em outras palavras a
metodologia proporciona maior liberdade na interação entre aluno e conteúdo assim como pessoas e ambiente.
Assim sua proposta é que, durante o aprendizado, o local deve proporcionar o co-working e o co-learning,
ou seja, ideias precisam ser trocadas, dúvidas compartilhadas, soluções criadas em conjunto usando várias
“cabeças” com diferentes qualidades, desta forma resgata a teoria de Araújo (2008) “A teoria construtivista
oferece subsídios valiosos à compreensão da aprendizagem como um processo construtivo e significativo”.
Piaget também prioriza a interação entre sujeito e objeto e destaca que o crescimento cognitivo se dá a partir
da ação do indivíduo sobre o objeto de seu conhecimento. O relatório da Unesco define 4 pilares da Educação
para o século XXI: Aprender a Conhecer, Aprender a Fazer, Aprender a Conviver e Aprender a Ser. O pri-
meiro entende-se como a escola no dever de ter um processo divertido, o segundo refere-se a estimular para
concretizar as ideias e projetos das pessoas, o terceiro baseia-se que as ideias e projetos são compartilhados
e, quarto, no qual a troca de experiência transforma a vida do cidadão. Portanto, a metodologia mencionada
pode proporcionar aprendizado significativo, se for conduzida conforme sua proposta, unindo entretimento e
construção colaborativa.

Palavras-chave: Learning Experience,Educação,Metodologias

164 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

SOBREPESO E OBESIDADE EM ESCOLARES DO MUNICIPIO DE SANTARÉM-PA

Gabriela Conceição Da Silva Rodrigues, Laryssa Trindade, Anna Claudia Soares Silva, Anna Júlia Pimen-
tel Silva E Silvania Yukiko Lins Takanashi
gabi-sr1@hotmail.com
Universidade do Estado do Pará - UEPA

Resumo: A obesidade infantil tem se apresentado como um sério problema de Saúde Pública, sendo justificado
pelo aumento na taxa de incidência entre crianças e adolescentes que é preocupante, pois o excesso de gordura
corporal, principalmente na região abdominal, está intimamente relacionada com alterações do perfil lipídico,
o aumento da pressão arterial e a hiperinsulinemia, sendo estes fatores de risco para o desenvolvimento de
doenças crônicas, como o diabetes melitos tipo 2, doenças cardiovasculares e ainda, a síndrome metabólica.
Dessa forma, foi traçado como objetivo verificar a incidência de sobrepeso e obesidade em escolares no mu-
nicípio de Santarém-Pa. Sendo a pesquisa caracterizada como estudo epidemiológico, quantitativo,descritivo
e transversal, realizado em duas (02) instituições da rede particular de ensino, localizadas no município de
Santarém. A pesquisa teve como participantes adolescentes entre 11 a 17 anos, que cursavam o Ensino Fun-
damental e Médio, totalizando uma amostra de 93 escolares. Foram avaliados 93 escolares das instituições
inclusas na pesquisa, com idade entre 11 e 17 anos, apresentando uma maior prevalência do sexo feminino
59% (n=55) entre os participantes da pesquisa. Em relação à classificação do Índice de Massa Corpórea (IMC)
20% apresentavam magreza, 54% normalidade, 14% sobrepeso, 10% obesidade e 1% obesidade grave. A
circunferência abdominal (CA) foi avaliada com base no percentil relacionado à faixa etária correspondente e
sexo, sendo identificada uma maior prevalência do sexo feminino acima do percentil 90, com 64% (n=35). O
sexo masculino apresentou 43% (n=16) de indivíduos com percentil acima de 90. Dessa forma, é necessário a
maior atenção dos pais e responsáveis quanto à dieta, principalmente, no que diz respeito ao consumo exces-
sivo de alimentos industrializados; e a realização de uma fiscalização dos lanches escolares a fim de se obter
uma alimentação mais saudável. Sensibilizando, consequentemente, as crianças e adolescentes para adoção de
hábitos de vida saudáveis como alimentação e atividade física, conduzindo-os a reproduzi-los na vida adulta e,
por conseguinte, diminuir o risco de doenças crônico-degenerativas. O fato é que estamos diante de um grave
problema de Saúde Pública que deve ser tratado como prioridade, já que traz consigo consequências.

Palavras-chave: crianças,Adolescentes,Sobrepeso,Obesidade

165 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ANSIEDADE E DESESPERANÇA NO PACIENTE RENAL CRÔNICO EM HEMODIÁLISE

Lorenna de Lima Batista Conceição, Rayane Souza Santos e Fernanda Tabita Zeidan De Souza
lorennabatista77@gmail.com
Instituto Esperança de Ensino Superior - IESPES1, Cognitiva Scientia - , COGNITIVA SCIENTIA1, Instituto
Esperança de Ensino Superior - , IESPES3 e Cognitiva Scientia - e COGNITIVA SCIENTIA4 e Instituto Es-
perança de Ensino Superior - e IESPES5

Resumo: A ansiedade é a sensação incômoda de medo e/ou tensão, decorrente da identificação do indivíduo de
uma possível grande ameaça. Já a desesperança é definida pela falta de interpretações positivas sobre o futu-
ro. Assim, entende-se que a presença de ansiedade e desesperança no paciente renal crônico pode influenciar
negativamente na sua qualidade de vida. A relevância do tema se caracteriza por ser uma crítica ao modelo
biomédico que impossibilita práticas de saúde baseadas na importância da relação entre os aspectos psicológi-
cos com os sintomas físicos. Desse modo, a hipótese inicial foi a existência de ansiedade e desesperança nos
pacientes que realizam tratamento em hemodiálise, com importantes correlações entre fatores sociodemográ-
ficos com os níveis de ansiedade e desesperança dos participantes. Portanto, o estudo objetivou identificar a
correlação de variáveis sociodemográficas com a presença de ansiedade e desesperança em pacientes que rea-
lizam tratamento hemodialítico na cidade de Santarém-PA. A amostra da pesquisa foi de 37 pacientes que rea-
lizam tratamento hemodialítico três vezes por semana, com 40 à 60 anos, com ensino fundamental, de ambos
os sexos e ocorreu no Hospital Regional do Baixo Amazonas Dr. Waldemar Penna em Santarém-PA. Quanto
a metodologia, o estudo é de campo, exploratório, descritivo, transversal e quantitativo. Os instrumentos uti-
lizados foram: entrevista estruturada, Inventário de Ansiedade de Beck (BAI) e Escala de Desesperança Beck
(BHS). A análise estatística dos dados foi realizada pelo software SPSS. O estudo foi aprovado pelo Comitê
de Ética Nº CAAE: 69475817.2.0000.8070 e seguiu as normas da Resolução 466/2012. Os resultados do BAI
e BHS apontaram a presença de ansiedade e desesperança nos participantes nos níveis: mínimo, leve, mode-
rado e grave, de forma que o nível leve prevaleceu entre os participantes tanto de ansiedade (32,4%) quanto
para desesperança (37,8%). Para o nível grave, ressalta-se os valores de ansiedade (16,2%) e desesperança
(10,8%). Sobre os aspectos sociodemográficos, os participantes não-otimistas (92,9%) apresentaram maior
ansiedade e os que vivem exclusivamente de pensão/aposentaria (86,9%) apresentaram maior desesperança.
Alguns autores afirmam que a DRC é considerada uma das primeiras no topo de patologias crônicas que apre-
sentam os maiores indicadores de depressão e ansiedade. Diante do que foi exposto, conclui-se que existe uma
grande necessidade de realização de novos estudos que abordem essa temática para que sejam promovidos
projetos de intervenções terapêuticas que reduzem os vários prejuízos e o alto índice de morbidade gerado
pelo tratamento hemodialítico.

Palavras-chave: Ansiedade;,Desesperança;,Hemodiálise;

166 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PERFIL EPIDEMIOLÓGICO E CARACTERIZAÇÃO DOS CASOS DE HIV (AIDS) NO MU-


NICÍPIO DE ITAITUBA, ESTADO DO PARÁ, BRASIL

Jacira Ribeiro de Lima Sousa e Jossehan Galúcio da Frota


Jaciraribeirolima@gmail.com
Faculdade de Itaituba - FAI

Resumo: A síndrome da imunodeficiência adquirida (Aids) é definida como uma das mais graves doenças no
mundo inteiro, tornando-se relevante desafio para a saúde publica. No Brasil, desde o início da epidemia até
2016, ocorreram cerca de 842.710 casos positivos. Foi aumento de 2% na taxa de diagnóstico de HIV no Brasil
últimos anos, com a Região Norte liderando com 92,7% dos casos. O Pará está entre os estados brasileiros
com maior número de casos. Porém esses números são desconhecidos nos municípios de pequeno e médio
porte em sua maioria. Itaituba está entre esses de pequeno porte, pois, contem menos de 100 mil habitantes
e nenhum estudo tinha sido realizado até o momento na região. O estudo tem como objetivo, conhecer o nú-
mero de casos e o perfil epidemiológico das pessoas diagnosticadas com vírus HIV no Município de Itaituba,
no período de 2004 a 2014. Esse trabalho foi realizado no Município de Itaituba, Estado do Pará. Os dados
foram coletados em dezembro de 2017, no Centro de Testagem e Aconselhamento. Foram encontrados 242
pessoacom HIV. A pesquisa foi autorizada pelo Comitê de Ética e Pesquisa da Universidade do Estado do
Pará, Campus XII – Santarém (CAAE: 77542717.9.0000.5168). Do total de casos com o vírus HIV entre 2004
e 2014, o menor registro foi em 2005 (4,9%; n= 12) casos positivos e o maior registro foi em 2014 (21,5%;
n= 52). Com Relação ao sexo, a maioria (55,4%; n= 134) é do sexo masculino. A faixa etária variou de um
a 70 anos. A maioria tem ensino fundamental incompleto. Foram identificados 43 óbitos. O presente estudo
corrobora em muitos aspectos a média nacional, além de revelar uma tendência de crescimento no número de
casos. Nota-se ainda, que a situação do município até 2013 era endêmica, tornando-se epidêmica em 2014,
sendo esse último o ano com maior número de casos.

Palavras-chave: Epidemia,HIV,Tapajós

167 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

SISTEMATIZAÇÃO DA ASSISTÊNCIA DE ENFERMAGEM AO PACIENTE PEDIÁTRICO


COM ARTRITE SÉPTICA DO QUADRIL: UM RELATO DE CASO

Adria Paiva Rascon, Alessandro Santos Bonfim Almeida, Greice Nivea Viana dos Santos e Marnie Figueire-
do Ferreira
adriarascon@gmail.com
Universidade do Estado do Pará - UEPA

Resumo: A artrite séptica (artrite bacteriana, artrite piogênica, artrite supurativa, artrite purulenta, pioartrose)
é definida como invasão bacteriana do espaço articular, com consequente inflamação. Esta afecção é mais co-
mum na faixa etária infanto-juvenil, sendo que aproximadamente metade dos casos ocorre antes dos 20 anos
de idade (com predomínio nos menores de 3 anos), tem incidência de 5,5 a 12 casos em cada 100.000 crianças,
e o sexo masculino é duas a três vezes mais atingido do que o feminino.Objetivo: Descrever o caso clínico de
uma criança com artrite séptica de quadril com ênfase na implementação da Sistematização da Assistência de
Enfermagem (SAE). Metodologia: Trata-se de um estudo descritivo, do tipo relato de caso realizado no mês de
março de 2018 com um paciente (criança) com diagnóstico de Artrite séptica do quadril durante seu período de
internação na clínica pediátrica do Hospital municipal de Santarém Pará. Resultados e discussão: Paciente do
sexo masculino, 7 anos de idade, procedente do Município de Itaituba, reside na aldeia indígena Munduruku.
Deu entrada no PSM no dia 05/03/18 com um quadro de hipertermia, dificuldade de deambulação, edema
e sinais de flogose em quadril direito. O mesmo teve queda da própria altura no dia 25/02/18, foi levado ao
hospital do Município dias após a queda, e encaminhado para o Pronto Socorro Municipal em Santarém onde
foi solicitado Raio-x do quadril e USG, os quais evidenciaram a presença de conteúdo liquido na articulação
do quadril direito, fechando assim, o diagnóstico de Artrite da articulação coxo-quadril direito.Considerações
finais: A Sistematização da Assistência de Enfermagem constitui um papel fundamental no atendimento ao
paciente, visto que possibilita ao profissional enfermeiro individualizar suas ações e torná-las mais holística
e humanizada.A artrite séptica é uma infecção relativamente frequente, principalmente se comparada a outras
doenças ortopédicas, que tem progressão rápida, porém, de difícil diagnóstico em um primeiro momento,
tornando-se grave e exigindo cuidados constantes. Entre estes destacaram os cuidados de enfermagem com a
identificação precoce dos sinais e sintomas, mobilização e educação em saúde.

Palavras-chave: Artrite piogênica, Cuidados de enfermagem, Pediatria.

168 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

DOENÇAS CAUSADAS POR PROTOZOÁRIOS INTESTINAIS NO MUNICÍPIO DE ITAITU-


BA, ESTADO DO PARÁ, BRASIL

Jossehan Galúcio da Frota e Jessica Leandro de Brito


jgfrota@gmail.com
Faculdade de Itaituba - FAI

Resumo: As enteroparasitoses causadas por protozoários são um grave problema de saúde pública. Elas são
decorrentes de diversos fatores e normalmente, geram sérias complicações não só na mucosa intestinal, mas
também, em diversos órgãos, provocando, disenteria, esteatorreia, febre, entre outros e que se não for tratada
pode levar ao óbito. Na região do Município de Itaituba, não existem estudos sobre as doenças causadas por
parasitas intestinais e nem dados epidemiológicos relacionados. Por esse motivo, pretende-se conhecer as
principais doenças, descrever seus agentes etiológicos do grupo dos protozoários e seus aspectos epidemioló-
gicos dos casos registrados no município. Este trabalho foi realizado no Laboratório de Análises Clínicas do
Hospital Municipal de Itaituba, no Município de Itaituba, Estado do Pará, no período de 05 de outubro a 09
de novembro de 2016. Das 215 amostras examinadas nesse estudo, 45,1% (n = 97) foram diagnosticadas com
algum tipo de parasita protista intestinal. As doenças registradas nessas amostras foram: amebíase (57,6%),
seguida de blastocistose (22,4%) e giardíase (6,4%). Foram encontradas seis espécies de protozoários na
forma cística, os de maior prevalência foram: Endolimax nana (55,2%; n= 69), Blastocystis hominis (22,4%;
n= 28), Entamoeba coli (7,2%; n= 9), Giardia lamblia (6,4%; n= 8), Iodamoeba butschlii (6,4%; n= 8) e Enta-
moeba histolytica (2,4%; n= 3). Das amostras positivas, 64,9% (n= 63) foram registradas no sexo feminino e
35,0% (n= 34) no sexo masculino. Cerca de 73,2% (n= 71) dos casos apresentaram apenas um tipo de parasita
(monoparasitadas) e 26,8% (n= 26) apresentaram dois ou mais parasitas (poliparasitadas). Em relação a faixa
etária, foram identificadas pessoas infectadas entre 01 e 80 anos de idade, sendo a prevalência maior entre
indivíduos de 21 a 30 anos (18,4%; n= 23), e a menor entre indivíduos de 71 a 80 anos (4,0%; n= 5). Ações
educativas devem ser implantadas nos bairros do município, com apoio dos agentes de saúde e enfermeiros
das unidades básica (com o apoio do governo municipal), com visitas as residências com o objetivo de orientar
as famílias sobre o que fazer para evitar a contaminação de agentes parasitológicos, esclarecendo o que cada
agente pode causar no organismo do indivíduo parasitado, orientando-os a procurar atendimento de saúde pelo
menos de 6 em 6 meses, para realizar exames parasitológicos de fezes e tomar medicações para verminoses
como medida preventiva.

Palavras-chave: Protozoários,Endoparasitoses.,Amebíase

169 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

SISTEMATIZAÇÃO DA ASSISTÊNCIA DE ENFERMAGEM A UM PACIENTE COM DIAG-


NÓSTICO DE FRATURA DIAFISÁRIA DE FEMUR: UM RELATO DE CASO

Adria Paiva Rascon, Alessandro Santos Bonfim Almeida, Greice Nivea Viana dos Santos e Marnie Figueire-
do Ferreira
adriarascon@gmail.com
Universidade do Estado do Pará - UEPA1, UNIVERSIDADE DO ESTADO DO PARÁ - , UEPA2, Universi-
dade do Estado do Pará - , UEPA3, Universidade Federal do Oeste do Pará - , UFOPA4 e Universidade do
Estado do Pará - e UEPA5

Resumo: Introdução: As fraturas da diáfise do fêmur geralmente estão relacionadas a traumatismos envolven-
do alta energia cinética como acidentes automobilísticos, quedas de altura e até acidentes de trabalho, que por
sua vez, são causas etiológicas mais frequente entre traumas ósseos. Além da lesão óssea, observa-se também
a destruição de tecidos que envolvem a estrutura do fêmur, esse fato gera um prognóstico individualizado,
principalmente no que se refere à perda de habilidade funcional. Objetivo: relatar caso clínico de um paciente
vítima de trauma ortopédico em diáfise de fêmur e realizar a Sistematização da Assistência de Enfermagem
(SAE). Método: Trata-se de um estudo descritivo, em forma de relato de caso de um paciente (adulto-jovem)
com diagnóstico de fratura exposta de fêmur, internado na clínica cirúrgica do Hospital Municipal de Santa-
rém, em março de 2018. Resultados e Discussão: Paciente, 24 anos, vítima de acidente com colisão de moto
com carro que evoluiu com dor, deformidade e limitação funcional de membro inferior direito, com presença
de lesão com cerca de 10cm em face anterior de coxa direita, apresentando ao exame de imagem radiográfica,
fratura da diáfise de fêmur. . De acordo com a SAE identificaram-se os diagnósticos: Mobilidade física pre-
judicada relacionada fratura em membro evidenciada restrição dos movimentos devido a dor e imobilização
de membro; Risco de queda relacionada mobilidade prejudicada; Déficit de autocuidado para banho e higie-
ne intima relacionada e dor evidenciado por incapacidade de acessar o banheiro; Constipação relacionada
à mudança nos padrões alimentares e atividade física insuficiente evidencia por redução de frequência de
eliminações; Potencial para risco de infecção relacionada a lesão de pele causada por tração transesquelética.
Conclusões: O estudo de caso permitiu a elaboração do processo de enfermagem ao paciente com trauma de
membro inferior, visando a redução de danos e complicações relacionadas ao trauma ortopédico, contribuindo
para a o bom prognóstico do estado clinico do paciente. Além disso, a Sistematização da Assistência de Enfer-
magem, permite organizar e operacionalizar o cuidado do indivíduo vítima de trauma ortopédico, devendo ser
efetivamente utilizada como ferramenta das intervenções dos profissionais enfermeiros, no entanto, necessita
estar pautada em conhecimentos científicos que viabilizem a tomada de decisão na escolha das intervenções de
cuidado, subsidiando o raciocínio clínico e crítico da enfermagem, estimulado também, através das discussões
entre a equipe assistencial.

Palavras-chave: Fratura de fêmur, Cuidados de enfermagem, SAE.

170 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

CUIDADOS DE ENFERMAGEM NA PREVENÇÃO E TRATAMENTO DE LESÕES POR


PRESSÃO EM PACIENTES NA UNIDADE DE TERAPIA INTENSIVA: UMA REVISÃO DES-
CRITIVA

Marnie Figueiredo Ferreira , Jair Wanderlei Arruda Pereira e Jociléia da Silva Bezerra
marnie.figueiredo@gmail.com
Universidade do Estado do Pará - UEPA1, Centro Sul Brasileiro de Pesquisa, Extensão e Pós graduação - ,
CENSUPEG2 e Iespes - e IESPES 3

Resumo: As lesões por pressão são consideradas como eventos adversos ocorridos no processo de hospitaliza-
ção, que refletem de forma indireta a qualidade do cuidado prestado. É uma complicação frequente em pacien-
tes graves e tem grande impacto sobre sua recuperação e qualidade de vida. Estudos nacionais evidenciaram
que a incidência global de lesões por pressão em pacientes hospitalizados varia de 2,7 a 29%. Esse número
eleva-se para 33% em pacientes internados em Unidades de Terapia Intensiva. Dessa forma, o objetivo desta
pesquisa foi identificar os cuidados de enfermagem mais frequentes na prevenção e tratamento das lesões por
pressão em pacientes na UTI descritos na literatura. Trata-se de um levantamento bibliográfico, descritivo,
realizado em bancos de dados virtuais no qual foram selecionados e analisados 10 artigos do período de 2006
a 2014, comparando as medidas adotadas pela equipe de enfermagem na prevenção e tratamento das lesões
por pressão. As análises constataram que as medidas de prevenção mais frequentes realizadas pela equipe de
enfermagem são a mudança de decúbito, o uso de colchão piramidal, hidratação da pele, suporte nutricional,
uso de placas de hidrocolóide preventivo e coxins nas proeminências ósseas, manutenção da pele seca e a ca-
beceira do leito elevada em até 30º. Quanto ao tratamento das lesões por pressão, a higiene corporal foi a mais
evidente seguido da realização do curativo com cobertura adequada, acompanhamento nutricional e o debrida-
mento mecânico, quando necessário. A partir dos resultados encontrados constatou-se que ainda há uma falta
de padronização do cuidado nas ações da equipe de enfermagem, fator que pode causar danos ao paciente.

Palavras-chave: Lesão por pressão. Enfermagem. UTI. Prevenção. Tratamento

171 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO DA NECESSIDADE DE TERAPIA RENAL SUBSTITUTIVA NOS CASOS DE


LEPTOSPIROSE

Gabriel castelo branco lauffer, Vanessa Vinente De Oliveira e Philippe Kalleo Sampaio Matos
lauffergabriel@hotmail.com
Universidade do Estado do Pará - UEPA1, Universidade do Estado do Pará - , UEPA2 e Universidade Fede-
ral do Oeste do Pará - e UFOPA3 e Instituto Esperança deEnsino Superior - e IESPES4 e Universidade do
Estado do Pará - e UEPA5

Resumo: A leptospirose é uma zoonose com relevância mundial, a qual representa um grande problema de
saúde pública no Brasil. Este estudo avaliou os fatores envolvidos na resolução dos casos de Leptospirose que
evoluíram com insuficiência renal aguda (IRA) sem a terapia renal substitutiva no Hospital Municipal de San-
tarém (HMS) entre 2007 e 2012. Trata-se de uma pesquisa documental, retrospectiva de abordagem quantita-
tiva. Foram analisados 26 prontuários de pacientes confirmados por sorologia para Leptospirose no banco de
dados da instituição. Os principais resultados encontrados foram: 73,07% eram homens, 42,30% tinham entre
40-59 anos, 26,92% apresentaram 1° grau incompleto, 96,15% apresentaram febre, 88,46% manifestaram
mialgia, 84,61% estavam ictéricos, resultados laboratoriais em media encontrados de Hemoglobina (11,323 g/
dL), Uréia (128,173 mg/dL), Creatinina (3,793 mg/dL) e Potássio (4,045mEq/L) séricos. Diurese preservada
em 42,3%, 53,84% fizeram uso de antibioticoterapia precoce, dos pacientes que tiveram diálise indicada 100%
tiveram oligúria, 100% tiveram escórias nitrogenadas aumentadas, 20% dialisaram precocemente, o valor dos
pacientes que obtiveram cura com diálise foi semelhantes aos que obtiveram cura sem diálise. A Insuficiência
Renal Aguda na leptospirose pode ser conduzida sem Terapia Renal Substitutiva (TRS) em algumas situações,
porém para garantir melhor prognóstico ao paciente adotando conduta conservadora (hidratação venosa vigo-
rosa), deve-se analisar um conjunto de fatores clínicos e laboratoriais que denotariam priorizar a TRS.

Palavras-chave: Leptospirose,Insuficiência Renal Aguda,Hemodiálise

172 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ATUAÇÃO DA HIDROTERAPIA EM PACIENTES COM ESCLEROSE LATERAL AMIA-


TRÓFICA: REVISÃO DE LITERATURA

Thalissa Silva Rattes, Marcela Taissa Waimer e Jose Alexandre da Silva Júnior
marcelawaimer@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: INTRODUÇÃO: A Esclerose Lateral Amiotrófica (ELA) é uma doença neurodegenerativa e fatal,
caracterizada pela degeneração dos neurônios motores, responsáveis pelo controle dos movimentos involuntá-
rios. Segundo Arcanjo et al (2009), a piscina terapêutica pode ser utilizada como um recurso para manutenção
da marcha, do equilíbrio e da qualidade vida em pacientes com ELA. Colaborando, Pinto et al (2009) afirma
que a fisioterapia aquática demonstrou ser eficaz como um método de tratamento para a melhora da qualidade
de vida. A reabilitação aquática é o tratamento mais indicado para esses pacientes, uma vez que, aquecendo
por igual todas as articulações, fornecendo suporte aos segmentos, aliviando o peso corporal e dando maior
liberdade de movimentos, auxilia na manutenção da força muscular. Podem-se associar ainda várias técnicas
e também trabalhar de uma maneira mais global e dinâmica, ou seja, com exercícios respiratórios ao mesmo
tempo em que se trabalha a musculatura postural (JAKAITIS, 2007). Os objetivos do tratamento aquático para
um paciente com ELA ou qualquer enfermidade do neurônio motor são: manutenção da força muscular, treinar
habilidades motoras finas, conscientização corporal e relação espacial, prevenção de deformidades e manuten-
ção da amplitude de movimento, das atividades funcionais, capacidade vital, controle cervical e equilíbrio. As
propriedades físicas da água são outros fatores relevantes para a maioria dos pacientes com desordens neuro-
lógicas, pois influenciam na redução da espasticidade, da rigidez articular, das tensões musculares e proporcio-
nam estímulos táteis de reprodução sistemática do movimento (MORRIS, 2000). OBJETIVO: Correlacionar à
importância da fisioterapia ao tratamento Esclerose Lateral Amiotrófica. METODOLOGIA: Trata-se de uma
pesquisa descritiva do tipo revisão bibliográfica. Foram incluídos nesta pesquisa artigos científicos e disser-
tações sobre ELA encontrados nas bases de dados do Scielo, Medline, PubMed e Google Acadêmico. Foram
considerados critérios de inclusão estudos nos idiomas português e inglês que abordassem a hidroterapia no
tratamento dos portadores de ELA, foram excluídos artigos que não apresentaram clareza. RESULTADOS:
Os estudos concordam que apesar de a ELA ser uma doença degenerativa e de rápida progressão, o tratamento
por meio da hidroterapia pode beneficiar de forma significativa os aspectos que envolvem a qualidade de vida,
a funcionalidade, força muscular e fadiga de acordo com a fase que o paciente se encontra. CONCLUSÃO: O
tratamento hidroterapêutico pode ser eficaz para os pacientes com ELA, pois pelos estudos foi observado que
o tratamento vai muito além do aspecto motor, apresentando um envolvimento de ordem psicológica, propor-
cionando uma melhor integração social do paciente.

Palavras-chave: Esclerose Lateral Amiotrófica, hidroterapia, reabilitação, efeitos terapêuticos

173 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A ASSISTÊNCIA DE ENFERMAGEM NAS ORIENTAÇÕES VOLTADAS AO ALEITAMEN-


TO MATERNO.

Juliana Viana Paz, Lídia dos Santos Carvalho, Ingrid Amaral Correa e Andréa de Sousa Costa
ju.vianapaz@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: O aleitamento materno é considerado Como principal fonte de alimento para o crescimento e o de-
senvolvimento saudável dos lactentes, sendo o único alimento capaz de atender as necessidades fisiológicas
do metabolismo das crianças menores de seis meses (MARINHO; ANDRADE; ABRÃO, 2016). Na prática
do aleitamento materno estar reconhecida a influência dos profissionais de saúde envolvidos neste processo. O
sucesso do Aleitamento Materno depende de vários fatores, dentre eles, as orientações prévias ao nascimento,
assim como no pós-parto, com os objetivos de preparar a mãe para superar as dificuldades que possam surgir,
minimizar as preocupações e fortalecer sua autoconfiança, acreditando que quanto mais instruída sobre o
assunto, maior facilidade terá para superar os obstáculos. Nesse sentido destaca-se a necessidade dos profis-
sionais de saúde estarem aptos a desenvolver ações de educação em saúde voltada a orientação do aleitamento
materno, além de identificar ainda durante o pré-natal a vivência social e familiar da gestante assim como,
garantir vigilância e efetividade durante a assistência a nutriz no pós-parto. Este estudo tem como objetivo
enfatizar a importância dos profissionais de enfermagem relacionada ao aleitamento materno, no período gra-
vídico e puerperal. Trata-se de um estudo bibliográfico, qualitativo de caráter descritivo, utilizando o banco de
dados, Scielo e Google Acadêmico, buscando referências que contemplassem a temática em questão, e foram
excluídas aquelas que não englobam a temática estudada. Dessa maneira, os profissionais de enfermagem da
equipe de saúde exercem um importante papel frente à amamentação, pois são eles quem mais se relaciona
com a mulher durante o ciclo gravídico-puerperal, lidando com as demandas do aleitamento, e por meio de
suas práticas e conhecimento técnico científico que elas podem incentivar a amamentação e apoiar as ges-
tantes, melhorando assim, os índices de aleitamento materno e, consequentemente, diminuindo os índices de
desnutrição infantil, alergias, anemias, doenças dentárias e infecções que podem elevar à mortalidade infantil,
além de diminuir as internações, custos com consultas, medicamentos e outros.

Palavras-chave: assistência de enfermagem,aleitamento materno,orientação.

174 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO DA SÍNDROME DE BURNOUT RELACIONADA COM A PRÁTICA DE ATIVI-


DADE FÍSICA EM ESTUDANTES DE MEDICINA

gabriel castelo branco lauffer, Vanessa Vinente De Oliveira e Zilma Nazaré Souza de Pimentel
lauffergabriel@hotmail.com
Universidade do Estado do Pará - UEPA1, Universidade do Estado do Pará - , UEPA2 e Universidade Fede-
ral do Oeste do Pará - e UFOPA3 e Instituto Esperança de Ensino Superior - e IESPES4 e Universidade do
Estado do Pará - e UEPA5

Resumo: A Síndrome de Burnout é uma condição psicológica resultante de estressores interpessoais crônicos
no trabalho e caracteriza-se por: exaustão emocional, despersonalização (ou ceticismo) e diminuição da rea-
lização pessoal (ou eficácia profissional). Acomete, principalmente, profissionais em contato direto com as
pessoas e expostos a uma sobrecarga de trabalho. A qualidade de vida pessoal envolve diversos fatores, dentre
eles o bem-estar físico e mental. E este estudo também busca avaliar e relacionar as condições de saúde tanto
física quanto mental, dos possíveis alunos que convivem com estresse diário e não realiza atividade física,
o que pode agravar o quadro da Síndrome de Burnout e trazer complicações cardiovasculares futuras para
cada individuo. Com base na revisão da literatura, foram formuladas as seguintes hipóteses: a Síndrome de
Burnout está presente nos alunos de graduação dos cursos de medicina; os estudantes de medicina apresentam
um nível baixo de atividades físicas; a síndrome de Burnout é mais frequente em alunos sedentários e/ou com
baixos níveis de atividade física. A presente pesquisa buscou analisar a ocorrência da Síndrome do estresse
em acadêmicos de medicina do município de Santarém-PA. Tendo como objetivo geral avaliar a Síndrome de
Burnout relacionado com a prática de atividade física em estudantes de medicina. A pesquisa foi de caráter
quantitativo, descritivo e de campo, além de adotar como instrumento uma versão adaptada do MaslachBur-
noutinventory – StudentSurvey (MBI-SS), que avalia as três dimensões do burnout:EE, DE e EP. O estudo
voltou-se mais para análise bibliográfica sobre o tema, na qual houve coleta de dados, na Universidade do
Estado do Pará – Campus XII, Santarém-PA. Após analisados os dados, contatou-se que do total de participan-
tes 52% foram do sexo feminino, (58,4%) enquadraram-se dentro do intervalo de 19-23 anos. Com relação a
pratica de atividade física 42,40% dos estudantes foram classificados como ativos e apenas 7,90% sedentários.
Não foram encontradas relações significativas entre a prática de atividades físicas e a síndrome nas escalas
Exaustão Emocional e Descrença, o que foi encontrado na escala Eficácia Profissional, mas não com as rela-
ções esperadas. Foram observados 5 alunos que se enquadram nos critérios de Burnout, dentre estes 3 alunos
(60%) alto nível de atividade física (muito ativo e ativo) contra 2 acadêmicos pouco ativos (irregulares ativos
e sedentários). Concluiu-se que os estudantes da amostra apresentaram Burnout, porém possuíam um índice
de atividade física alta, mas não com grande discrepância entre valores absolutos com os de baixo nível de
atividade.

Palavras-chave: Sindrome Burnout,Atividade Física,Estudantes Medicina

175 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

O CONTEXTO DO CÂNCER DE ESÔFAGO NO BRASIL: UMA REVISÃO

Danielly Lima Clauss e Franciane Aguiar Santana


dany_clauss@hotmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: O câncer de esôfago é uma das mais frequentes neoplasias malignas. Nos últimos anos a incidência
de casos aumentou consideravelmente juntamente com as taxas de mortalidade- onde a maioria dos casos
são diagnosticados apenas em estágio avançado e com baixa possibilidade de tratamento devido a dificuldade
na percepção do surgimento de sintomas. O objetivo da pesquisa consiste em relatar sobre câncer de esôfago.
Trata-se de uma revisão bibliográfica a partir de pesquisas em bancos de dados no Google acadêmico e artigos
científicos. Nesse sentido, destacam-se dois principais e mais frequentes tipos de câncer de esôfago, o carcino-
ma de células escamosas, relacionado a elevada quantidade de tabaco consumida ou de álcool ingerida, fatores
que atuam de modo sinérgico para o risco relativo de casos adquiridos. Assim também, o adenocarcinoma,
causado por refluxo, obesidade e má alimentação. Em razão disso o incentivo a uma melhor qualidade de vida
e a realização de exames deve ser um fator de extrema importância na área da enfermagem para a população
brasileira- pois, à espera do aparecimento de sintomas neste caso pode ser um grande risco de morte- com o
intuito de promover a melhoria no controle de casos de câncer no esôfago. No Brasil, segundo o levantamento
do Sistema de Informações sobre Mortalidade (SIM 2011), o Brasil registrou 7.636 óbitos. Além disso, de
acordo com o Instituto Nacional de Câncer (INCA 2018) as estimativas de novos casos são de 10.790, sendo o
oitavo tipo de câncer mais incidente na população brasileira. Em suma, devido o frequente aumento de fatores
como tabagismo, alcoolismo e falta de cuidados em relação a saúde, o número de casos da neoplasia esofágica
elevaram-se gradativamente. Por essa razão, a prevenção desta neoplasia está diretamente interligada com
bons hábitos de vida, sendo inclusos a ingestão moderada de bebidas alcoólicas, a prática de exercícios físicos,
dietas e alimentações saudáveis. Diante disso, defende-se a alteridade do profissionais de saúde a partir do
diálogo e possibilidades de um fazer compartilhado em relação ao cuidar e o autocuidado para a melhoria da
qualidade de vida.

Palavras-chave: Palavras chave: câncer de esôfago,enfermagem,qualidade de vida.

176 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ATUAÇÃO DO ENFERMEIRO NO TRATAMENTO ASSISTIDO DE TUBERCULOSE PUL-


MONAR

Eliane Galúcio Nunes, Jessimone Pereira De Souza, Jenifer Maria Da Silva Ribeiro, Maria Da Conceição
Caetano Siqueira, Maria Da Conceição Cavalcante Farias, Fabriane Ramos Oliveira E Alanna Cecilia Au-
gusto Da Silva
anne27_stm@hotmail.com
Faculdades Integradas do Tapajós - FIT

Resumo: INTRODUÇÃO: Este relato foi desenvolvido a partir das experiências vivenciadas durante o estágio
supervisionado em Saúde Coletiva I, do Curso de Graduação em Enfermagem da UNAMA – Faculdade da
Amazônia, em uma unidade básica de saúde, no município de Santarém-PA. Na oportunidade observou-se
a atuação do enfermeiro frente ao tratamento assistido de um paciente com diagnostico de tuberculose pul-
monar. REVISÃO DA LITERATURA: Segundo o Ministério da Saúde, esta patologia trata-se de um grande
problema de saúde pública, atingindo 10,4 milhões de pessoas e levando a óbito mais de um milhão em todo o
mundo. O tratamento diretamente observado para doença proposto pela Organização Mundial de Saúde prevê
com a adesão do mesmo, que ocorra cerca de 85% de cura. METODOLOGIA: Trata-se de uma pesquisa qua-
litativa, descritiva, do tipo relato de caso. A pesquisa descritiva é aquela que o pesquisador expõe os dados sem
alterá-los. RESULTADOS: No decorrer do estágio, acompanhou-se um paciente com Tuberculose Pulmonar,
que encontrava-se no 3º mês de tratamento, porém ainda apresentava os mesmos sinais e sintomas iniciais da
doença. Durante este acompanhamento foram aplicadas medidas preconizadas pela Organização Mundial de
Saúde e Ministério da Saúde, realizando-se o tratamento diretamente observado, com o intuito de avaliar os
avanços da terapêutica e identificar possíveis causas de falhas no tratamento. O resultado dessa intervenção
foi positivo, uma vez que, foi possível identificar a resistência bacteriana e a evolução sintomatológica, reco-
nhecendo a necessidade de encaminhamento para tratamento hospitalar. CONCLUSÃO: Neste processo de
assistência detectamos a indispensabilidade do tratamento assistido ao paciente com Tuberculose Pulmonar e
a relevância do papel da enfermagem na aplicação deste método. Além disso, possibilitou a prática dos conhe-
cimentos adquiridos na academia, e mais adiante a realização de um comparativo das ações preconizadas e a
real situação vivenciada nos serviços de saúde.

Palavras-chave: Enfermagem,Terapêutica,Tuberculose Pulmonar

177 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

LEVANTAMENTO RÁPIDO DA QUALIDADE DOS CORPOS HÍDRICOS

Joseph Simões Ribeiro, Isabella Clarissa Vasconcelos Rêgo, Greice Nivea Viana dos Santos, Alessandra de
Sousa Silva, Soraia Baia dos Santos, Ronison Santos da Cruz e Ruy Bessa Lopes
josephribeiro_@hotmail.com
Universidade Federal do Oeste do Pará - UFOPA

Resumo: Introdução: Nos últimos anos a Educação Ambiental tem possibilitado cada vez mais a difusão da
problemática ambiental de práticas conservacionistas. Em função disso, a preocupação com a degradação dos
recursos hídricos tem revelado a necessidade de se estabelecer métodos de avaliação rápida de sua qualidade
ambiental. Nesse contexto, os Protocolos de Avaliação Rápida (PARs), torna-se uma ferramenta complemen-
tar no monitoramento dos recursos hídricos. Por definição, PARs são ferramentas que reúnem procedimentos
metodológicos de avaliação rápida, qualitativa e semi-quantitativa de variáveis representativas de um corpo
hídrico. Objetivos: A partir disso objetiva-se avaliar a qualidade ambiental de trechos do Igarapé do Urumarí
por meio de um PAR por alunos de Ensino Fundamenta e Médio como atividade de Educação Ambiental.
Material e Métodos: Foram selecionados pontos homogêneos para avalição dos alunos e que pudessem repre-
sentar o igarapé no todo para execução do protocolo após o mesmo ser adequado. Após uma oficina de moni-
toramento ambiental foi oferecida a à 60 alunos, os mesmos foram conduzidos aos pontos avaliação. O resul-
tado final do protocolo adequado é obtido pelo somatório dos valores atribuídos a cada parâmetro avaliado. A
pontuação final reflete a condição ambiental encontrada nos trechos avaliados. Resultados e conclusão: Após
a aplicação do PAR pelos alunos os mesmos responderam a um questionário sobre as informações obtidas na
oficina de monitoramento ambiental. Os mesmos relataram que o a oficina e o protocolo de avaliação foram
uteis na sensibilização com a condição do igarapé permitindo maior conhecimento sobre qualidade ambiental,
afirmando que o protocolo que foi adequado pode ser utilizado por qualquer pessoal da comunidade. Com
a adequação do PAR tanto na sua aplicação e forma de linguagem oportunizou aos discentes a percepção e
identificação de impactos que passam despercebidos no dia-a-dia devido ao fato do impacto já ter se incorpo-
rado as suas realidades e isso não se enxergado como um problema ambiental e se mostrou uma ferramenta de
grande valia para conscientização de jovens e crianças.

Palavras-chave: Educação Ambiental,PAR,Recursos hídricos

178 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

CONTAGEM DE OVOS POR GRAMA DE FEZES (OPG) EM EQUÍDEOS ATENDIDOS POR


ACADÊMICOS DE MEDICINA VETERINÁRIA NA CAMPANHA DO CAVALO LEGAL NA
CIDADE DE SANTARÉM – PARÁ.

Albiane Sousa Oliveira, Ellen Patrcia correia Lisboa, Dennis José Silva Lima e Simone Vieira Castro
josephribeiro_@hotmail.com
faculdade da amazonia - UNAMA

Resumo: Introdução: As verminoses em equinos são enfermidades parasitárias preocupantes, que pode in-
correr em sérios agravos à saúde como, por exemplo, a tromboembolia verminótica. Objetivo: O objetivo
deste trabalho foi identificar os principais parasitas intestinais dos animais atendidos pela ação Cavalo Legal,
realizada na cidade de Santarém. Metodologia: Durante a ação Cavalo Legal foram coletadas 24 amostras
de fezes. As amostras foram encaminhadas ao Laboratório de Patologia da Faculdade UNAMA-Santarém e
foram submetidas à análise pelo método de McMaster para a determinação da quantidade de ovos por grama
de fezes (OPG). Resultados: Das amostras analisadas 91,6% (21) foram positivas para algum tipo de parasita
grastrointestinal. Destes, 79,1% (19) apresentaram ovos da superfamília Strongyloidea, 12,5% (3) Anoploche-
phala sp., 12,5% (13) Strongyloides sp., 4,16% (1) Nematodirus sp. e 4,16% (1) Parascaris equorum. A média
de OPG nas amostras positivas para superfamília Strongyloidea foi de 3857 ovos, com mínimo de 200 ovos
no animal menos parasitado e 9900 ovos no animal com maior parasitemia. Todas as amostras positivas para
Strongyloides sp. apresentaram concomitantemente ovos da superfamília Strongyloidea, bem como as positi-
vas para Nematodirus sp. e Parascaris equorum Conclusão: Diante dos resultados obtidos conclui-se que os
equinos de tração da população de baixa renda, atendidos na ação Cavalo Legal, apresentam alta prevalência
de parasitas gastrointestinais, principalmente da superfamília Strongyloidea.

Palavras-chave: Palavras chave: parasitologia; Strongyloidea; helmintos gastrointestinais.

179 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

EFEITO DA INTEGRIDADE DO AMBIENTE SOBRE AS COMUNIDADES DE ODONATAS


(INSECTA) EM IGARAPÉS COM DIFERENTES NIVEIS DE CONSERVAÇÃO NO OESTE
PARAENSE

Everton Cruz da Silva, Tainã Silva da Rocha, Juliano de Sousa Ló, Amanda Karinne Amaral Lima e José
Max Barbosa de Oliveira Junior
evertonsilva856@gmail.com
Universidade Federal do Oeste do Pará - UFOPA

Resumo: Por apresentar distribuição, riqueza e composição altamente associadas às características físicas dos
ambientes aquáticos, a ordem Odonata é frequentemente utilizada em estudos biológicos de conservação.
Nesse contexto, comparamos a abundância e riqueza de Odonata entre igarapés com diferentes níveis de con-
servação. Adicionalmente avaliamos o efeito do horário e do período sazonal sobre essas medidas. Com uso
de rede entomológica foram amostrados adultos de Odonata em quatro igarapés no município de Santarém
nos meses de outubro de 2016 (estiagem) e abril de 2017 (chuvoso). Cada igarapé foi amostrado três vez em
diferentes dias, totalizando 24 coletas, 12 em cada estação. Para fazer a comparação de abundância e riqueza
em relação à integridade foi utilizado a metodologia de inferência baseado nos intervalos de confiança de
95% e a abundância por horário através da ANOVA one way.Foram coletados 389 indivíduos de Odonata, a
subordem Anisoptera apresentou maior abundância (n= 62) e riqueza (n= 15) em ambientes alterados na esta-
ção de estiagem. Para subordem Zygoptera sua abundância (n= 216) e riqueza (n-30) estiveram em ambientes
preservados na estação de estiagem. Houve maior abundância de Odonata nas estações de estiagem e chuvoso
em ambientes alterados nos horários de 10:00 as 14:00. (F (20, 108)=4,126 P=,000). Em ambientes preserva-
dos a abundância da ordem nas duas estações também foi no período de 10:00 as 14:00. (F(20,108)=3,671,
P=,001). Os resultados indicam que a subordem Zygoptera está diretamente ligada a ambientes preservados
e Anisoptera com ambientes alterados, possibilitando a utilização desses individuos como bioindicadores de
qualidades de ambientes aquáticos.

Palavras-chave: libélulas,ecossistemas,biomonitoramento

180 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

TECNOLOGIAS DE INFORMAÇÃO E COMUNICAÇÃO: REPRESENTAÇÕES SOCIAIS E


PRÁTICAS DE UTILIZAÇÃO ENTRE DOCENTES E DISCENTES UNIVERSITÁRIOS

Luiz Carlos Rabelo Vieira e Doriedson Alves Almeida


luizcrvieira@hotmail.com
FACULDADE DA AMAZÔNIA - UNAMA1 e Universidade Federal do Oeste do Pará - e UFOPA2

Resumo: Nas últimas décadas houve um aumento significativo de investigações sobre tecnologias na educa-
ção. Versam sobre o uso de tecnologias de informação e comunicação (TIC) em espaços de aprendizagem,
artefatos que passaram a fazer parte da cultura pela própria influência da geração digital. Por esta razão, a
presente investigação, em resultado de estudos desenvolvidos no Mestrado Acadêmico em Educação da Uni-
versidade Federal do Oeste do Pará (UFOPA), teve como situação problema: quais representações sobre TIC
apresentam docentes e discentes universitários de um instituto de formação de professores e suas implicações
na utilização desses recursos diante do processo de ensino-aprendizagem? O objetivo deste estudo, portanto,
foi analisar as representações sociais sobre TIC e suas implicações na utilização desses recursos diante do pro-
cesso de ensino-aprendizagem, segundo a percepção de docentes e discentes universitários de um instituto de
formação de professores. Com suporte na Teoria das Representações Sociais (abordagem estrutural e metodo-
logia do Discurso do Sujeito Coletivo), investigamos o público do Instituto de Ciências da Educação (ICED),
Campus Rondon, da UFOPA de Santarém-Pa. Para a produção de dados utilizamos três técnicas, apoiados em
Nóbrega e Coutinho (2003), Teixeira, Souza e Vieira (2015) e Lankshear e Knobel (2008), respectivamente: 1)
associação livre de palavras-ALP, 2) questionário e 3) entrevista. As duas primeiras técnicas foram aplicadas
a 10 docentes e 25 universitários, enquanto que a terceira foi aos 10 docentes e 14 discentes (sendo dois re-
presentantes de cada um dos sete cursos ofertados no ICED). Os resultados da análise da ALP evocadas pelos
grupos investigados indicam como possíveis elementos centrais da representação social os termos Internet,
Computador e Comunicação; e como elementos periféricos, Informação, Avanço, Interação e Necessário. Pe-
los depoimentos concedidos à entrevista, notamos não unanimidade nas respostas dos participantes, embora
evidente a convergência das suas representações em considerar as TIC como importantes recursos em prol da
comunicação e da Educação. Pelo questionário, notamos que os docentes citam as TIC serem variavelmente
integradas nas suas práticas pedagógicas, em razão da automotivação. A maioria afirmou promover a reflexão,
com os alunos, da integração de TIC em práticas pedagógicas e incentivo aos mesmos no uso dessas tecno-
logias. Por outro lado, para a maioria dos discentes não há reflexão de TIC pelos professores no âmbito da
formação. Concluímos que os dados desta investigação vêm ao encontro das discussões sobre esse tema de tão
vital importância na contemporaneidade no que respeita ao ensino e à formação inicial de professores.

Palavras-chave: Formação de professores, Tecnologias de informação, Representações Sociais.

181 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

EDUCAÇÃO QUILOMBOLA: REFLEXÕES HISTÓRICAS E EDUCACIONAIS

Claudiane Castro Santos, Alana Oriente Silva E Wilverson Rodrigo S. De Melo


claudianesantos652@gmail.com
Universidade Federal do Oeste do Pará - UFOPA1, Universidade Federal do Oeste do Pará - , UFOPA2 e
Universidade Federal do Oeste do Pará - e UFOPA3, Universidade de Évora - , UEVORA3

Resumo: RESUMO - Este trabalho teve por objetivo fazer uma reflexão sobre a educação quilombola, além
de apontar problemas e dificuldades que a população quilombola enfrenta no âmbito educacional. A proposta
metodológica adotada fora a pesquisa bibliográfica, tendo por base autores que discutem sobre a história dos
quilombos e a educação quilombola no Brasil, tais como: Campos; Gallinari (2017) e Reis; Gomes (1996).
A partir dos dados coletados, referentes as escolas quilombolas no âmbito do contexto histórico brasileiro,
infere-se que para os quilombolas terem acesso à educação, muitas lutas e manifestações foram travadas. Com
a implementação da lei 10639/03 que propôs novas diretrizes curriculares para o estudo da história e cultura
afro-brasileira e africana, as escolas e os profissionais da educação passaram a ressaltar dentro de sala de aula
– ou pelo menos deveriam – a cultura afro, como constituinte e formadora da sociedade brasileira. Segundo
Campos; Gallinari (2017), o acompanhamento da educação quilombola, a implementação da lei 10639/03 e a
estruturação, no modo geral do sistema de ensino devem ser vistas e entendidas como ações interdependentes.
Todavia, embora, o quadro educacional das escolas quilombolas tenham tido significativos avanços na promo-
ção da interculturalidade e no fomento à pesquisa de etnicidade, as condições arquitetônicas e estruturais de
algumas escolas, ainda são muito precárias. Outro fator incisivo para tal conjectura, é a carência de docentes
formados, visto que, muitos desses profissionais que são deslocados para as escolas quilombolas não possuem
uma formação adequada e não conhecem a realidade desses povos, dessa forma fica difícil de trabalhar a valo-
rização da cultura dos mesmo, pois é dever da escola e de tais profissionais desde o início da alfabetização des-
ses jovens quilombolas, trabalhar e imprimir nesses jovens a importância da identidade. Porém, para chegar
a uma educação de qualidade nos quilombos, são necessárias tanto condições estruturais e de acessibilidade,
como pedagógicas, tais como: garantir a implementação e efetividade dos dispositivos de lei (lei 10.639/03;
11.645/08; Orientações étnicorraciais 2005); garantir o assistencialismo do poder público as escolas quilom-
bolas (ônibus escolar, laboratório de informática, ampliação estrutural das escolas, etc); reinvindicar melhor
formação de professores nas universidades (seja via formação regular, PROFIC, PRONERA, UAB ou outro).

Palavras-chave: Educação,Escolas,Quilombola

182 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO DA TOXICIDADE AGUDA DO HIDROLATO DA PIPER MARGINATUM

Milena de Sousa Vasconcelos, Victor Hugo Rabelo de Aquino, Soraia Baia dos Santos, Ludyanne da Silva
Sousa, Luis Afonso Ramos Leite, Lucinewton Silva de Moura, Kelly Christina Ferreira Castro e Maxwell
Barbosa de Santana
milenavasconcelos34@gmail.com
Universidade Federal do Oeste do Pará - UFOPA1, Universidade Federal do Oeste do Pará - , UFOPA2,
Universidade Federal do Oeste do Pará - , UFOPA3, Universidade Federal do Oeste do Pará - , UFOPA4,
Universidade do Estado do Pará - , UEPA5, Universidade Federal do Oeste do Pará - , UFOPA6, Universi-
dade Federal do Oeste do Pará - , UFOPA7 e Universidade Federal do Oeste do Pará - UFOPA8

Resumo: O Hidrolato é uma substância obtida durante a extração de óleos essenciais, sendo geralmente des-
cartado ou pouco utilizado. Acredita-se que este subproduto contenha alguns metabólito secundários bioativos
existente no óleo essencial. Existem poucos estudos que testam sua toxicidade, principalmente da Piper Mar-
ginatum. Além de testar possíveis efeitos tóxicos desse composto que geralmenteé descartado no ambiente,
também existe a necessidade dessa avaliação inicial para a utilização segura do hidrolato em testes farmaco-
lógicos. Tradicionalmente, a Piper Marginatum é utilizada para tratamento de distúrbios gastrointestinais e
com efeito anti-inflamatório. O objetivo deste trabalho foi avaliar a toxicidade aguda do Hidrolatoda Piper
Marginatum(HPM). Metodologia: Seguindo o protocolo de toxicidade aguda preconizado pelo Guia número
423 da OECD, de 2001, nos quais foram utilizados camundongos albinos da linhagem Swiss, fêmeas, pesando
entre 25-30g . O HPM foi diluído em solução Salina (0,9%). Os animais foram dividos em 5 grupos com 3
animais cada e separados quanto a dose de óleo a ser recebida: grupo (1) 2000mg/kg; grupo (2) 300 mg/kg;
Grupo (3) 50mg/kg, Grupo (4) 5mg/Kg e Grupo (5) controle/salina. Os animais foram observados a cada 30
minutos nas primeiras 4 horas, e depois diariamente na mesma hora de administração durante 14 dias. Foram
observados parâmetros como: alterações na pele, nos pelos, nos olhos, mucosas, desconforto respiratório, al-
terações motoras do comportamento, tremores, convulsões, salivação, diarréia, letargia, sono e morte, sendo
anotado o dia de aparecimento de sintomas e morte caso ocorresse. O peso inicial e final também foi avalia-
do. Após o teste, os animais foram sacrificados por deslocamento cervical. Não foram observadas alterações
comportamentais nos grupos testados, como também não houve morte de animais. A média de peso inicial e
final respectivamente: Grupo (1) 26.7 ±3.21g – 28.4 ±3.05g; Grupo (2) 27.7 ±1.52g – 29g; Grupo (3) 29.4
±1.52g – 30.7 ±0.55g; Grupo (4) 29.7 ±0.57g – 31.4 ±1.52g e Grupo (5) 25g – 29.4±2.30g . Com base nos
resultados apresentados aqui, sugere-se que o HPM esteja em uma faixa segura de toxicidade, podendo ser
utilizados em testes farmacológicos.

Palavras-chave: toxicidade aguda,Piper Marginatum,Hidrolato

183 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AÇÃO EM SAÚDE PARA A COMUNIDADE EM UMA ESCOLA LOCALIZADA EM SANTA-


RÉM-PARÁ

Françoíse Gisela Gato Lopes, Marlyara Vanessa Sampaio Marinho e Alda Lima Lemos
gigatolopes@gmail.com
Universidade do Estado do Pará - UEPA

Resumo: Introdução: Ultimamente as doenças crônicas não transmissíveis (DCNT) tem se tornado uma das
principais causas de mortes entre a população Brasileira, destacando-se a hipertensão arterial sistêmica (HAS)
e diabetes mellitus (DM). Essas doenças podem ser responsáveis por desenvolver problemas cardiovascu-
lares, sendo esta uma das principais causas de morbidade no Brasil (RIBEIRO; et al 2017). Em relação ao
tratamento de DM, é considerada difícil, por depender absolutamente da educação, participação e comprome-
timento do paciente nos planos cuidados, para que ocorra prevenção de complicações, baseado no controle
de glicemia (MENEZES, LOPES e NOGUEIRA 2016). Pessoas com HAS e DM podem receber tratamento
na rede de atenção primária e através da educação em saúde proporcionar qualidade assistencial e orientações
no que se diz respeito às prevenções e autocuidado (RIBEIRO; et al 2017).Objetivo: Propiciar atendimento
de saúde para a comunidade em uma escola pública em Santarém- Pará. Metodologia: trata-se de um trabalho
descritivo, do tipo relato de experiência, desenvolvido por acadêmicas e docente do curso de graduação em
enfermagem da Universidade do Estado do Pará- Campus XII, realizado no terceiro trimestre do ano de 2017
em uma Escola Pública Estadual de Ensino Médio localizada no centro da cidade de Santarém-Pará. Foram
verificados valores de hipertensão arterial e glicemia de escolares, professores e funcionários e através dessa
ação, analisar valores e com base nesses dados, orientar segundo as particularidades de cada um. Resultados:
Realizar atividades que visem à manutenção da saúde de escolares, funcionários e professores de um ambien-
te educacional, é essencial. Durante a realização de exames e educação em saúde, percebeu-se que havia um
valor considerável de adolescentes realizando jejum intermitente, o que refletia em pressão baixa associada a
sintomas como desmaio, fraqueza, sudorese. Já os professores, a maior prevalência era de hipertensão e pro-
blemas relacionados à massa corporal. As faixa-etária distintas manifestaram em comum amostras advindas da
má alimentação e sedentarismo. Após a realização das atividades havia a consulta de enfermagem individual
com os participantes. Conclusão: Intervir nas escolas, não somente com os estudantes, é um agir fundamental
na vida estudantil na área da saúde. Através disso, os conhecimentos podem não somente serem perpassados,
mas também praticados, e, a comunidade, a mais necessitada desse tipo de ação ganha um atendimento mais
direcionado e focado, na saúde do escolar, como um todo.

Palavras-chave: educação em saúde,escolares,promoção da saúde

184 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

IMAGEM CORPORAL E BUSCA PELA \"MUSCULARIDADE\": PERSPECTIVAS PARA A


PRESCRIÇÃO DA MUSCULAÇÃO

Adria Coelho de Lima, Luiz Neves Gonçalves, Helem Poliana Nunes e Silva, MARCOS ALEXANDRE BA-
TISTA DE JESUS, Arley Kayke Rafael Da Luz e Luiz Carlos Rabelo Vieira
adriacoelho12@gmail.com
Faculdade da Amazônia - UNAMA

Resumo: Introdução: a imagem corporal é um constructo complexo, que envolve aspectos subjetivos e sociais
de difícil representação objetiva. A avaliação dessa imagem vem sendo bastante empregada em estudos e na
prática profissional em diversas áreas (destacando-se na saúde), prevalecendo o uso de conjuntos de fotosi-
lhuetas. No contexto da atuação do profissional de Educação Física (PEF), é imprescindível o entendimento
de que, no ramo de academias (onde o Brasil ocupa o quarto lugar no mercado mundial), as representações
sobre o corpo e os desejos de buscar um modelo idealizado inserem-se numa “cultura do corpo” em que pes-
soas despendem tamanho esforço e tempo nesses ambientes, atitude esta que interfere na vida dos mesmos e
na imagem que têm de si. Nesse sentido, a busca pela "muscularidade" consiste no desejo de obter um corpo
musculoso idealizado. Objetivo: revisar a literatura sobre imagem corporal e busca pela "muscularidade" con-
siderados como fatores a serem levados em conta na prescrição da musculação. Metodologia: pesquisa do tipo
revisão de literatura, cuja bibliografia consistiu de 11 artigos científicos publicados em periódicos brasileiros.
Os textos foram rastreados em plataformas disponíveis na internet mediante o uso de palavras-chave. No seu
delineamento, foram seguidas as técnicas de leitura exploratória, seletiva e analítica de Gil (1991). Resulta-
dos: a prescrição da musculação, em concordância com a literatura consultada, é de competência privativa
do PEF. Este, antes de prescrever programas de treinamento de musculação, deve promover anamnese (tria-
gem de casos) no sentido de conhecer as condições iniciais do cliente, sob pena de incorrer em negligência.
Essa avaliação pré-participação (APP) deve ser conduzida com perícia e ética, sendo conveniente a coleta de
dados sobre a imagem corporal. Pesquisadores brasileiros (LIMA et al., 2008) propuseram um conjunto de
silhuetas para representar a “muscularidade”, uma ferramenta de fácil utilização na identificação da silhueta
atual e ideal de praticantes de musculação. Logo, na APP deve haver, por parte do PEF, a preocupação em
diagnosticar que relevância o cliente atribui a sua aparência e a importância que dá à aprovação externa, es-
pecialmente no público mais jovem. Isso se deve, apontam investigações, da relação existente pela busca de
ganho de massa muscular e o prevalente uso de substâncias ergogênicas/esteroides anabólico-androgênicos
(EAA). Conclusão: o PEF deve realizar, na APP, também análise da imagem corporal antes da prescrição da
musculação, posto que a busca pela "muscularidade" relaciona-se à baixa autoestima, aos comportamentos de
risco (uso de EAA) e transtornos alimentares.

Palavras-chave: Educação física,Musculação,Imagem corporal

185 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

EMPIEMA SUBDURAL OS PARADIGMAS DA ASSISTÊNCIA DE ENFERMAGEM A UM


PACIENTE NO INTERIOR DA AMAZÔNIA

Ana Flávia Chaves de Souza, Crislem Viegas Da Trindade e Antenor Matos de Carvalho Junior
flaviachaves24.fc@gmail.com
FACULDADE DA AMAZÔNIA - UNAMA1, FACULDADE DA AMAZÔNIA - , UNAMA2 e UNIVERSIDADE
DO ESTADO DO PARÁ - UEPA3

Resumo: INTRODUÇÃO:Dentro do cotidiano da enfermagem, assim como nas demais áreas da saúde, per-
manecemos em constante contato com pessoas que apresentam patologias distintas, o empiema subdural é
uma delas e pode ocorrer em qualquer idade, comum na segunda e terceira década de vida, acompanhando
uma margem de 32 casos para cada 10.000, em uma proporção de três homens para cada mulher. O objetivo
deste estudo é salientar a importância do relacionamento entre a equipe multiprofissional e o cliente, propor-
cionando um melhor atendimento e uma assistência de enfermagem voltada para as necessidades humanas
básicas observando as manifestações clínicas, unificando o conhecimento técnico científico para um melhor
cuidado. Revisão da literatura:O termo Empiema Subdural define uma patologia inflamatória bacteriana e su-
purativa presente no espaço compreendido entre a dura-máter e a aracnoide, a patologia constitui cerca de 13%
a 33% de todas as infecções intracranianas localizadas, representando 5% de todas as lesões expansivas do
espaço subdural. É uma complicação intracraniana das rinossinusites, de alta mortalidade quando não tratada.
Metodologia:Este estudo apresenta uma pesquisa de caráter quantitativo, através do relato de experiência. As
informações foram obtidas através da análise do prontuário de uma paciente portador de empiema subdural
internado em um hospital do município de Santarém-Pará, posteriormente fora realizada coleta e validação
dos dados junto ao paciente. Para a assistência de enfermagem utilizamos o auxílio da Nanda – Associação
Americana de Diagnósticos de Enfermagem. Resultados:Após a validação dos dados observou-se a integri-
dade da pele prejudicada devido à presença de incisão cirúrgica, risco de infecção em virtude da presença de
acesso venoso, uma porta de entrada para infecções, o risco de confusão aguda por conta de algia referida
durante o anamnese e exame físico, risco de infecção, pois o ambiente hospitalar é um local onde existe uma
gama de bactérias circulando e patologias distintas, o risco de síndrome do estresse por mudança, o conforto
de casa versus hospitalização prolongada, haja vista que este paciente estava em seu 40° dia de internação, a
ansiedade era bem característica em relação a condição vivenciada. Conclusão:O Empiema subdural é uma
patologia muito parecida com sintomas gripais, a literatura nos informa acerca da gravidade, pois caso não
seja detectada a tempo pode ser fatal, em razão do disfarce que a doença faz no organismo, reforçando a im-
portância da associação teórica e pratica na assistência prestada pelos profissionais de enfermagem envolvidos
no cuidar sistematizado do paciente.

Palavras-chave: Assistência de enfermagem,empiema subdural,infecção

186 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO DA TOXICIDADE AGUDA DO ÓLEO ESSENCIAL DA PIPER MARGINATUM

Milena de Sousa Vasconcelos, Victor Hugo Rabelo de Aquino, Soraia Baia dos Santos, Éden Bruno Sousa da
Silva, Luis Afonso Ramos Leite, Ludyanne da Silva Sousa, Kelly Christina Ferreira Castro e Maxwell Barbo-
sa de Santana
milenavasconcelos34@gmail.com
Universidade Federal do Oeste do Pará - UFOPA

Resumo: A Piper Marginatum é conhecida pelo uso tradicional em distúrbios gastrointestinais, analgesia e
atividade antiinflamatória. Para o uso seguro, existe a necessidade de estudos que avaliem o potencial tóxico
de fitoterápicos, como o óleo essencial da Piper Marginatum (OEPM). O objetivo desse trabalho é avaliar a
toxicidade aguda do óleo essencial da Piper Marginatum.Seguindo o protocolo de toxicidade aguda preconi-
zado pelo Guia número 423 da OECD, de 2001, nos quais foram utilizados camundongos albinos da linhagem
Swiss, fêmeas, pesando entre 32-36g .O OEPM foi diluído em solução Salina (0,9%) e Tween 80. Os animais
foram divididos em 4grupos com 3 animais cada e separados quanto a dose de óleo a ser recebida:grupo (1)
controle/salina.; grupo (2) 50mg/kg; grupo (3)300 mg/kg e grupo (4) 2000mg/kg. Os animais foram observa-
dos a cada 30 minutos nas primeiras 4 horas, e depois diariamente na mesma hora de administração durante
14 dias. Foram observados parâmetros como: alterações na pele, nos pelos, nos olhos, mucosas, desconforto
respiratório, alterações motoras do comportamento, tremores, convulsões, salivação, diarréia, letargia, sono e
morte, sendo anotado o dia de aparecimento de sintomas e morte caso ocorresse. O peso inicial e final também
foi avaliado. Após o teste, os animais foram sacrificados por deslocamento cervical. Foi observado sonolência
apenas em animais do grupo (4) durante os quatro primeiros dias de teste, porémnão foram observadas altera-
ções no comportamento motor ou sensorial nos outros grupos avaliados, assim como também não houve mor-
tes. A média de peso inicial e final respectivamente: Grupo (1) 35±1g -39,7±5g; Grupo (2) 32±1g - 36,7±1.52g;
Grupo (3) 33±1g -36,7 ±1.52g; Grupo (4) 32 ±1g - 32 ±0,57g. De acordo com os resultados obtidos nos testes
aqui pode-se sugerir que essa espécie apresentou baixa toxicidade e com isso pode ser utilizada cm segurança
em testes farmacológicos.

Palavras-chave: toxicidade aguda,Piper Marginatum,óleo essencial

187 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A IMPORTÂNCIA DO ENFERMEIRO NO TRATAMENTO DA HANSENÍASE NA ESTRATÉ-


GIA SAÚDE DA FAMÍLIA

Raylane Rodrigues Alves, Dayane De Sousa, Natália Nazaré Pinheiro, Pamela Tafany Sussuarana, Adriana
Lemos Pereira, Leidiane Maria Silva Gonçalves e Elca Silvanea da Silva Abreu
raylan.erodrigues@hotmail.com
Instituto Esperança de ensino superior - IESPES

Resumo: A hanseníase é uma doença infectocontagiosa que representa um importante problema de saúde pú-
blica, não somente pelo grande número de pessoas que acomete, mas também pelas incapacidades advindas
da doença. Sabe-se que o seu tempo de incubação é longo, portanto trata-se de uma doença silenciosa que
demora a ser diagnosticada e tratada, resultando na longa proliferação dos bacilos e da contaminação (SILVA
JUNIOR, 2008). Devido à alta prevalência de casos no Brasil, á doença torna-se um grave problema de saúde
pública. O seu tratamento é de fundamental importância na estratégia de controle, visando primordialmente
interromper a transmissão. O profissional de enfermagem torna-se um sujeito primordial na assistência, visto
que estabelece uma interação terapêutica no tratamento do paciente, buscando trabalhar todas as ações rela-
tivas ao controle da hanseníase, desde a consulta de enfermagem até as ações de vigilância epidemiológica.
O presente estudo tem por objetivo ressaltar a importância do enfermeiro no tratamento da hanseníase e sua
contribuição no atendimento do programa de saúde da família. Para realização da pesquisa foi realizada atra-
vés de pesquisa bibliográfica na biblioteca virtual de saúde e com busca na base de dados LILACS e SCIELO,
referente à assistência integral ao portador de hanseníase e a conduta do enfermeiro para prevenção e trata-
mento da doença. O estudo mostrou que os enfermeiros possuíam conhecimento adequado sobre aspectos
do tratamento da hanseníase, dando a importância na prevenção, diagnostico, tratamento e controle. Pode-se
destacar que a atividades em educação em saúde executada pelo enfermeiro são de alta relevância, em razão
de que a sociedade em geral desconhece as medidas de prevenção dessa doença, pois deve estar seguro ao
exercer suas habilidades e competências na tomada de decisão promovendo o bem estar do individuo, família
e comunidade.

Palavras-chave: Palavras chaves: Hanseníase, Enfermagem, Educação em saúde.

188 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

CONDUTAS DE ENFERMAGEM NA ADMINISTRAÇÃO DE QUIMIOTERÁPICOS

Ellen Caroline Santos Navarro, Kamila Brielle Pantoja Vasconcelos, Cleiva Pedroso Fereira, Maria Ribeiro
Riker, Mônica Brasil Silva, Queila Silva Oliveira e Antonia Regiane Duarte
navarrocaroll@gmail.com
Instituto Esperança de Ensino Superior - IESPES1, Faculdade da Amazônia - , UNAMA2, Faculdades In-
tegradas do Tapajós - , FIT3, Faculdades Integradas do Tapajós - , FIT4, Faculdade da Amazônia - , UNA-
MA5, Faculdade da Amazônia - , UNAMA6 e Faculdade da Amazônia - e UNAMA7

Resumo: O câncer é uma doença muito agressiva, de alta prevalência em todo o mundo e pode atingir pes-
soas de todo as idades. A escolha da terapêutica depende do tipo de neoplasias, do estágio, das características
que se encontra o tumor e das características específicas das células tumorais. Atualmente, a quimioterapia,
é dentre a modalidade de tratamento, a que possui maior incidência de cura de muitos tumores incluindo os
mais avançados e a que mais aumenta a sobrevida dos portadores de câncer. Sabe-se que durante a infusão
de quimioterápicos pode ocorrer extravasamento de drogas antineoplásicas para os tecidos, e a equipe de en-
fermagem deve estar preparada para tomar medidas de prevenção visando à segurança dos pacientes, diante
de tal problemática observou-se a relevância de abordar sobre o tema em questão. Trata-se de uma pesquisa
de campo com enfoque quantitativo e qualitativo, que ocorreu na unidade de internação e ambulatorial do
Hospital Regional do Baixo Amazonas Dr. Waldemar Penna, no município de Santarém, estado do Pará. O
objetivo principal da presente pesquisa buscou analisar o conhecimento da equipe de enfermagem quanto aos
cuidados na administração de quimioterápicos. Para tanto foi necessário à abordagem aos colaboradores de
enfermagem através de questionário aberto e fechado. O desenvolvimento da pesquisa teve enfoque no papel
da equipe de enfermagem diante ao paciente com diagnóstico de câncer, visando suas condutas perante o ex-
travasamento de drogas antineoplásicas, sendo esta uma forma de conhecer mais sobre o tema proposto e a as-
sistência de enfermagem prestada ao mesmo. A partir da análise, os resultados apontam que cada participante
mostra sua singularidade ao discorrer sobre ao desempenho de suas funções. Ressalta-se que a realização da
concretização de uma assistência adequada envolve a prática adquirida no dia-a-dia e o tempo de experiência
profissional. Mas considera-se que o conhecimento científico se mostra relevante. Observa-se que o estudo
em questão se mostra de forma indispensável para melhoria da assistência prestada, na qual servirá de alicerce
teórico para a formação de futuros profissionais de enfermagem.

Palavras-chave: Câncer,Extravasamento,Quimioterapia

189 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

RELATO DE EXPERIÊNCIA VIVENCIADO EM UMA SALA DE VACINA DE UMA UNIDA-


DE BÁSICA DE SAÚDE NO MUNICÍPIO DE SANTARÉM-PARÁ

Eliane Galúcio Nunes, Jessimone Pereira De Souza, Jenifer Maria Da Silva Ribeiro, Fabriane Ramos Oli-
veira, Maria Da Conceição Cavalcante Farias e Jéssica Freitas Reis
anne27_stm@hotmail.com
Faculdade da Amazônia - , UNAMA

Resumo: INTRODUÇÃO: O presente relato foi desenvolvido baseado em experiências durante o estágio
supervisionado de saúde coletiva I, do curso de enfermagem da Faculdade da Amazônia – UNAMA, em um
centro de saúde no município de Santarém – Pará. Na oportunidade vivenciou-se a rotina em sala de vacina e
observou-se a atuação do profissional responsável por aquele setor. REVISÃO DA LITERATURA: Segundo
o Ministério da Saúde, grande parte das doenças pode ser prevenida por meio da imunização na faixa etária
infantil. Porém, tal fato só pode ser alcançado a partir do conhecimento das peculiaridades de cada imunobio-
lógico, que inclui o armazenamento e manuseio. A atualização dos profissionais que atuam frente a esse ser-
viço também se configura como um fator "chave" no alcance da eficácia do Programa Nacional de Imunização
(PNI), este contribui de forma significativa para o controle e erradicação de patologias, sendo necessário o
domínio dos profissionais sobre esse programa. METODOLOGIA: caracteriza-se por um estudo exploratório,
descritivo, de natureza qualitativa, do tipo relato de caso, baseado das experiências vivenciadas na sala de
vacina, que possibilitou a compreensão e aprendizado acerca das normas e rotinas da sala de vacina. RESUL-
TADOS: Observou-se a grande procura dos usuários por imunobiológico, bem como a busca por orientações
e esclarecimento de dúvidas acerca de reações vacinais. A experiência também possibilitou o conhecimento
do fluxo de atendimento e organização do ambiente, além de permitir o acesso ao sistema de informação.
CONCLUSÃO:A partir do vivenciado, percebeu-se a importância do conhecimento sobre as vacinas e habi-
lidades para o gerenciamento. Ainda, o conhecimento sobre o PNI se mostrou imprescindível para a garantia
da qualidade de vida e melhorias na saúde pública.

Palavras-chave: Capacitação profissional,Enfermagem,Imunização

190 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

TAXA DE APARECIMENTO FOLIAR DO PANICUM MAXIMUM CV. BRS ZURI SOB DO-
SES CRESCENTES DE NITROGÊNIO EM SOLO AMAZÔNICO

Mailana Almeida de Souza, CARLOS MIKAEL MIKAEL, Rogério Rangel Rodrigues, Luciano de Sousa
Chaves, Klebson Santos Brito, Carlos Eduardo Pedroso de Sousa, Jackson Marinho Sarmento e Clécio Hen-
rique Limeira
almeida.ifpa@hotmail.com
Instituto Federal de Educação, Ciência e Tecnologia do Pará - IFPA

Resumo: As gramíneas do gênero Panicum são as mais produtivas forrageiras tropicais propagadas por semen-
tes, apresentam alta produtividade de folhas, porte elevado, bom valor nutricional e alta aceitabilidade pelos
animais. O manejo correto, como a adubação, pode favorecer o ganho de peso animal. Desta forma, objeti-
vou-se avaliar a taxa de aparecimento foliar (TApF) do Panicum maximum cv. BRS Zuri sob doses crescentes
de nitrogênio no solo. O experimento foi realizado em casa de vegetação no setor de agropecuária do Instituto
Federal de Educação, Ciência e Tecnologia do Pará, Campus Santarém. Utilizou-se o delineamento experi-
mental inteiramente casualizado, com quatro tratamentos e quatro repetições (vasos). Os tratamentos foram
constituídos por doses crescentes de nitrogênio (Ureia – 45% de N), sendo: 0, 50, 100 e 150% da recomenda-
ção mínima para a cultura (50 kg ha-1), equivalente as doses de 0, 25, 50 e 100 kg ha-1. O solo utilizado foi um
latossolo amarelo, predominante na região, extraído da camada de 20 cm. Este foi distribuído em vasos, com
capacidade de 2,5 dm³, que foram saturados com água e deixados drenar por 24 h. Após este período, anotou-
-se o peso dos vasos, equivalendo ao peso do solo na capacidade de campo. Assim, as irrigações foram feitas
com base na reposição (até o peso inicial) da água evapotranspirada diariamente, utilizando balança eletrôni-
ca. Após semeadura, as plantas cresceram por 45 dias, ocasião em que foi realizado o corte de uniformização a
25 cm de altura, simulando a altura ideal de saída por animais em pastejo, dando início ao experimento. Após
28 dias de experimento, a variável avaliada foi produção de TApF. O TApF é o quociente entre o número de
folhas por perfilho surgidas no período avaliado e número de dias do período (28). Os dados foram submeti-
dos à análise de variância e teste de média. De acordo com os resultados, observou-se diferença significativa
(P<0,05) entre os tratamentos avaliados. Os tratamentos de 100 e 150% da recomendação (equivalente a 50 e
100 kg ha-1 de N, respectivamente) foram superiores aos demais, apresentando TApF média de 0,072 e 0,066
folhas/perfilho/dia. Não houve diferença estatística entre os tratamentos de 50 e 100% (equivalentes a 25 e 50
kg ha-1de N, respectivamente), apresentando TApF média de 0,037 e 0,037 folhas/perfilho/dia, respectiva-
mente. A adubação nitrogenada de 100 e 150% da recomendação mínima proporciona resultados positivos na
elevação da TApF média da cultivar avaliada.

Palavras-chave: forrageira,adubação,ureia.

191 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ATUAÇÃO DOS PROFISSIONAIS DE ENFERMAGEM NA PREVENÇÃO DE SEPSE NO SE-


TOR DE UTI PEDIÁTRICA

Kamila Brielle Pantoja Vasconcelos, Ellen Caroline Santos Navarro, Ana Ingrid de Souza Galvão Gomes,
Geovanna Carla da Cruz Marques, Mônica Brasil Silva, Queila Silva Oliveira e ANTONIA REGIANE
DUARTE
kamilabrielle@hotmail.com
Faculdade da Amazônia - UNAMA1, Instituto Esperança de Ensino Superior - , IESPES2, faculdade da
amazonia - , UNAMA3, faculdade da amazonia - , UNAMA4, Faculdade da Amazônia - , UNAMA5, FA-
CULDADE DA AMAZÔNIA - , UNAMA6 e faculdade da amazonia - e UNAMA7

Resumo: A sepse é uma patologia bastante complexa, gerada pela resposta inflamatória de forma desordenada
que ocorre no organismo ou sistema do indivíduo, de caráter infeccioso, definida por diversas manifestações,
podendo evoluir e fazendo com que ocorra disfunções ou falência de vários órgãos ou até mesmo evoluir para
morte. A incidência desta patologia tem aumentado na faixa etária pediátrica, e isso vem ocorrendo devido a
elevada população de risco de prematuridade e maior prevalência de pacientes com doenças mais graves. A
enfermagem por sua vez, para prevenir a sepse no setor de Unidade de Terapia Intensiva Pediátrica, tem como
obrigação está atento aos sinais e sintomas que cada paciente poderá apresentar, como hipotensão, taquicardia,
febre, taquipneia, leucopenia entre outros, sendo de fundamental importância para sua detecção. A pesquisa
objetivou relatar sobre o conhecimento dos profissionais de enfermagem acerca dos fatores de risco para evo-
lução da sepse; identificar quais medidas de controle são empregadas para minimizar tal evento e demostrar
o conhecimento de enfermagem sobre os sinais clínicos indicativos da sepse. O estudo delineia-se como uma
pesquisa de campo, de natureza descritiva e exploratória com uma abordagem qualitativa, desenvolvida na
Unidade de Terapia Intensiva Pediátrica (UTIP) de um hospital público no interior da Amazônia, tendo como
método entrevista semiestruturada com perguntas subjetivas. Os resultados mostram que dentre os profis-
sionais da equipe de enfermagem atuantes na UTIP, a categoria de técnicas de enfermagem prevalece, e que
todos receberam treinamento para desenvolver as técnicas adequadas na prevenção de sepse no setor, e que
estes possuem uma visão ampla para evitar tal evento, porém se faz necessário ainda o conhecimento científico
sobre outras formas de prevenção. Diante dos fatos, conclui-se que a equipe de enfermagem tem ação funda-
mental na prevenção, detecção precoce e tratamento da sepse, para tanto é necessário que estes profissionais
se mantenham atualizados teórica e tecnicamente para prestar uma assistência com qualidade.

Palavras-chave: Sepse,UTI Pediátrica,Enfermagem Pediátrica

192 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

OCORRÊNCIA DE ACIDENTES COM CORPO ESTRANHO EM PACIENTES ATENDIDOS


NO SETOR DE URGÊNCIA E EMERGÊNCIA EM UM HOSPITAL PÚBLICO DE SANTA-
RÉM – PA NO ANO DE 2016

Isabela Natilde Costa Góes, Jéssica Pinto Trindade Leal e Mirna Brito Malcher Pedroso
jessicapintotrindadeleal@gmail.com
Instituto Esperança de Ensino Superior - IESPES1, Instituto Singular - , 2 e Instituto Esperança de Ensino
Superior - e IESPES3, Universidade Federal do Oeste do Pará - , UFOPA4

Resumo: Os acidentes com corpos estranhos são muito comuns nos serviços de urgência e emergência, ocor-
rendo com mais frequência em crianças menores de 3 anos, podendo acometer qualquer pessoa e ocasionan-
do possíveis complicações graves e irreversíveis. O estudo tem como objetivo geral descrever a ocorrência
de acidentes com corpo estranho em pacientes atendidos no setor de urgência e emergência em um hospital
público de Santarém – PA no ano de 2016. Utilizou-se como método a pesquisa documental com abordagem
quantitativa de caráter descritivo e embasamento em pesquisas bibliográficas. Coletaram-se as informações
através de registros de arquivos digitais do Serviço de Arquivo Médico Hospitalar (SAME) após autorização
da Secretaria de Saúde de Santarém e o processo de análise dos documentos foi formulado mediante um Ter-
mo de Consentimento de Uso de Dados (TCUD) sobre a ocorrência de atendimentos de pacientes com corpo
estranho no setor de urgência e emergência no ano de 2016. Foram registrados durante o ano em questão, 493
casos em diferentes regiões do corpo. Destes pacientes atendidos, 0,6% (493/3) foi por corpo estranho na ca-
vidade anal, 1% (493/6) no braço, 37% (493/183) na garganta, 0,4% (493/2) na cabeça, 5% (493/23) na mão,
11% (493/51) no nariz, 18% (493/90) no olho, 18% (493/91) no ouvido, 4% (493/200) no pé, 2% (493/8) na
perna e 3% (493/16) não especificados nos registros. Destaca-se que o local com corpo estranho com maior
prevalência foi a garganta, seguido do ouvido, olho e nariz respectivamente. Segundo Silva, Costa e Albuquer-
que (2017) as cavidades mais atingidas por corpos estranhos são ouvidos, nariz e orofaringe, onde observam
uma sequência de acometimentos como as orelhas, nariz, faringe, esôfago e árvore traqueobrônquica. Estudos
mostram que os corpos estranhos respondem em média por 11% dos casos de emergências em otorrinola-
ringologia, onde podem evoluir para complicações em 22% dos casos, tais como: perfurações timpânicas e
broncoaspiração (FIGUEIREDO et al., 2008). Para minimizar o acometimento de corpo estranho na cavidade
orofaríngea, auricular, ocular e nasal é necessário que haja orientações e meios de prevenção quanto a essas
situações, para que a sociedade saiba agir frente a esses acidentes. Ressalta-se também que é fundamental a
capacitação de profissionais habilitados para a manipulação precoce dos corpos estranhos, evitando assim
complicações graves ao paciente.

Palavras-chave: Urgência e emergência, Corpo estranho, Prevalência

193 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

DETERMINAÇÃO DA FREQUÊNCIA DE MICRONÚCLEOS EM CÉLULAS ESFOLIATI-


VAS DA MUCOSA ORAL EM INDIVÍDUOS FUMANTES E ETILISTAS

Karine Rodrigues do Nascimento, Luan Aércio Melo Maciel, Thais Sena Trolly, Samaroni Brelaz Feitosa,
Isabela Natilde Costa Góes e Albino Luciano Portela de Sousa
karinern@outlook.com
Instituto Esperança de Ensino Superior - IESPES1, Universidade Federal do Oeste do Pará - , UFOPA2,
Universidade Federal do Oeste do Pará - , UFOPA3, Secretaria de Saúde - , SEMSA4, Instituto Esperança
de Ensino Superior - , IESPES5 e Instituto Esperança de Ensino Superior - e IESPES6

Resumo: O fumo tem sido descrito como o principal fator de risco no desenvolvimento de lesões malignas e
pré-malignas na mucosa bucal, e o consumo de álcool, por outro lado, é citado como forte agente potencia-
lizador no desencadeamento de lesões cancerosas. O estudo objetivou avaliar a frequência de micronúcleos
em células esfoliativas da mucosa oral de indivíduos fumantes e etilistas, comparando-os com indivíduos não
expostos. Um total de 40 voluntários foram selecionados e distribuídos em 4 grupos contendo indivíduos ex-
postos ao fumo e ao álcool e não expostos. Para determinação da frequência de micronúcleos empregou-se a
técnica do ensaio de micronúcleos em células da mucosa oral. As células examinadas foram coletadas com au-
xilio de uma espátula e coradas com as técnicas de Feulgen/Fast-green. Na presente pesquisa a frequência de
micronúcleos nos grupos expostos a genotoxicidade do fumo e álcool foi significativamente maior (p= 0,01)
quando comparados ao grupo controle. A associação entre álcool e fumo potencializou o aparecimento de
micronúcleo nos indivíduos usuários contínuos dessas duas substâncias, p<0,05. O hábito de fumar ou ingerir
bebidas alcoólicas causam aumento de danos na mucosa oral, e de forma conjunta estes agentes potencializam
o aparecimento de micronúcleos aumentando o risco de carcinogênese.

Palavras-chave: Genotoxidade,Micronúcleos,DNA

194 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A INCIDÊNCIA DE PARTO NORMAL E CESÁREO NO HOSPITAL MUNICIPAL DE SAN-


TARÉM - PARÁ NO PERÍODO DE 2012 A 2015.

Isabela Natilde Costa Góes, Jéssica Pinto Trindade Leal e Mirna Brito Malcher Pedroso
jessicapintotrindadeleal@gmail.com
Instituto Esperança de Ensino Superior - IESPES1, Instituto Singular - , 2 e Instituto Esperança de Ensino
Superior - e IESPES3, Universidade Federal do Oeste do Pará - , UFOPA3

Resumo: A existência do parto surgiu desde o aparecimento da humanidade e ao longo dos séculos várias
transformações foram impostas ao parto devido sua relação com aspectos culturais, sociais, pessoais, geográ-
ficos, familiares e científicos. Segundo Carvalho e Oliveira (2013), o parto normal é definido por seus aspectos
positivos, por ser mais fisiológico, saudável, natural, emocionante e satisfatório para a gestante, tornando-se o
parto ideal. A cesariana é uma intervenção cirúrgica que possibilita que o bebê seja retirado do útero materno,
em vez de nascer naturalmente. Em relação ao parto normal a recuperação é imediata, pois logo após o nasci-
mento a mulher poderá levantar-se e cuidar de seu filho. As complicações deste tipo de parto são menos graves
quando comparadas ao de parto cirúrgico (CAMPOS; ALCANTARA; GOIS, 2010). O objetivo geral deste
estudo é descrever a incidência de partos normais e cesáreos do Hospital Municipal de Santarém no período
de 2012 a 2015. Trata-se de uma pesquisa descritiva com abordagem quantitativa onde foram coletados dados
a partir dos registros do SAME- Serviço de Arquivo Médico Hospitalar do HMS, foram catalogados o número
total de partos normais e cesáreas realizados por mês, dos anos de 2012, 2013, 2014 e 2015 e respectivamente,
foram realizados 668, 1.351, 1.940 e 2.190 partos normais, e 185, 429, 700 e 845 partos cesáreos. Nota-se
através dos dados obtidos que o número de partos normais e cesáreos vem aumentando, porém o número de
partos normais é maior do que de partos cesáreos. Percebe-se então que a atenção primária possivelmente
está promovendo a conscientização das gestantes a aceitar o parto normal e também estão se adequando ao
Programa de Humanização no Pré-natal e Nascimento (PHPN) instituído pelo Ministério da Saúde, onde o
mesmo busca assegurar acesso e qualidade no acompanhamento pré-natal, na assistência ao parto, pós-parto e
neonatal, promovendo assim a redução das cesarianas. Ressaltando a lei nº 11.108, de abril de 2015 que regu-
lamenta sobre a assistência ao parto e ao nascimento, tal lei estabelece prazos para que hospitais adaptassem
suas instalações e procedimentos à nova regra. Portanto este é um estudo de extrema importância para todos
os profissionais que estão relacionados na assistência a gestante, destacando principalmente os profissionais
da enfermagem, pois através de um pré-natal adequado e orientações necessárias, pode-se conscientizar e sen-
sibilizar as mulheres sobre a importância do parto normal, considerando este como a escolha ideal.

Palavras-chave: Parto,Incidência,Enfermagem.

195 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AUTORIZAÇÃO DE INTERNAÇÃO HOSPITALAR (AIH) RELACIONADA A ACIDENTES


DE TRANSPORTE EM SANTARÉM-PA

Lídia dos Santos Carvalho, Jaiane Cristina dos Santos Nascimento, Juliete Alcantara Silva e Lucio Thadeu
Macedo Meireles
lidiacarvalhoiespes@gmail.com
Instituto Esperança de ensino superior - IESPES

Resumo: Os acidentes de trânsito são considerados como todo evento, com dano, que envolva um veículo (in-
dependente da categoria) e segundo o Ministério da Saúde o impacto negativo dos acidentes de transporte so-
bre a saúde da população brasileira, com a deterioração da qualidade e redução da expectativa de vida dos ado-
lescentes e jovens, além dos altos custos sociais e econômicos impostos ao Sistema Único de Saúde. A OMS
aponta que por ano, são registradas no mundo cerca de 1,2 milhões de mortes no trânsito, o que representa
um total de 3.000 mortes por dia. Com isso o objetivo deste estudo, foi analisar as autorizações de internação
hospitalar aprovadas no Hospital Municipal de Santarém-PA. Trata-se de uma pesquisa descritiva, documental
e retrospectiva, através do Sistema de Informações Hospitalares do SUS entre os anos de 2014 a 2017, aces-
sadas pela plataforma do Departamento de Dados do SUS, foram utilizadas as seguintes variáveis: quantidade
de AIHs aprovadas, custo total e médio das AIHs, média de internação e total de óbitos. Chegou-se a um total
de 755 internações no ano de 2014, destas 606 do gênero masculino e 149 do gênero feminino, tendo o custo
o total de R$ 717.633,71 e custo médio por internação R$950,51 na qual o paciente permaneceu durante 7,7
dias no hospital, dentre todos esses dados ocorreram 15 óbitos. No ano de 2015 foram 1139 internações, sendo
897 do gênero masculino e 242 do gênero feminino, com custo total de R$ 930.225,35 no qual o valor médio
de 816,70 por paciente, permanecendo em média 8.5 dias, e destas internações um total de 36 óbitos. Já no
ano de 2016 ocorreram 1314 internações sendo que 1044 gênero masculino e 270 do gênero feminino com um
custo total de R$ 1.032.636,33 e valor médio R$ 785,87, com tempo de permanência médio de 9.1 dias, com
um total de 44 óbitos. No ano de 2017 aconteceram 709 internações, sendo 535 do gênero masculino e 174
do gênero feminino, com um custo total de R$ 620.975,79, e tempo média de permanência de 8 dias, o que
resultou em 10 óbitos. Portanto é evidente que o Brasil não está na direção correta no combate aos acidentes
de trânsito e o aumento do número de mortes, eles são ainda mais frequentes devido às más condições de in-
fraestrutura das cidades e do trânsito e/ou ainda devido à negligência, imprudência ou imperícia das pessoas.

Palavras-chave: Acidentes de transporte, Sistema Único de Saúde, Autorização de Internação Hospitalar.

196 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

TUBERCULOSE PULMONAR COMO CONSEQUÊNCIA DO TABAGISMO

Ingrid Amaral Correa, Lídia dos Santos Carvalho, Juliana Viana Paz, Caroline Cardoso Bonfin, Lidiane dos
Santos Araújo, Ellen Dayane Braga e Andréa de Sousa Costa
ingridamaralcorrea087@gmail.com
Instituto Esperança de ensino superior - IESPES

Resumo: O Hábito de fumar e tuberculose são dois dos principais problemas de saúde pública no mundo. A tu-
berculose se apresenta como grande problema de saúde principalmente onde a nicotina também é uma epide-
mia. A exposição à fumaça do tabaco está significativamente associada com reincidência de tuberculose e sua
mortalidade. Notadamente há uma ação negativa combinada entre as duas doenças. O fumo, alterando todos
os mecanismos de defesa da árvore respiratória e reduzindo a concentração de oxigênio no sangue colabora
com a gravidade das lesões necrotizantes, além de prejudicar e tornar mais lenta a cicatrização, o que pode
gerar sequelas mais extensas. O objetivo da pesquisa busca enfatizar a associação da tuberculose pulmonar ao
tabagismo para que seja possível realizar ações voltadas a orientação de pacientes com tuberculose que são
tabagistas evitando o risco de desenvolver sequelas inerentes a associação dos dois problemas. Trata-se de um
estudo qualitativo com abordagem descritiva, onde a revisão de literatura foi realizada através de pesquisas em
bancos de dados do Google acadêmico e Scielo, além de referências que abordam a associação da tuberculose
pulmonar ao tabagismo, foram excluídas as referências que não abordassem a temática em questão, a pesquisa
incluiu ainda artigos de revisão, artigos originais e diretrizes escritos na língua portuguesa. Fumantes passi-
vos estão expostos as mesmas substâncias tóxicas que fumantes ativos, porém em concentrações diferentes.
O hábito de fumar foi significativamente associado com infecção de tuberculose, tanto em fumante passivo
quanto ativo com a doença. Fumantes ativos estão significativamente associados com retratamento, e com
mortalidade por tuberculose. Esses efeitos apareceram independentemente do nível socioeconômico e outros
vários potenciais fatores.

Palavras-chave: Tabagismo Fumantes,Tuberculose

197 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

EDUCAÇÃO SEXUAL E PROTEÇÃO À SAÚDE

JENIFFER KATIUCE SILVA DOS SANTOS, Antônia Daiane Sena da Costa, Raquel Freitas dos Santos,
Noeverton Maia do Carmo, Valdemir de Souza Farias, Greicianny dos Santos RODRIGUES, Bruna Viana
Nobre e Iracenir Andrade Dos Santos
jeniffersantos1212@gmail.com
UNIVERSIDADE FEDERALDO OESTE DO PARÀ - UFOPA

Resumo: Educação sexual é um tema amplamente abordado por diversos autores e é caracterizado como uma
das mais importante formas de prevenção de problemas ligados à saúde sexual e reprodutiva. Constitui um
processo contínuo e permanente de aprendizagem e socialização que abrange o compartilhamento de informa-
ção e o desenvolvimento de atitudes e competências relacionadas com a sexualidade humana. Dessa forma,
estimular ações e condutas saudáveis para se promover atitudes e comportamentos sexuais seguros. Essas
ações são essenciais à concretização de uma educação sexual que tenha como objetivo desenvolver atitudes
e competências, permitindo que haja segurança e informação nas escolhas de parceiros/as. A sexualidade de
crianças e adolescentes é preocupação na escola desde o momento em esta torna-se um problema público.
Nesse contexto, a atividade teve como objetivo abordar a educação sexual e proteção à saúde através de con-
ceitos sobre a temática. No período de 10 e 11 de outubro de 2017 o Programa de Educação Tutorial-PET Co-
nexões de Saberes de Estudos Interdisciplinares: Comunidade do Campo realizou o IV PET na Comunidade
na Escola Municipal Gerardo Monteiro, localizada na comunidade de Ubinzal, município de Mojuí dos Cam-
pos-PA, onde foram realizadas palestras educativas com informações sobre infecções sexualmente transmis-
síveis, abuso sexual e gravidez na adolescência, além de orientações quanto ao prevenção e tratamento para
estudantes do ensino fundamental e médio. Os resultados mostraram o intenso interesse do público através da
participação e interação com a equipe palestrante, como: questionamentos, busca de esclarecimentos. Além
disso, houve contribuição entre os envolvidos através do compartilhamento de experiências vivenciadas. A
partir disso, o evento proporcionou a conexão de saberes, com uma visão interdisciplinar do conhecimento.
Com o evento foi possível ampliar o conhecimento através de esclarecimentos e estímulos para que esses es-
tudantes pudessem fazer escolhas mais responsáveis e cautelosas considerando as necessidades de prevenções
e cuidados para com os parceiros e sua saúde.

Palavras-chave: Educação Sexual,Prevenção,ISTs

198 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

DESAFIOS E APRENDIZAGENS NOS FESTEJOS RELIGIOSOS DA COMUNIDADE SÃO


JOÃO DO LAGO GRANDE, EM SANTARÉM- PARÁ

Genilson da Silva Oliveira e Patrícia Guimarães Pereira


g.oliveiraufopa@gmail.com
Universidade Federal do Oeste do Pará - UFOPA

Resumo: O presente trabalho traz a pesquisa sobre a tradição religiosa popular contida nos momentos festi-
vos da comunidade ribeirinha de São João do Lago Grande no município de Santarém-PA. As festividades
joaninas foram os objetos da análise aqui apresentada. O objetivo do estudo foi apresentar a comunidade
santarena, a relação religiosa da região de várzea e os eventos religiosos urbanos ocorridos na cidade santare-
na; tento como referências, o estudo de Amaral (1998) com elementos como a devoção, a fé e os momentos
de celebrações. A questão que norteia a investigação se fundamenta com o teórico Santos (2006) na relação
entre a religiosidade popular existente no grupo tradicionais do município, buscando compreender se o e a
religiosidade popular do ribeirinho se forma em resultados simbólicos e religiosos às mudanças produzidas
pelos novos valores sociais, frutos do crescimento econômico, de novas práticas, valores sociais e a inserção
do grupo nos grandes projetos de desenvolvimento planejados para a região ribeirinha de São João do Lago
grande. A metodologia da pesquisa se deteve nos seguintes aspectos: participação nas festividades religiosas
das comunidades; realização de levantamentos documentais da famílias locais e referências bibliográficas;
delimitação dos instrumentos de coleta de dados (transcrição e entrevista); classificação e ordenamento dos
dados. Diante disso, as festas religiosas realizadas nestas comunidades são exemplificações da história cultural
na qual a infiltração do universo cultural do grupo tradicional está presente; o que nos mostra que os festejos
são manifestações ordenadas por atividades coletivas, pela qualidade e quantidade de folias, pela efervescên-
cia cabocla e pelas inúmeras representações de crenças em torno da imagem do santo protetor.

Palavras-chave: São João do Lago Grande; Religiosidade popular; Comunidades ribeirinhas.

199 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PERFIL DA SÍFILIS GESTACIONAL NO MUNICÍPIO DE SANTARÉM/PA

Sílvia Maria Farias dos Santos, Luana Almeida dos Santos, Antenor Matos de Carvalho Junior, Sabrina
Sousa dos Santos e Maria Victória Trindade de Sousa
silvia.farias.enf@gmail.com
Universidade do Estado do Pará - UEPA1, Faculdade da Amazônia - , UNAMA2, UNIVERSIDADE DO
ESTADO DO PARÁ - , UEPA3, Faculdades Integradas do Tapajós - , FIT4 e Instituto Esperança de Ensino
Superior - e IESPES5

Resumo: Introdução: A sífilis é doença infecto-contagiosa que pode ser transmitida através do ato sexual sem
proteção ou da mãe para o feto durante a gestação. Caracterizada por períodos de atividade e latência, tendo
acometimento sistêmico disseminado, e evolução para complicações graves em pacientes que não realizaram
o tratamento da doença ou que foram tratados inadequadamente. Objetivo: Identificar o perfil epidemiológico
das gestantes diagnosticadas com sífilis no município de Santarém/PA no período de 2014 a 2016. Metodo-
logia: Trata-se de uma pesquisa descritiva, de natureza quantitativa, na qual a coleta de dados foi realizada
através do Sistema de Informação do Departamento de Infecções Sexualmente Transmissíveis (IST) e Hepa-
tites Virais. Resultados: Destaca-se que no período de 2014 a 2016 foram notificados um total de 143 casos
de sífilis em gestantes, sendo que destes 76,9% dos casos foram diagnosticados e tratados no 3º trimestre da
gestação, a faixa etária mais prevalente foi de 20 a 29 anos o equivalente a 55,9% dos casos, quanto ao nível
de escolaridade observou-se que 50,3% das gestantes haviam cursado do 5º ao 8º ano incompleto. Conclusão:
Dessa forma observa-se que o número de casos de sífilis em gestantes no município de Santarém é preocupan-
te, uma vez que está doença pode causar danos irreversíveis ao feto, além do fato de que a maioria das grávidas
estão sendo diagnosticadas e tratadas tardiamente no terceiro trimestre da gestação (76,9%), acarretando ao
feto algum problema neurológico ou ósseo. O enfermeiro e sua equipe exercem um papel relevante no diag-
nóstico e tratamento da sífilis, é importante que a gestante inicie o pré-natal o mais breve possível, para que
essa e outras infecções transmissíveis sejam tratadas tendo o mínimo de risco para mãe e feto.

Palavras-chave: Doença,Gestantes,Epidemiologia

200 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

SEPSE: A IMPORTÂNCIA DE UM DIAGNÓSTICO RÁPIDO EM CASOS DE URGÊNCIA E


EMERGÊNCIA

Taiana Cristina Alves Canto, Vanessa Ross De Sousa Teixeira, Igor Cruz de Souza e Andréa de Sousa Costa
taiana89@live.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: SEPSE é considerada como uma síndrome da resposta inflamatória sistêmica de causa infecciosa. A
sepse pode ocorrer em resposta a qualquer microrganismo, sua fisiopatologia é complexa e depende de fatores
como a exposição a um patógeno invasor. É um importante problema de saúde do Brasil, incluindo serviços
públicos e privados, com altos custo de tratamento e mortalidade. O objetivo deste trabalho foi demonstrar a
importância de uma intervenção imediata e eficaz em casos de sepse na urgência e emergência. A metodologia
utilizada na revisão bibliográfica foi determinada por uma busca sistemática por meio da consulta aos indexa-
dores de pesquisa nas bases de dados eletrônicos: Google acadêmico e Scielo. O levantamento foi realizado
com os seguintes descritores: SEPSE, Urgência e Emergência. Foram definidos como critérios de inclusão:
artigos de revisão, editoriais e artigos originais, realizados e publicados em periódicos, não havendo restrição
a data de publicação. A sintomatologia depende do tipo e do local da infecção, sendo os principais sintomas
irregulares, dificultando assim o diagnóstico, que é realizado pela anamnese e exames laboratoriais. Na análise
da revisão literária foi possível verificar um nível de dificuldade na detecção dos sinais e sintomas da sepse,
tanto a forma grave, quanto o choque séptico, no entanto o tratamento atualmente sofreu significativas mudan-
ças nas últimas décadas, ainda mais com a campanha mundial, Surviving Sepsis Campaign, campanha que es-
tabeleceu procedimento padrão para atendimento desses pacientes, visando sua otimização clínica, sendo que
o procedimento deve ser iniciado imediatamente ainda na sala de urgência. Portanto a sepse e uma doença de
com alto índice de morbimortalidade e demanda de um atendimento de excelência na urgência e emergência
e terapia intensivista, cujo tratamento envolve altos custos. O prognostico da Sepse Grave e Choque Séptico,
estão relacionadas ao diagnóstico, a abordagem ordenada visando a melhoria clínica do Paciente – Cliente e,
de grande relevância, a precocidade do diagnóstico é a chave do sucesso para o tratamento.

Palavras-chave: SEPSE,Emergência,Diagnóstico

201 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PERFIL EPIDEMIOLÓGICO DE PACIENTES COM HIV/AIDS DO MUNICÍPIO DE SANTA-


RÉM ENTRE O ANO DE 2012 A 2016

Sílvia Maria Farias dos Santos, Antenor Matos de Carvalho Junior, Luana Almeida dos Santos, Sabrina
Sousa dos Santos e Maria Victória Trindade de Sousa
silvia.farias.enf@gmail.com
Universidade do Estado do Pará - UEPA1, Universidade do Estado do Pará - , UEPA2, Faculdade da Ama-
zônia - , UNAMA3, Faculdades Integradas do Tapajós - , FIT4 e Instituto Esperança de Ensino Superior - e
IESPES5

Resumo: Introdução: Desde seu surgimento a AIDS/HIV foi conhecida pelo sofrimento e estigma que causava
no indivíduo, tida como uma doença grave e mortal, sua principal forma de contágio era pelo ato sexual e uso
de drogas, através do compartilhamento de seringas e agulhas. Apesar de nos dias atuais sua taxa de mortali-
dade ter sido reduzida pelo uso da terapia antirretroviral, garantindo à qualidade de vida ao portador. Objetivo:
Identificar o perfil epidemiológico dos indivíduos diagnosticados com AIDS/HIV no município de Santarém/
Pa, no período de 2012 a 2016. Metodologia: Trata-se de uma pesquisa descritiva, de natureza quantitativa,
onde a coleta de dados foi realizada através do Sistema de Informação do Departamento de Infecção Sexual-
mente Transmissível (IST), AIDS e Hepatites Virais. Resultados: Destacam que no período estudado foram
notificados 445 casos de AIDS/HIV, sendo que 223 eram do sexo masculino e 160 do sexo feminino, entre o
total de casos estavam 12 crianças menores de 5 anos e 95 indivíduos com idade entre 15 e 24 anos. Foi obser-
vada uma taxa de detecção de 18,7/2012; 30,2/2013; 32,7/2014; 30,8/2015 e 39,7/2016 por 100 mil habitantes
nesse período. Em relação ao número de casos em gestantes foram detectados 47 casos de HIV, com uma taxa
de detecção de 7 nascidos vivos por 100 mil habitantes. Dos indivíduos do sexo masculino acima de 13 anos
de idade 39,0% eram homossexual, 17,1% bissexual e 43,9% heterossexual. O número de óbito tendo como
doença base AIDS/HIV foi de 198. Conclusão: AIDS/HIV sendo uma doença prevenível, o número de casos
no município de Santarém continua crescente, apesar disso a transmissão vertical da doença tem diminuído,
isso se deve a efetividade do Centro de Testagem e Aconselhamento do município, uma vez que os casos diag-
nosticados estão sendo tratados e mantidos com uma carga viral baixa.

Palavras-chave: Carga viral,Doença,Transmissão

202 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ANÁLISE DO PERFIL CLÍNICO-EPIDEMIOLÓGICO DOS INDIVÍDUOS DIAGNOSTICA-


DOS COM FEBRE AMARELA: UMA REVISÃO INTEGRATIVA

Emanuel Roberto Figueiredo da Silva, Vanessa Mello da silva, Olívia Campos Pinheiro, Flávio da Silva
Costa Umbelino, Franciane de Paula Fernandes, Alexandre Vasconcelos Dezincourt, Marcos José Silva de
Paula e Kerly Ribeiro Acácio
emanuel.f.stm@gmail.com
UNIVERSIDADE DO ESTADO DO PARÁ - UEPA1, UNIVERSIDADE DO ESTADO DO PARÁ - , UEPA2,
Centro Universitário Nilton Lins - , UNINILTONLINS3, UNIVERSIDADE DO ESTADO DO PARÁ - ,
UEPA3, UNIVERSIDADE DO ESTADO DO PARÁ - , UEPA4, UNIVERSIDADE FEDERALDO OESTE DO
PARÀ - , UFOPA5, UNIVERSIDADE DO ESTADO DO PARÁ - , UEPA6, Universidade do Estado do Pará -
, UEPA7 e UNIVERSIDADE FEDERALDO OESTE DO PARÀ - e UFOPA8

Resumo: Introdução: A febre amarela é uma doença febril aguda, infecciosa, não contagiosa, causada por
arbovírus e transmitida por insetos hematófagos. A doença já causou surtos importantes principalmente no
continente africano, e se mantém endêmica nas florestas tropicais da América. Objetivo: Dessa forma, o obje-
tivo da pesquisa é identificar o perfil clínico-epidemiológico e os dados vacinais da febre amarela a partir de
trabalhos publicados entre 2011 e 2017. Metodologia: Foi realizada uma revisão integrativa utilizando como
fonte de pesquisa a filtragem nos sites de busca base de dados PubMed (Public/Publish Medline) e Scientific
Eletronic Library Online (SCIELO), de 2011 a 2017, além de trabalhos de autores referência em Febre Ama-
rela e a Cartilha de Manejo Clínico da Febre Amarela, versão 01, 2017 de Minas Gerais, sendo encontrados
59 artigos e, após selecionados pelos critérios de inclusão e exclusão, permaneceram 35. Resultados: a Febre
amarela possui dois ciclos de transmissão: o silvestre e o urbano. Não variam, porém, os aspectos etiológicos,
clínicos, fisiopatológicos e imunológicos entre eles. Houve um aumento no número de casos de febre amarela,
inicialmente notada no final de 2016, estendendo-se para 2017, com mais de 680 casos relatados e uma taxa
de letalidade de 34%. Os estados mais acometidos foram Minas Gerais e Espírito Santo. Evidenciou-se que os
homens são mais afetados, em faixa etária com média em 32 anos, moradores e trabalhadores rurais. Há maior
número de casos de FA nos períodos mais chuvosos do ano. A maioria dos casos tem curta duração e curso
benigno, 15% podem complicar para a fase toxêmica. Quanto à vacina, sabe-se que esta compõe braço vital da
prevenção de surtos de febre amarela em regiões endêmicas e também para evitar a importação da doença para
regiões indenes. Fontes de referência atestam validade vitalícia e efeitos adversos raros e discretos. Há dificul-
dades para avaliar cobertura vacinal por parte de seus atendentes de saúde. Considerações Finais: Concluiu-se
que ocorrem surtos isolados ou epidemias de grande impacto da doença na América do Sul. Para cobertura
vacinal, recomendam-se campanhas periódicas de vacinação em adição às atividades rotineiras. Futuras linhas
de pesquisa devem detectar padrões individuais de risco para efeitos adversos da vacina para torná-la mais
seguras, minimizando efeitos colaterais.

Palavras-chave: Febre amarela,Aedes aegypti,Vacina

203 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PERFIL EPIDEMIOLÓGICO DAS MORTES AUTOPROVOCADAS EM SANTARÉM-PA DE


2007 A 2015

Emanuel Roberto Figueiredo da Silva, Vanessa Mello da silva, Francileno Sousa Rêgo, Arthur Menezes Vaz,
Karine Leão Marinho, Kerly Ribeiro Acácio e Gabriel Tavares de Oliveira Silva
emanuel.f.stm@gmail.com
Universidade do Estado do Pará - UEPA1, Universidade do Estado do Pará - , UEPA2, Universidade do
Estado do Pará - , UEPA3, Universidade do Estado do Pará - , UEPA4, Universidade do Estado do Pará - ,
UEPA5, Universidade Federal Do Oeste Do Pará - , UFOPA6 e Universidade do Estado do Pará - e UEPA7

Resumo: Introdução: O suicídio constitui-se, atualmente, em um problema de saúde pública mundial. Está
entre as três principais causas de morte entre adolescentes e adultos jovens. Esses valores excluem as tentati-
vas de suicídio, que se acreditam ser de 10 a 20 vezes mais frequentes. Além de ainda ser um tema cercado de
tabu. Objetivo: O objetivo da pesquisa foi apresentar os dados epidemiológicos sobre o suicídio no Município
de Santarém, na série histórica que compreende os anos de 2007 a 2015, quantificando o coeficiente bruto de
mortalidade por suicídio no Município, correlacionando gênero e faixa etária, além de discutir as­pectos rela-
cionados ao suicídio como os fatores de risco. Métodos: Esse estudo se trata de uma pesquisa observacional
do tipo longitudinal, descritiva, com o uso de variantes quantitativas, sendo incluídos no estudo os indivíduos
com óbito autoprovocado dentro do período estabelecido, de 2007 a 2015, e os dados obtidos junto à DIVISA.
Foi utilizada a décima revisão da Classificação Internacional de Doenças na versão brasileira (CID-BR-10),
no tocante a lesões autoprovocadas intencionalmente incluindo as categorias X60 a X84. Resultados: Foram
registradas 118 mortes autoprovocadas na série histórica abordada, com predominância do gênero masculino
(78,8%) em relação a 21,2% do sexo feminino. A faixa etária mais acometida compreende as idades de 20 a
39 anos. A forma mais utilizada para cometer o suicídio foi o enforcamento, estrangulamento e sufocamento
(CID 10 - X70). O domicílio foi o local predominante de ocorrência, porém a maioria dos que utilizaram arma
de fogo o fizeram em vias públicas. Maioria de solteiros em relação a casados. Infelizmente, não se pôde traçar
um perfil das mortes quanto à ocupação em vida devido à falta de dados. Considerações finais: Por fim, per-
cebe-se são necessárias medidas que visem diminuir, quiçá, impedir esses acontecimentos para a redução das
estatísticas apresentadas nesse trabalho. Os dados apresentados buscaram criar evidências que subsidiassem
pesquisas futuras na área, bem como que servissem de auxílio na construção de políticas públicas de enfrenta-
mento do problema, quanto a medidas para coibir essa fatalidade, muitas vezes, evitável.

Palavras-chave: Morte Autoprovocada,Suicídio,Perfil Epidemiológico

204 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PET-SAÚDE/GRADUASUS: UM RELATO DE EXPERIÊNCIA ACADÊMICA NA ATENÇÃO


BÁSICA

Taianne Kaiena Frota Oliveira, Luiz Fernando Gouvêa e Silva, Marcela Godinho Miranda do Vale, Jackson
Celso Pereira Pires, Fernanda de Araújo Oliveira, Iana Bruna Parente Cardoso e Ademir Ferreira Sousa
resistaja@outlook.com
Universidade do Estado do Pará - UEPA

Resumo: INTRODUÇÃO: O Programa de Educação pelo Trabalho para a Saúde (PET-Saúde) GRADUA-
SUS, criado pelo Ministério da Saúde, para qual a Universidade do Estado Pará, Campus XII, teve seu projeto
aprovado durante os anos de 2016 a 2018, contando com a participação de docentes, profissionais de saúde em
exercício profissional e discentes dos cursos de graduação em medicina, fisioterapia, enfermagem e educação
física. No qual, buscou fortalecer a integração do ensino-serviço-comunidade por meio de discussões, ações
e experiências vividas durante o projeto. OBJETIVO: Relatar e refletir sobre experiências e vivências na rede
pública de saúde pelos bolsistas e voluntários do PET-Saúde/GraduaSUS, acadêmicos do curso de fisioterapia
da Universidade do Estado do Pará-Campus XII no período de maio/2016 a abril/2018. METODOLOGIA:
Trata-se de um relato de experiência, de caráter qualitativo, acerca das vivências obtidas durante os debates
de artigos, reflexão dos dados obtidos sobre a necessidade reais da comunidade no que tange aos assuntos
abordados para prevenção, a produção e confecção de meios de divulgação e propagação do mesmo. Por fim,
a análise e comparação das metodologias utilizadas na comunidade. RESULTADOS: A equipe multiprofissio-
nal após diversas reuniões em que ocorriam discussões de artigos, analise dos dados coletados por meio dos
questionários aplicados a comunidade, traçou intervenções que viessem de encontro as necessidades locais.
Mediante isto, os bolsistas/voluntários tiveram contato com o representante de cada local onde seriam reali-
zadas as intervenções, afim de obter o conhecimento da rotina e peculiaridade de cada setor, permitindo um
planejamento prévio de quais abordagens teriam melhor resultados. Através da inserção dos acadêmicos nas
unidades e centros de referência em saúde, permitiu-se o contato com os usuários e seus relatos de história de
vida e de saúde-doença. Esse elo proporcionou trocas de ideias sobre as reais necessidades da comunidade
dando enfoque nas suas potencialidades, facilitando o planejamento das ações a serem realizadas. Enfatizando
as atividades relacionadas à promoção de saúde e prevenção de doenças. Além de proporcionar meios para que
fossem coletadas informações importantes no campo da saúde dando subsidio a futuras pesquisas cientificas.
CONSIDERAÇÕES FINAIS: O PET-Saúde/GraduaSUS vem agregar valores na formação dos profissionais
de saúde, bem como para os futuros fisioterapeutas, permitindo que estes não somente tenham o contato pre-
maturo com a comunidade, mas também com as vivências na rede pública de saúde. Desenvolvendo ações que
propiciem o ensino, pesquisa e assistência, gerando novas práticas e saberes permitindo o crescimento de sua
postura como futuro profissional.

Palavras-chave: Programa de Educação pelo Trabalho para a Saúde,Formação Acadêmica,Sistema Único de


Saúde,PET-Saúde/GraduaSUS

205 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

FISIOTERAPIA NAS DISFUNÇÕES DO ORGASMO FEMININO – UMA REVISÃO LITERÁ-


RIA

Thalita de Andrade Almeida Moura, Sofia Camargo da Silva, Nathaina Torres Chaves e Gustavo Fernando
Sutter Latorre
thalita-moura@hotmail.com
Universidade Federal do Oeste do Pará - UFOPA1, Universidade Federal do Pará - , UFPA1, Instituto de
Ensino E Pesquisa Objetivo - , IEPO2, FACULDADE INSPIRAR - , 3 e FACULDADE INSPIRAR -, 4

Resumo: INTRODUÇÃO: A resposta sexual saudável é definida como um conjunto de quatro etapas sucessi-
vas: desejo, excitação, orgasmo e resolução. A falta, excesso, desconforto e/ou presença de dor na expressão e
no desenvolvimento de algumas dessas etapas, caracteriza-se como disfunção sexual. Estima-se que o percen-
tual de mulheres afetadas por alguma disfunção sexual chega a 45%, dentre as quais 30% apresentam disfun-
ção de excitação e anorgasmia. Há diversas propostas de técnicas fisioterapêuticas na melhora das disfunções
sexuais femininas como: cones vaginais, exercícios de Kegel, trabalho manual com toque digital, biofeedback,
eletroestimulação e orientações domiciliares. Contudo, existem poucas evidencias cientificas que comprovem
os efeitos desses tratamentos fisioterapêuticos nessas disfunções. OBJETIVO: Buscar na literatura científica,
evidencias que elucidem os efeitos dos tratamentos fisioterapêuticos nas disfunções do orgasmo feminino.
METODOLOGIA: Busca nas bases de dados PubMed, Lilacs e PEDro, por artigos, livros e periódicos pu-
blicados entre 2000 e 2016. Os critérios de inclusão definidos foram: estudos nos idiomas português, inglês e
chinês, pesquisas realizadas apenas com seres humanos, ensaios clínicos, tratamento fisioterapêutico para as
disfunções sexuais femininas que citaram orgasmo; os critérios de exclusão foram: artigos não relacionados
ao tema anorgasmia, artigos com abordagem masculina, artigos de revisão ou que abordassem outros tipos de
tratamento não fisioterapêutico, antigos anteriores ao ano 2000. RESULTADOS: foram encontrados 314 es-
tudos relacionados as palavras-chave utilizadas. Contudo, somente 15 ensaios clínicos incluídos. Os motivos
de exclusão foram: não abordar o tema anorgasmia ou disorgasmia (70), estudos de revisão (64) estudo com o
sexo masculino (62), estudos qualitativos ou que não realizaram intervenção fisioterapêutica (54), estudos an-
teriores ao ano 2000 (49). Na pesquisa realizada, foi possível observar uma variedade de tratamentos que ob-
jetivavam a melhora da função sexual feminina, particularmente para as disfunções do orgasmo, lubrificação,
desejo, excitação ou dor no ato sexual. Também verificamos que a disfunção sexual feminina muita das vezes
vem associada ou é um sintoma secundário de outras disfunções do assolho pélvico. CONCLUSÃO: Nota-se
a importância da fisioterapia ligada as disfunções sexuais femininas, desta forma evidencia-se a necessidade
da implantação do fisioterapeuta na equipe multidisciplinar ligado a saúde da mulher. Tornando necessário o
conhecimento de sua função pelos demais profissionais da área da saúde para que possam direcionar as mu-
lheres aos cuidados desse profissional. Porém, a fisioterapia pélvica é uma especialidade ainda recente, tendo
a necessidade de maiores evidências científicas para validar as técnicas já conhecidas e proporcionar maior
diversidade em tratamentos fisioterapêuticos nas disfunções femininas.

Palavras-chave: Disfunção sexual,Fisioterapia,Anorgasmia

206 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ALTERAÇÃO NEUROBIOLÓGICA E COMPORTAMENTAL DO DEPENDENTE DE SUBS-


TÂNCIAS QUÍMICAS

Daniela dos Santos Américo, alexandre Vinícius Ferreira e Maelly Larissa Mendes Pantoja
danielaamericoa@hotmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: O uso crescente de drogas, lícitas e ilícitas, configura-se em um problema de saúde pública mundial.
Atualmente no Brasil, 19,4% é o índice que compreende as pessoas que utilizaram alguma droga na vida (com
exceção do álcool e tabaco) e 68,7% corresponde a porcentagem de brasileiros que usam álcool; uma área
que está intimamente mais ligada com a problemática do uso abusivo das drogas são os serviços de saúde.
Dessa forma, a pesquisa teve como objetivo apontar as modificações que ocorrem nas funções cerebrais e a
sua relação com os comprometimentos comportamentais pelo uso abusivo de substâncias químicas. A pre-
sente pesquisa é de cunho bibliográfico. Segundo a Organização Mundial da Saúde (OMS) a classificação
das substâncias químicas é feita a partir de seus efeitos, como o álcool e os sedativos são classificados como
‘depressores’, nicotina, cocaína e anfetamina entendidos como ‘estimulantes’, enquanto LSD e maconha são
‘alucinógenos’. Independente do objetivo pelo qual o sujeito usa a substância, dependendo da quantidade mi-
nistrada e a frequência, podem ocorrer modificações e reações ao organismo. A dependência química acarreta
na alteração da sensopercepção, da propriocepção e das emoções; o indivíduo com um sistema neurobiológico
dependente atua inteiramente no controle do comportamento e pensamentos, logo as substâncias psicoativas
agem sobre o cérebro. A anatomia do sistema de recompensa é o mecanismo utilizado maciçamente pela de-
pendência química, caracterizado pelo sistema dopaminérgico, que têm tratos no mesolímbico-mesocortical
que se projeta a partir da área tegmental ventral (ATV) para a maior parte do córtex frontal (funções psíquicas
superiores), sistema límbico (emoção) e a via dopaminérgica relacionada à recompensa. A recompensa tem
participação fundamental na busca de estímulos causadores de prazer, tais como alimentos, sexo, relaxamento;
no reforço positivo da recompensa, o organismo é impelido a buscá-las repetidas vezes, ou seja, cria-se uma
memória específica, como se as básicas necessidades estivessem ameaçados caso não seja saciada a vontade.
Logo, as modificações a nível neuronais, alteraram o aspecto neurobiológico e comportamental com o uso
abusivo de drogas, sendo essas causadoras de sequelas temporárias ou irreversíveis, como transtornos, afec-
ções neurológicas, lesões infecciosas e doenças degenerativas, como Alzheimer e Parkinson.

Palavras-chave: Dependência química, Funções cerebrais, Comportamento

207 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

DIÁLOGO COM ADOLESCENTES SOBRE VIOLÊNCIA DOMÉSTICA E INTRAFAMI-


LIAR: UM RELATO DE EXPERIÊNCIA

BRENDALY FÁVERO, CLAUDILEDE SOUSA SILVA , DAYANI OLIVEIRA SILVA, HARNON GABRIEL
FIGUEIREDO FERREIRA e Edilmara Patricia Rocha
brendalypsifavero@gmail.com
Iespes - IESPES

Resumo: A violência doméstica ou a violência intrafamiliar é resultante de formas desiguais de poder den-
tro das relações familiares e afetivas, que podem estar vinculadas a condição de gênero e/ou a condição de
vulnerabilidade física e psíquica, no caso de crianças, adolescentes, idosos ou pessoas com algum tipo de
deficiência. Tendo em vista a complexidade desse fenômeno e demandas emergentes em uma turma do 5° ano
vespertino, de uma escola de ensino fundamental da rede municipal de Santarém - PA, as (os) acadêmicas (os)
do 8º semestre do curso Bacharelado em Psicologia, se propuseram a realizar uma intervenção com o público-
-alvo citado. A atividade teve como objetivo proporcionar espaços reflexivos acerca da Violência Doméstica/
Intrafamiliar e suas facetas. A atividade foi dividida em três etapas: Inicialmente foi apresentado um vídeo
intitulado “2 minutos para entender – Violência Doméstica”, onde são abordados alguns elementos como tipo-
logia da violência, estatísticas e consequências psicossociais; Em seguida, foi proposta a divisão da turma em
subgrupos para a realização de uma vivência teatral, nela as (os) participantes elegeram um ou mais tipos de
violência e encenaram para as (os) demais colegas; E por fim, o público teve a função de identificar os tipos de
violência apresentados através de uma pequena tabela/questionário de múltipla escolha. Observou-se que as
(os) estudantes se apresentaram receptivas (os) com as encenações, tendo todas (os) uma participação ativa ao
longo da intervenção. A identificação do tipo de violência foi uma forma de avaliação do grau de entendimento
das (os) alunas (os) sobre as manifestações da violência, bem como uma forma de construir coletivamente o
que eles vivenciam e percebem em seu meio, como sendo ou não um ato violento. Por fim, a intervenção pos-
sibilitou uma experiência belíssima de contato com as (os) adolescentes, bem como proporcionou um espaço
seguro para a discussão, trocas e orientações quanto aos direitos e meios pelos quais eles/elas podem acionar
equipamentos da rede de proteção da integridade de seus familiares.

Palavras-chave: Condição de Vulnerabilidade,Relações Familiares,Violência Intrafamiliar.

208 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AS CONTRIBUIÇÕES DA MÚSICA NO DESENVOLVIMENTO PSICOMOTOR DE CRIAN-


ÇAS DE 02 Á 04 DA EDUCAÇÃO INFANTIL: UM OLHAR A PARTIR DO MÉTODO DAL-
CROZE.

Erlane Ferreira Santos


santoserlane.musica@gmail.com
Universidade Do Estado Do Pará - UEPA1

Resumo: Este trabalho aborda as contribuições da música para o desenvolvimento psicomotor de crianças de
03 á 04 anos da educação infantil, tendo como problemática: Quais são as contribuições que a música pode
oferecer no processo de aquisição da coordenação motora de crianças de 02 a 04 anos de idade da educação
infantil? Elencaram-se objetivos, sendo o geral, identificar as contribuições da música para o desenvolvimento
psicomotor nos aspectos da coordenação motora; e como objetivos específicos; desvelar os conceitos sobre
desenvolvimento psicomotor, educação infantil e Método Dalcroze, analisar as contribuições da música no
desenvolvimento psicomotor da criança de 02 á 04 anos e especificar quais as contribuições do Método Dal-
croze para o desenvolvimento da coordenação motora em crianças de 02 á 04 anos. Entende-se que a educação
musical em parceria com outras ciências, entre elas a psicomotricidade promovem contribuições singulares
para a referida faixa etária, período tal que é considerado entre os estudiosos uma das fases mais importantes
para o desenvolvimento do indivíduo. A metodologia utilizada na investigação exposta é de caráter quali-
-quantitativa, tendo como instrumento de coleta de dados um questionário misto. Participaram da pesquisa três
professoras de música de três escolas particulares da cidade de Santarém-PA. Os resultados demonstram que
o referido método trabalhado pelas professoras está contribuindo especificamente no desenvolvimento dos
movimentos básicos de locomoção, não-locomoção e manipulativos das crianças. Porém, constatamos que em
duas escolas a escolha de materiais acontece de forma inconsciente pelas professoras, não existe um objetivo
específico para o ensino de música.

Palavras-chave: Música e educação infantil,Psicomotricidade infantil,Método Dalcroze

209 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ISQUEMIA MESENTÉRICA: RELATO DE EXPERIÊNCIA EM UM HOSPITAL PÚBLICO


DO BAIXO AMAZONAS

Martha Nunes Freitas, Ellen Caroline Santos Navarro, Kamila Brielle Pantoja Vasconcelos, Jailson Torres
de Menezes, Erivan Souza Lima, Queila Silva Oliveira e ANTONIA REGIANE DUARTE
marthanunesf@gmail.com
CENTRO UNIVERSITÁRIO INTERNACIONAL - UNINTER1, Instituto Esperança de Ensino Superior - ,
IESPES2, Faculdade da Amazônia - , UNAMA3, UNIVERSIDADE DA AMAZONIA - , UNAMA4, Faculdade
da Amazônia - , UNAMA5, FACULDADE DA AMAZÔNIA - , UNAMA6 e Faculdade da Amazônia - e UNA-
MA7

Resumo: A Isquemia Mesentérica pode ser ocasionada por uma variedade de doenças e síndromes, apresenta
altas taxas de mortalidade e ocorre geralmente entre a quinta e sexta década de vida. As principais causas são
trombose ou embolia arterial, vasoconstricção esplênica, trombose venosa ou estrangulamento mecânico de
um seguimento intestinal. A eficácia do tratamento está diretamente ligado ao diagnóstico precoce e interven-
ção imediata. Objetiva-se identificar a caracterização clínica, abordar os aspectos fundamentais da terapêutica,
e as medidas necessárias para a resolução de cada caso. Trata-se de um estudo descritivo, com abordagem
qualitativa, do tipo relato de experiência. Os dados foram coletados por meio do acompanhamento clínico e
da consulta ao prontuário do cliente de um hospital público do baixo amazonas. Os resultados mostram que as
síndromes isquêmicas tornam-se mais frequentes com o progressivo envelhecimento da população e a demora
em se fazer o diagnóstico é um fator responsável pela elevada morbimortalidade. O tratamento clínico é feito
com dieta alimentar adequada, pouco volumosa e fracionada, associado a medicação antiespasmódica e va-
sodilatadora. Nos casos em que há resistência ao tratamento clínico, faz-se necessária a abordagem cirúrgica,
não só para reabilitação do paciente, mas também como medida preventiva para infarto intestinal. O estudo
evidencia a relação de Isquemia Mesentérica com a clínica do paciente, cujo o principal fator se trata do per-
fil de risco cardiovascular. O sucesso terapêutico depende do diagnóstico precoce associado ao tratamento.
Conclui-se que o acompanhamento da clínica e diagnóstico precoce do paciente é essencial para eficácia do
tratamento. Além disso o conhecimento preciso pelos profissionais acerca da patologia, bem como a escolha
certa do tipo de tratamento podem reduzir a morbimortalidade.

Palavras-chave: Doenças vasculares,enfermagem,isquemia mesentérica

210 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A PESSOA COM DEFICIÊNCIA E O RESPEITO A SUA DIGNIDADE: UMA CONSTRUÇÃO


HISTÓRICA

Brendaly Fávero e Maria das Dores Carneiro Pinheiro


brendalypsifavero@gmail.com
Iespes - IESPES

Resumo: De acordo com o Censo Demográfico (IBGE, 2010) cerca de 24% da população brasileira apresenta
algum tipo de deficiência: visual, auditiva, motora e/ou intelectual/mental. Atualmente, existem Leis que bus-
cam a garantia da inserção participativa destas pessoas na sociedade. O presente estudo busca refletir acerca
da construção histórica da pessoa com deficiência, na luta por sua dignidade e direitos humanos. Quanto aos
procedimentos metodológicos, o estudo caracteriza-se como pesquisa bibliográfica narrativa. Na área jurídi-
ca, ‘homem digno’ é o sujeito de direitos, com autonomia e liberdade, e a característica que garante isso é a
condição de humanidade. Ao analisar fatores históricos, constata-se a presença de discriminação e exclusão
social para com as pessoas com deficiência em diferentes épocas. Foi apenas, a partir das duas grandes Guerras
Mundiais que os direitos desses cidadãos foram sendo reconhecidos, por meio de documentos oficiais, entre
eles: a Declaração Universal dos Direitos Humanos (1948), a Lei 7.853 de 1989 que cunhou a expressão: inte-
gração social, a Declaração de Salamanca (1994) e o Estatuto da Pessoa com Deficiência (2015). Quanto aos
resultados ressalta-se que ao longo da história da sociedade, surgiram às formas de tratamento e participação
social segregacionista, isso ocorreu, especialmente, devido à forma como se priorizava uma ótica com foco
principal na deficiência (o cego, o surdo, etc.) em detrimento de um olhar humanizado que observasse primei-
ro o ser humano e, em segundo lugar, a deficiência que apresentava (a pessoa com deficiência visual, a pessoa
com deficiência auditiva, etc.). Foi a partir da luta pelos direitos e reconhecimento da dignidade da pessoa
com deficiência que este cenário foi ganhando novos horizontes. Contudo, ainda há muito a ser executado em
prol da categoria, no que se refere à inclusão do convívio social e a diminuição dos preconceitos. Conclui-se
que a efetivação dos diretos da pessoa com deficiência necessita de um olhar atencioso das autoridades, e es-
pecialmente da sociedade como um todo, para que de fato as leis se ampliem e sejam aplicadas no cotidiano,
fortalecendo cada vez mais a inclusão e a valorização da dignidade da pessoa com deficiência.

Palavras-chave: Direitos Humanos, Inclusão, Pessoa com deficiência.

211 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

DAS ESTRATÉGIAS DE LEITURA A GÊNEROS TEXTUAIS: UM PASSO PARA O LEITOR


CRÍTICO

Genilson da Silva Oliveira e Patrícia Guimarães Pereira


g.oliveiraufopa@gmail.com
Universidade Federal do Oeste do Pará - UFOPA1 e Universidade Federal do Oeste do Pará - e UFOPA2

Resumo: O presente trabalho objetiva entender as transformações no ensino de língua portuguesa, a partir de
ações e aprendizagens relacionadas à educação, considerando o sujeito como um ser ativo, bem como constru-
tor de opiniões. Percebe-se a necessidade de ampliar as formas de leitura, por conseguinte, desenvolver essa
habilidade no ambiente escolar, como recurso para compreender o mundo. Diante disso, partindo das práticas
sociais, culturais e profissionais, questiona-se: como as estratégias de leitura podem prover um leitor ativo em
prol de uma ação na interatividade sócio espacial? Propõe-se o resgate de reflexões a respeito da educação
de língua portuguesa nas escolas públicas e privadas, com destaque ao conceito ao ensino de gêneros textuais
em sala de aula. Por conseguinte, aplica-se uma pesquisa qualitativa, com enfoque em autores na área da lin-
guística e da educação, a citar, MARCUSCHI (2004), cujo estudo trata de estratégias de leitura, e GERALDI
(1984), o qual faz uma distinção das propostas para o ensino de português, ainda, analisa o papel do professor
em sala de aula. Destarte, ao que tange à formação de um leitor crítico, observa-se a premente necessidade do
ensino dos gêneros textuais para além das aulas de português, pois os recursos linguísticos estão presentes em
diversas tipologias. Além disso, o gênero textual facilita a aproximação entre o ensino e a realidade objetiva
do educando. Portanto, o enfoque dos diversos gêneros textuais deve ser compreendido como um instrumento
didático eficaz.

Palavras-chave: Língua Portuguesa. Aprendizagem. Gênero textual.

212 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ANGIOGRAFIA DE MEMBROS SUPERIORES

DANIELLA MESQUITA DE MATOS, Geise Nogueira Santos, JESIMIEL DE SOUSA GUIMARAES, LINDE-
TE OLIVEIRA DE MEDEIROS NETA e MARCIA LILIAN MELO DE MIRANDA
nogueirageise2@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: A Angiografia é um exame radiográfico dos vasos após a injeção de um meio de contraste, devido as
densidades relativas dos tecidos moles do corpo. O meio de contraste deve ser utilizado para visibilidade do
sistema circulatório. O objetivo do estudo é descrever a angiografia e procedimentos intervencionistas. A me-
todologia adotada para este estudo contou com a consulta direta a livros impressos disponíveis na biblioteca
do Instituto Esperança de Ensino Superior e artigos científicos hospedados na internet. A Literatura descreve
que devido as partes moles do corpo possuírem densidades radiográficas diferentes, o meio de contraste utili-
zado é adicionado para estudar a distribuição normal e anormal do sistema circulatório e as indicações clinicas
incluem: doença aterosclerótica, oclusão do vaso e estenose, traumatismo, neoplasia, embolia e trombo. A
angiografia periférica pode ser um arteriograma, aonde a injeção é administrada pela técnica denominada ca-
teterismo, que vem ser a passagem de um cateter, sendo o mesmo um fino tubo plástico de aproximadamente
1,5mm que é introduzido em uma artéria ou um venograma em que a injeção é administrada na local que será
examinado. O cateter avançado junto à aorta torácica e abdominal, para o estudo de membro superior esquer-
do, a artéria subclávia é utilizada e para o estudo do membro superior direito a artéria empregada é a subclávia
direita advinda do tronco braquiocefálico. A técnica Seldinger é empregada para aceder a artéria femoral ou
um local alternativo para a injeção, para operar o arteriograma periférico. Bontrager 2015 menciona a imagem
do membro superior também exige marcação do fluxo sanguíneo; a diferença entre a imagem de membros in-
feriores e superiores é que a imagem é unilateral para membros superiores e, dependendo da área de interesse,
a imagem de membros inferiores pode ser unilateral ou bilateral. Logo, faz-se a conclusão de que a angiografia
de membros superiores é essencial para dimensionar as lesões, todavia o conhecimento preciso da anatomia é
de extrema importância, a fim de que não ocorram erros como a introdução do cateter numa artéria imprópria
ou se perca o tempo de contraste, por isso aperfeiçoa-se na área da imaginologia é indispensável.

Palavras-chave: Veja,artéria,Vaso, artéria, angiografia

213 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

CREATININA COMO PREDITOR INSUFICIENTE NO DIAGNÓSTICO DE DOENÇA RE-


NAL CRÔNICA

Martinho de Souza Leite, Ítalo Alexander Garcia da Silva e Cassiano Júnior Saatkamp
martinholeite@hotmail.com
Universidade Federal do Oeste do Pará - UFOPA1, Fundação esperança - , IESPES2 e Fundação esperan-
ça - e IESPES3

Resumo: Grupos de doenças e síndromes metabólicas podem diminuir a expectativa laboral do indivíduo
em estados agravados de comorbidade. A doença renal crônica vem apresentando taxa de incidência de 8%,
agravado pela condição de seu diagnóstico que ocorre tardiamente, tendo a alíquota da creatinina como prin-
cipal fator para a estimativa de comprometimento renal por meio da Taxa de Filtração Glomerular. O objetivo
desta revisão de literatura é apresentar os questionamentos sobre a creatinina como insuficiente fator preditor
da doença renal crônica, além de auxiliar os profissionais de saúde a não proverem pré-diagnóstico com base
na creatinina taxada dentro da equação de filtração. Mesmo a literatura mostrando outros marcadores renais
para o diagnóstico da doença renal crônica, a creatinina sérica permanece no rol de exames para avaliação da
função renal.

Palavras-chave: biomarcadores, função renal, TFG

214 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO DA QUALIDADE DE VIDA DO PACIENTE HEMODIALÍTICO

Ellen Caroline Santos Navarro, Kamila Brielle Pantoja Vasconcelos, Kellen Fernanda Oliveira Almeida,
Mônica Brasil Silva, Jailson Torres de Menezes, Erivan Souza Lima e ANTONIA REGIANE DUARTE
navarrocaroll@gmail.com
Instituto Esperança de Ensino Superior - IESPES1, Faculdade da Amazônia - , UNAMA2, Faculdade da
Amazônia - , UNAMA3, Faculdade da Amazônia - , UNAMA4, UNIVERSIDADE DA AMAZONIA - , UNA-
MA5, Faculdade da Amazônia - , UNAMA6 e Faculdade da Amazônia - e UNAMA7

Resumo: Sabe-se que a Qualidade de Vida (QV) tem se tornado importante critério para avaliar a eficácia de
tratamentos e intervenções na área da saúde, analisando impactos sofridos por pacientes portadores de doen-
ças crônicas. O doente renal crônico experimenta uma drástica mudança em sua vida, convivendo com muitas
limitações, como: tratamento hemodialítico doloroso; dietoterapia rígida; mudanças no cotidiano familiar,
profissional e social; o pensamento na morte fica frequente, o que leva o indivíduo a ter uma percepção nega-
tiva sobre a saúde. O apoio dos profissionais de saúde com pacientes renais crônicos submetidos a tratamento
hemodialítico é de fundamental importância para contribuir com a qualidade de vida desse indivíduo, uma
vez que ele atua não somente na esfera física, mas psicológica, por estar em contato direto com o paciente e
família. Diante desta problemática o tema em pauta buscou responder como que as variáveis de cunho físico,
emocional, social e financeiro, comprometem a qualidade de vida da pessoa portadora de insuficiência renal
crônica, submetidos à hemodiálise no município de Santarém - Pará. O presente estudo objetiva mensurar
a qualidade de vida dos pacientes em tratamento, qualificando os amplos aspectos de sua vida, sendo uma
pesquisa de cunho descritivo, transversal, quantitativo e comparativo. Participaram do estudo trinta pacientes
renais crônicos em hemodiálise no Hospital Regional do Baixo Amazonas Dr. Waldemar Pena, com auxilio
do instrumento validado e qualificado WHOQOL-bref. Observou-se que em relação a qualidade de vida geral
dos pacientes entrevistados, a média que resultou (três vírgula treze) é considerada como regular qualidade de
vida, onde constatou-se similaridade perante os demais domínios pesquisados: Físico (três vírgula quatorze);
Psicológico (três vírgula trinta e seis); Relações Sociais (três vírgula oito); Meio Ambiente (três vírgula quin-
ze). Por fim, conclui-se que os pacientes entrevistados apresentam regular qualidade de vida, devido diversos
fatores que deprimem desde seu bem estar físico, ao psicológico, afetando também, suas relações familiares
e sociais.

Palavras-chave: Doença Renal Cronica,Qualidade de vida,Hemodiálise

215 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

EXTRATIVISMO DO AÇAÍ: INFLUÊNCIA NA RENDA FAMILIAR DOS MORADORES DA


COMUNIDADE DE MURUMURU, SANTARÉM-PARÁ

Emilly Pinheiro de Oliveira, João Ricardo Vasconcellos Gama e Lucas Cunha Ximenes
emillyde-oliveira@hotmail.com
Universidade Federal do Oeste do Pará - UFOPA

Resumo: Resumo: O açaizeiro (Euterpe oleracea Mart.), palmeira de porte arbóreo, nativa da Amazônia bra-
sileira, pertencente à ordem Arecales, gênero Euterpe e da família Palmae, possui procedência em áreas de
várzeas alta, baixa e igapó e em áreas de terra firme, principalmente quando próximas a áreas de igapó e várzea
e tem o estado do Pará como o principal dispersor natural dessa palmeira. A atividade extrativista do açaí teve
início por conta da crise da agricultura e da quase extinção da espécie pela prática do extrativismo de aniqui-
lamento e nos últimos anos tal atividade extrativista movimentou 91,9% da produção nacional, proveniente
da região Norte, sendo que atualmente possui grande visibilidade, principalmente quando se trata da polpa
ou vinho, produto este extraído do fruto do açaizeiro. De modo que o trabalho teve por objetivo investigar a
influência do açaí na economia familiar dos moradores da comunidade de Murumuru. A pesquisa se deu na
comunidade de Murumuru, delimitada como território quilombola, situada na região do planalto, localizada
a 45 km da área urbana de Santarém-PA, caracterizada como área de terra firme, porém, com procedência em
seu entorno do Lago Maicá. A metodologia se baseou em entrevistas com questionários semiestruturados por
meio da técnica bola de neve, a qual os dados foram posteriormente tabulados e processados com o auxílio
do software Excel 2013. A análise dos dados demonstrou que a extração do fruto é realizada principalmente
na área de igapó e a comercialização se dá majoritariamente de forma primária (in natura). Tal fator que pode
ser explicado pela distância e dificuldade de acesso que liga a comunidade ao mercado consumidor, sendo um
obstáculo para a comercialização de subprodutos como o vinho. A participação na renda proveniente do açaí
se destaca como a principal, sendo que na safra de verão constitui uma participação de mais de 40% e na safra
de inverno com mais de 10% do total da renda familiar de todos os entrevistados. O preço em tais períodos
distintos pode variar entre 35 a 70 reais, demonstrando a importância socioeconômica do recurso durante todo
o ano. De acordo com os resultados obtidos pode-se concluir a expressividade do açaí para a comunidade,
principalmente da procedência do mesmo na área da união (igapó) que acaba por não prover custos adicionais,
como em tratos silviculturais e por ter uma parte da produção extraída consumida e outra comercializada, sen-
do assim fonte de renda e subsistência.

Palavras-chave: Amazônia,Euterpe oleracea,Produção

216 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

AVALIAÇÃO DO EFEITO CICATRIZANTE DE CORONOPUS DIDYMUS (L.) SMITH EM


LESÕES CUTÂNEAS EXTERNAS EM RATOS WISTAR

Vitor Farias Jati, Elizane Sales Sousa, Lidia Thayse Oliveira, Adriana Lemos Pereira, Pamela Tafany Sus-
suarana, Raylane Rodrigues Alves e José Oliva Apolinário Segundo
vjati25@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: A enfermagem estende-se ao campo da pesquisa, contribuindo à descoberta de novos conhecimentos.


O uso de espécies vegetais para a cura de doenças e lesões remota ao inicio da civilização. Nesse contexto,
destaca-se o Coronopus didymus (L.) Smith, ou Mastruz, como é popularmente conhecida na região, planta
nativa da América do Sul, da família Bassiacaceae de ordem Brassicale. Sendo assim, estudar e investigar
sobre o tema proposto é importante para tornar indubitável o conhecimento empírico, já que não há muitos
estudos sobre a mesma. Desse modo, o objetivo do presente trabalho consistiu em analisar a atividade cica-
trizante do Coronopus Didymus (l.) Smith em lesões cutâneas externas. Foram utilizados ratos da linhagem
Wistar (n=5), machos com peso entre 200 a 250g. Os animais foram divididos em 3 grupos: Grupo controle,
que não recebeu nenhum composto durante os dias de tratamento; Grupo Via Oral, que recebeu durante os
dias de tratamento o liquido extraído por via oral e; Grupo tópico, que recebeu durante os dias de tratamento
o extrato de mastruz topicamente sobre a lesão cutânea exposta. As lesões cutâneas foram feitas na região na
região dorsal, sob anestesia, em um tamanho de 1 cm². Folhas de Mastruz foram coletadas e maceradas para
obtenção do sumo, o qual foi armazenado em recipiente estéril e mantido em refrigeração durante o tempo de
tratamento, oral e tópico, por 14 dias consecutivos. Nos tempos 0, 5, 10 e 14 dias de tratamento, foram realiza-
das fotografias de cada lesão, a uma distância padronizada. Após o tratamento, os animais foram submetidos à
eutanásia. Para o dimensionamento da área cicatrizada, foi utilizado o software ImageJ que permitiu calcular,
em cm² a área de cada lesão. Após isso, as informações geradas a partir do respectivo programa foram inse-
ridas em planilhas no software Excel. Os resultados demonstraram haver uma redução da área da ferida nas
lesões do grupo tópico, quando comparados ao grupo controle. Não houve diferença na evolução da cicatri-
zação das feridas do grupo oral, quando comparado ao mesmo grupo controle. Por intermédio dos resultados
obtidos no presente estudo, pode-se concluir que o sumo de Coronopus didymus (L.) Smith aplicado sobre as
lesões cutâneas apresenta algum componente fitoquímico com atividade cicatrizante, pois se mostrou efetivo
no processo de cicatrização nos ratos Wistar. Esses resultados sugerem novas pesquisas que visem identificar
tais compostos fitoquímicos que possam ser utilizados em preparações farmacêuticas nos cuidados de enfer-
magem de tratamento de feridas.

Palavras-chave: Coronopus didymus (L.) Smith, mastruz, enfermagem

217 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

OS ASPECTOS GERAIS DO CUMARU (DIPTERYX ODORATA WILLD)

Ana Paula da Silva Cruz, Ana Carolina Pereira Dos Santos, Yan Vitor Silva Oliveira, Vanessa Ross De Sou-
sa Teixeira e Keyla Pereira Tiago
paula.anacruz06@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: O cumaru (Dipteryx odorata Willd) pertencente à família da Fabaceae, é uma árvore de porte ele-
vado, de caule reto e casca avermelhada ou amarelo-acinzentada, possui flores vermelhas que exalam um
perfume forte e também agradável, possui frutos em forma de drupa, de cor verde-amarelada que quando
maduros e secos fendem-se liberando sua semente coberta por uma película roxa-escura, oleosa e aromáti-
ca. Seu principal princípio ativo é a Cumarina. O cumaruzeiro é uma espécie comum na metade oriental da
Amazônia, desde o litoral do Pará até Manaus, e nos afluentes meridionais até os médios cursos do Tocantins
e Tapajós. Diante disto, objetivou-se revisar a literatura cientifica sobre o cumaru, tendo resultados através de
estudos bibliográficos do tipo exploratório descritivo, utilizando como fonte de pesquisa, artigos publicados
no período entre os anos 2004 a 2014, foram utilizados cinco artigos e um livro sendo que foram excluídos
três destes artigos por não possuírem informações relevantes à pesquisa. As sementes, são usadas popular-
mente como diaforéticas ou sudoríficas. A partir do cozimento dos frutos e das sementes, obtém-se um tipo
de remédio ou fortificante com propriedades anestésicas que auxilia no tratamento de problemas respiratórios
e cardíacos, além de combater vermes, incluindo-se amebíase. Com a casca, prepara-se um xarope usado no
combate a tosses, gripes e problemas pulmonares. O óleo da amêndoa pode ser usado diretamente em úlce-
ra bucal, otite (dor de ouvido) e em problemas no couro cabeludo. Portanto o princípio ativo encontrado no
cumaru é responsável por suas propriedades terapêuticas que estão presente no fruto e na casca tendo emprego
também industrial como sucedâneo da baunilha para perfumar tabacos, chocolates e bebidas pelo seu intenso
aroma e suas folhas tem grande aplicabilidade no ramo da cosmética. <!--[if gte mso 9]> <w:LsdException
Locked="false" Priority="9"

Palavras-chave: Cumaru,cumarina,Dipteryx odorata Willd

218 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ASSISTÊNCIA DE ENFERMAGEM EM CRIANÇAS PORTADORAS DE DOENÇAS CRÔNI-


CAS EM UNIDADE DE TERAPIA INTENSIVA DE UM HOSPITAL PÚBLICO DA CIDADE
DE SANTARÉM, ESTADO DO PARÁ

Kamila Brielle Pantoja Vasconcelos, Ellen Caroline Santos Navarro, Lilian Mota Oliveira, Maria Nazareth
dos Santos, Jailson Torres de Menezes, Erivan Souza Lima e ANTONIA REGIANE DUARTE
kamilabrielle@hotmail.com
Faculdade da Amazônia - UNAMA1, Instituto Esperança de Ensino Superior - , IESPES2, faculdade da
amazonia - , UNAMA3, Faculdade da Amazônia - , UNAMA4, Faculdade da Amazônia - , UNAMA5, Fa-
culdade da Amazônia - , UNAMA6 e Faculdade da Amazônia - e UNAMA7

Resumo: As doenças crônicas são patologias que tem um longo curso podendo ser incuráveis, deixando se-
quelas e impondo limitações às funções do indivíduo, requerendo adaptação, e a principal característica da
doença é a duração mínima de três meses e a hospitalização, por no mínimo, um mês contínuo no período de
um ano. Os grupos de maior risco para serem internados em uma unidade de terapia intensiva são os pacientes
com história de prematuridade, baixo peso ao nascer e portadores de doença pulmonar crônica, cardiopatia
congênita e doenças neuromusculares. As doenças que mais afetam as crianças quando relacionada a croni-
cidade são as cardiopatias congênita, doença pulmonar crônica e doenças neuromusculares. Os cuidados dos
profissionais de enfermagem são muito importantes, apresentando como enfoque principal a recuperação e o
conforto do cliente, que exige dos profissionais um esforço constante no entendimento da complexidade e fra-
gilidade do ser humano sob sua responsabilidade. Apesar disso, é importante que a enfermagem não mantenha
seu cuidado apenas no seu cliente, ou seja, a criança, mas esteja sensível a todas as modificações, sentimentos,
percepções, significações que a família vivencia para fornecer o cuidado adequado a cada situação, tendo
em mente que essa família sob seus cuidados encontra- se em um momento difícil, sob tensão emocional.O
presente estudo objetivou descrever a assistência da equipe de enfermagem prestada a crianças portadoras de
doenças crônicas em unidade de terapia intensiva pediátrica (UTIP). A pesquisa foi caracterizada uma aborda-
gem qualitativa e quantitativa que buscou os resultados mediante a aplicação de questionários com perguntas
abertas e fechadas para a equipe de enfermagem, e levantamento de dados nos prontuários das crianças com
diagnostico de doenças crônicas internadas na UTIP. Com os resultados pode-se observar que crianças com
doenças crônicas necessita de um período maior de internação e de cuidados de enfermagem mais específicos.
Com isso a equipe de enfermagem utiliza indicadores de qualidade para evidenciar os riscos que essas crianças
estão sendo expostas, e de acordo com cada risco evidenciado é aplicado as práticas de controle. Conclui-se
que os profissionais deveriam receber mais apoio psicológico, pois os mesmos estão lidando com pacientes
expostos a uma série de fatores de risco, dessa forma o apoio emocional para a equipe contribuiria na qualifi-
cação das atividades realizadas diariamente e facilitaria o relacionamento entre profissionais e família.

Palavras-chave: Doenças crônicas,Cuidados,Enfermagem

219 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

SEGURANÇA DO TRABALHO: UM ESTUDO NA EMPRESA MRW ENERGIA NA PERCEP-


ÇÃO DOS AGENTES DE COBRANÇA.

ROMILDA DA SILVA UCHOA, WANDERSON LOPES DE OLIVEIRA, MURILO HENRIQUE LIMA MAIA,
RODRIGO ESTEVES FELEOL, JOÃO AUGUSTO LIMA COSTA e JUAREZ BENEDITO SILVA SILVA
romildauchoa@gmail.com
Iespes - IESPES

Resumo: Compreende-se que a saúde e a segurança no trabalho nos tempos atuais são itens imprescindíveis e
que estão diretamente ligadas à valorização do elemento humano, a disseminação de informações sobre a pre-
venção de acidentes e doenças do trabalho são crescentes e decisivas para que a qualidade de vida no ambiente
de trabalho seja valorizada. Bisso (1990, p.15) relata que: “o trabalho foi uma atividade incorporada à própria
existência do ser humano, todavia, a preocupação em controlar os malefícios causados ao homem pelo trabalho
é bem recente”. Nesse sentido, faz-se necessário desenvolver este trabalho, que tem como objetivo conhecer
os benefícios que a Segurança do Trabalho tem a oferecer para as organizações. A pesquisa foi desenvolvida
por meio de uma pesquisa bibliográfica e de campo com abordagem quantitativa, através de um questionário
com dez perguntas fechadas para 08 Agentes de Cobrança, cujo total são 10 que correspondem a amostragem
de 80% do universo da pesquisa. Detectou-se que, 100% dos agentes são do sexo masculino, por unanimidade
responderam que para a empresa obter sucesso e garantir-se no mercado, a mesma precisa desenvolver ativi-
dades relacionadas à segurança, bem como fornecer os equipamentos necessários e orientar quanto ao uso e
conservação destes. No item treinamentos de segurança, todos garantiram ter passado por diversos, tais como:
Comissão Interna de Prevenção de Acidentes – CIPA, Programa de Prevenção de Riscos Ambientais – PPRA,
Equipamento de Proteção Individual - EPI e Equipamento de Prevenção Coletiva – EPC, etc. Conclui-se que,
a Segurança do Trabalho está relacionada com os resultados do setor operacional da empresa e que a mesma
é de fundamental importância para a organização, assim como para o trabalhador, uma vez que somente com
segurança a integridade física dos colaboradores será preservada e os resultados positivos serão garantidos.

Palavras-chave: segurança no trabalho,agentes de cobrança,benefícios,Segurança no trabalho

220 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

A PRÁTICA NA FORMAÇÃO DOS ACADEMICOS DE LICENCIATURA EM PEDAGOGI-


CA: RELATO DA VISITA TECNICA NA ESCOLA DE ENSINO TECNICO DO ESTADO DO
PARÁ (EETEPA)

Sara da Silva Pedroso, Aline Reis Pereira, Ederlen Danielle Gameiro, DEBORA LOPES GONZAGA, Naira
Danielle da Costa Corrêa, Thamires Luana Ferreira Pereira, VANESSA SAMPAIO SILVA e Marinete Costa
de Lima
sarapedrosostm@gmail.com
Instituto Esperança de Ensino Superior - IESPES

Resumo: A prática pedagógica como componente curricular ocupa um papel importante nos cursos de licen-
ciatura, pois possibilita aos acadêmicos vivenciarem momentos de aprendizagens, relacionando a teoria com
a prática. Neste sentido, os acadêmicos do Curso de Pedagogia do Instituto Esperança de Ensino Superior/
Iespes, através das disciplinas de Práticas Pedagógicas II e Estágio Curricular Supervisionado em Educação
Profissional, realizaram uma visita técnica na Escola de Ensino Técnico do Estado do Pará (EETEPA), no
município de Santarém, com o objetivo de conhecer a funcionalidade desta instituição, tanto no campo ad-
ministrativo como no campo pedagógico, considerando a importância do conhecer e do saber das diversas
atuações do Pedagogo, nos diferentes níveis e modalidades da educação básica. A EETEPA de Santarém foi
inaugurada no dia 12/06/2017 e a partir de 05 de agosto do mesmo ano, iniciou suas atividades educativas com
os educandos. A escola atende cerca de 800 educandos nas seguintes modalidades: ProEJA (Programa Nacio-
nal de Integração da Educação Básica com a Educação Profissional na Modalidade de Educação de Jovens e
Adultos), Ensino Médio Integrado à Educação Profissional, Ensino Concomitante ao Ensino Médio e Subse-
quente ao Ensino Médio, conforme preconiza o artigo 36-B da LDB 9394/96 que estabelece a forma como a
Educação Profissional Técnica de nível médio deve ser desenvolvida: I – articulada com o Ensino Médio, sob
duas formas: II – integrada, na mesma instituição, III – concomitante, na mesma ou em distintas instituições;
IV – subsequente, em cursos destinados a quem já tenha concluído o Ensino Médio. Atualmente, a escola ofer-
ta os cursos de Técnicos em Informática, em Logística, em Segurança no Trabalho, Meio Ambiente, Turismo e
Alimentos, além de ofertar Cursos de Formação Inicial e Continuada (FICs). As atividades foram as seguintes:
visita de reconhecimento do espaço, sob a orientação do Pedagogo da instituição, com apresentação do quadro
de funcionários e suas devidas formações e funções, seguido de uma roda de conversa sobre a dinâmica de tra-
balho da escola, a forma de oferta do ensino e o público alvo atendido. A partir da conversa com o pedagogo da
instituição chegamos à conclusão que a prática pedagógica tem papel fundamental na formação do educando,
principalmente quando trabalhada de forma integrada entre teoria e prática, pois o processo de aprendizagem
evolui e os resultados aparecem de forma satisfatório, sobretudo no campo experienciais do conhecer e do
fazer, a fim de fazer a diferença no campo profissional.

Palavras-chave: Práticas pedagógicas,Visita técnica,Educação profissional

221 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

SÍNDROME DE BURNOUT EM PROFESSORES DE UMA INSTITUIÇÃO PRIVADA DO EN-


SINO FUNDAMENTAL EM SANTARÉM, PARÁ.

Anne Caroline Salgado, Vitor Farias Jati, Larissa Ádna Neves Silva e Heloisa do Nascimento Moura Mene-
ses
anne.jesusfreak@gmail.com
Instituto Esperança de Ensino Superior - IESPES1, Instituto Esperança de Ensino Superior - , IESPES2,
Universidade Federal do Oeste do Pará - UFOPA3 e Universidade Federaldo Oeste Do Parà - e UFOPA4

Resumo: O Burnout ou “Síndrome do esgotamento” tem sido definido como uma resposta ao estresse laboral
crônico caracterizado pela presença de sentimento de inadequação pessoal, exaustão emocional, falta de rea-
lização profissional e tratamento despersonalizado com clientes ou usuários. O trabalho tevecomo objetivo
principal: investigar a saúde dos professores em um Escola Privada de Ensino Fundamental, no município
de Santarém/PA, caracterizando os principais fatores que ocasionam a Síndrome de Burnout, a fim de com-
preender o enfrentamento aos fatores estressores inerentes ao exercício da profissão docente. Trata-se de uma
pesquisa descritiva, com abordagem quantitativa, na qual a amostragem contabilizou 19 professores, sendo
aplicado um questionário dividido em duas partes: a primeira, a fatores socioeconômicos e a segunda, para re-
lacionar o fator trabalho à saúde. A exaustão emocional, a despersonalização e a baixa realização profissionais
foram as categorias criadas e percebeu-se que um grande número de professores estão esgotados emocional-
mente e preocupados com o seu relacionamento interpessoal, no entanto estão satisfeitos com a sua conduta
e exercício profissional. Assim, o professor, deve ser capacitado a cuidar de si e agir em grupo na defesa da
promoção de qualidade de vida, devendo perceber a escola como espaço de humanização e promoção de saú-
de, onde as práticas educativas não devam se limitar as tradicionais ações pedagógicas, e, sim, a possibilitar
também as transformações individuais e sociais.

Palavras-chave: Burnout, docentes, saúde.

222 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

MALÁRIA PULMONAR ASSOCIADA A SEPTICEMIA: UM RELATO DE CASO

Martha Nunes Freitas, Ellen Caroline Santos Navarro, Kamila Brielle Pantoja Vasconcelos, Antonia Regia-
ne Duarte e Gilvandro Ubiracy Valente
marthanunesf@gmail.com
CENTRO UNIVERSITÁRIO INTERNACIONAL - UNINTER1, Instituto Esperança de Ensino Superior - ,
IESPES2, Faculdade da Amazônia - , UNAMA3, Faculdade da Amazônia - , UNAMA4 e Universidade do
Estado do Pará - e UEPA5

Resumo: A malária constitui um dos maiores problemas de saúde pública no mundo. No Brasil três espé-
cies estão associadas a malária em seres humanos: Pasmodium vivax, Plasmodium falciparum e Plasmodium
malariae. A Região Amazônica é considerada endêmica e responsável pela maioria dos casos notificados no
Brasil, concentrando mais de noventa por cento dos casos autóctones. Objetiva-se relatar um caso de malária
pulmonar e fornecer subsídios para o diagnóstico e terapêutica da patologia. Trata-se de um estudo descri-
tivo, com abordagem qualitativa. Os dados foram coletados através do acompanhamento do caso clínico e
das anotações em prontuários do paciente. Os resultados mostram que a malária representa uma emergência
médica que requer diagnóstico e tratamento prontamente. O acompanhamento adequado, o diagnóstico rápi-
do e as medidas de suporte avançado diminuem a mortandade relacionada à doença. Por outro lado, as áreas
de garimpo, bem como as de construção de hidrelétricas, estradas e de exploração mineral, que apresentam
grande fluxo migratório e possuem ambiente favorável para a transmissão são um desafio para o controle da
malária no Brasil e necessitam de uma atenção especial em relação as medidas de controle como forma de se
evitar novos casos. Apesar da malária apresentar altos índices de casos registrados na Amazônia, obteve-se
uma redução de, aproximadamente, dez por cento do número de casos em dois mil e dezesseis. Em relação
ao número de óbitos também houve queda de sessenta e oito por cento, evidencia-se ademais uma redução de
setenta e seis por cento dos casos nos últimos dez anos, conforme dados do Ministério da Saúde. Dessa forma
faz-se necessário que além dos usuários, os profissionais de saúde tenham um melhor comprometimento com
o atendimento de um paciente acometido por malária. Conclui-se que tal redução esteja associada a campa-
nhas de prevenção e tratamento da doença na Região Amazônica. O início do tratamento deve ser o mais pre-
coce possível, pois o principal fator determinante das complicações na malária por Plasmodium Falciparum,
sobretudo em adultos não imunes, é o atraso de seu diagnóstico e postergação da terapêutica específica, fato
este constatado no caso em questão.

Palavras-chave: Anopheles, malária, saúde pública

223 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PERCEPÇÃO ENTOMOLÓGICA DOS ALUNOS DE ENSINO FUNDAMENTAL DA COMU-


NIDADE INDÍGENA (MUNDURUKU) EM AÇAIZAL, SANTARÉM-PA

Tainã Silva da Rocha, Everton Cruz da Silva, Leandro de Matos Souza e José Max Barbosa de Oliveira Ju-
nior
tainasilva.tr@gmail.com
Universidade Federal do Oeste do Pará - UFOPA

Resumo: A classe Insecta está inserida no filo Arthropoda, os quais possuem corpo segmentado dividido em
três tagmas; e três pares de pernas e sendo o grupo mais abundante e diversificado. O ensino de Ciências, nas
séries iniciais do Ensino Fundamental, busca colaborar para que o estudante entenda o mundo e suas trans-
formações. Diante disto, o nosso objetivo foi analisar, conhecer e comparar a percepção entomológica de
alunos do 6° ao 9º ano do ensino fundamental da escola pública indígena, Dom Pedro II; além de analisamos
possíveis influências das instâncias culturais e do conhecimento popular na formação escolar sobre os insetos
identificadas junto a esses alunos. O estudo foi desenvolvido na escola indígena (Munduruku) Dom Pedro II
de Açaizal, localizada em zona rural de Santarém-PA. Trata-se de um estudo com abordagem descritiva/ qua-
litativa. Realizamos: palestras, apresentações de vídeos e atividades educacionais. Os dados adquiridos foram
analisados segundo o modelo de união das diversas competências individuais. Foram aplicados 38 questioná-
rios a alunos do 6º ao 9º ano do ensino fundamental onde, 14 eram do sexo masculino e 24 do sexo feminino,
entre 11 e 15 anos. Quanto a taxonomia, perguntou-se o filo pertencente dos insetos, dos 38 alunos 53% não
souberam responder e apenas 5% respondeu acertadamente. Após a aplicação das atividades educacionais esse
percentual melhorou consideradamente, onde 95% respondeu corretamente. Quando perguntado se gosta ou
não dos insetos e o porquê, 63% responderam de forma negativa associando os insetos a seres repugnantes
transmissores de doenças, os 37%restantes responderam gostar, porém, não atribuíram a real importância aos
insetos. Posteriormente à palestra, 72% responderam gostar dos insetos e as justificativas associaram esses
animais à importância ecológica, medica e social. Sobre o hábtat, 90%respondeu de forma equivocada. Depois
das atividades 84%respondeu corretamente. Sobre a importância dos insetos, 48%dos alunos afirmaram que
os insetos possuem importância positiva e apenas 4%respondeu que os insetos têm importância negativa. Dos
animais percebidos como insetos, 51%eram da classe Insecta, contudo 49% assinalaram outros animais com
classificação taxonômica diferente dos insetos. Mostrando confusão na distinção do que é ou não um inseto,
após as atividades 99% marcou corretamente os insetos. A nota para a matéria de ciências dada pelos alunos
variou de 7 a 10. As práticas educacionais propostas neste trabalho demonstraram que os participantes das ati-
vidades lúdicas educacionais, entrevistados adquiriram conhecimento apropriado sobre a biologia dos insetos,
principalmente sobre a sua importância médica, ecológica e social.

Palavras-chave: Indígena,Percepção,Entomologia

224 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

TOXICIDADE DO HERBICIDA ATRAZINA EM PEIXES DE ÁGUA DOCE

Alessandra de Sousa Silva, Soraia Baia dos Santos, Ana Caroline Castro, Joseph Simões Ribeiro, Isabella
Clarissa Vasconcelos Rêgo, Igor Gonçalves Leal, Soraia Valéria Oliveira Coelho Lameirão e Ruy Bessa Lo-
pes
alessandra.ufopa@gmail.com
Universidade Federal do Oeste do Pará - UFOPA

Resumo: Atrazina é um herbicida usado em lavouras de soja, milho e arroz, considerado muito tóxico para
organismos aquáticos. Visualizando os ambientes aquáticos como principais receptores de contaminantes da
agricultura, pode-se considerar a hipótese de que os peixes, como grandes grupos, são diretamente atingidos
pela toxicidade dessas substâncias. Na última década foi possível ter acesso a trabalhos com testes de toxicida-
de realizados envolvendo organismos aquáticos, principalmente peixes, e atrazina. Dos quais podemos desta-
car, o estudo de Moron et al., (2006) que buscou analisar alterações nas frequências de micronúcleos e distúr-
bios na regulação iônica relacionados ao efeito direto do tecido branquial de pacu (Piaractus Mesopotamicus)
exposto ao herbicida atrazina. Além desse, Chapadense et al., (2009) teve como objetivo investigar a toxici-
dade da atrazina com a espécie tambaqui (Colossoma macropomum). Os autores também observaram número
de micronúcleo e eritrócitos durante a exposição dos peixes. Dong et al., (2009) também realizou bioensaios
de usando atrazina e zebrafish (Danio rerio). Tillit et al., (2010) observaram efeitos neuroendócrinos em pei-
xes (Pimephales promelas) provocados pela atrazina. A pesquisa de Xing et al., (2012), observou os efeitos
de atrazina sobre as células de Purkinje em carpas, e Paulino et al., (2012) apresentaram em seus resultados a
avaliação do estresse oxidativo nas brânquias da espécie Prochlodus lineatus através da exposição primária da
atrazina. A toxicidade da atrazina também pode exercer influências peculiares em peixes ornamentais, como
foi demonstrado no estudo de Shenoy (2012), que avaliou a exposição em Guppies machos (Pœcilia reticu-
lata) observando o pesticida como poluente e alterações de comportamentos sexuais da espécie. A pesquisa
de Castro et al., (2013) teve como objetivo testar a toxicidade da atrazina e seus respectivos efeitos (sanguí-
neos e teciduais) para a espécie lambari (Astyanax sp), comparando sua resistência à toxicidade do pesticida
entre a tilápia (Tilapia mossambicus) e o tambaqui. Analisando de modo geral, por meio desses trabalhos é
possível constatar que a atrazina, quando alcança ambientes aquáticos, pode ser um potencial contaminante
para diversos grupos de peixes de água doce, atingindo órgãos e sistemas diferenciados, que podem induzir
a mortalidade e perda de funções importantes desses animais, alterando assim todo um ecossistema atingido.

Palavras-chave: Toxicidade,herbicida,atrazina,peixes

225 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

CATETER CENTRAL DE INSERÇÃO PERIFÉRICA: PRINCIPAIS INDICAÇÕES, RISCOS


E BENEFÍCIOS NA UNIDADE DE TERAPIA INTENSIVA NEONATAL

Erivan Souza Lima, Ellen Caroline Santos Navarro, Kamila Brielle Pantoja Vasconcelos, Mônica Brasil Sil-
va, Queila Silva Oliveira, Jailson Torres de Menezes e ANTONIA REGIANE DUARTE
erivanlima226@yahoo.com
Faculdade da Amazônia - UNAMA1, Instituto Esperança de Ensino Superior - , IESPES2, Faculdade da
Amazônia - , UNAMA3, Faculdade da Amazônia - , UNAMA4, FACULDADE DA AMAZÔNIA - , UNAMA5,
UNIVERSIDADE DA AMAZONIA - , UNAMA6 e faculdade da amazonia - e UNAMA7

Resumo: O alto índice de internações nas Unidades de Terapia Intensiva Neonatais se deve a diferentes pato-
logias congênitas e/ou adquiridas antes, durante ou pós-parto. Tais patologias precisam de um cuidado intensi-
vo, necessitando assim de tratamento medicamentoso a longo prazo, requerendo, portanto, um acesso venoso
com boa durabilidade. Baseado nessas premissas o presente estudo objetivou conhecer sobre o uso do Cateter
Central de Inserção Periférica na Unidade de Terapia Intensiva Neonatal, buscando identificar as principais
indicações para a realização desse procedimento, apontar as vantagens e desvantagens desse dispositivo e des-
crever a atuação do enfermeiro na prevenção de infecções relacionado ao procedimento. Para a construção do
presente estudo foi utilizado o método de pesquisa bibliográfica. A busca dos dados se deu através de consulta
a livros e periódicos impressos e na forma eletrônica, que abordassem sobre indicações para o uso do Cateter
Central de Inserção Periférica em Neonatos e cuidados de enfermagem, foram excluídos do estudo os acervos
publicados anteriores ao ano de dois mil e oito, aqueles que não abordavam sobre o tema proposto e ainda
os estudos e livros em outros idiomas. Os resultados mostraram que o Cateter Central de Inserção Periférica
(PICC) é apontado como um procedimento de prioridade d SÍNDROME DE BURNOUT: EDUCAÇÃO EM
SAÚDE PARA FUNCIONÁRIOS DE UMA UNIDADE BÁSICA DE SAÚDE EM SANTARÉM

Keliane dos Santos Serra, Matheus Eduardo Horta da Costa e Elidiane Moreira Kono
erivanlima226@yahoo.com
UNIVERSIDADE DO ESTADO DO PARÁ - UEPA1, Universidade do Estado do Pará - , UEPA2 e UNIVER-
SIDADE DO ESTADO DO PARÁ - e UEPA3

Resumo: Introdução. A Síndrome de Burnout (SB) é considerada um tipo de estresse de caráter duradouro,
vinculado a situações de trabalho, sendo causada pela constante pressão emocional associada ao intenso en-
volvimento com pessoas. Entre os fatores agravantes para SB estão a sobrecarga de trabalho, remuneração
deficitária e falta de reconhecimento e autonomia na instituição que em que atuam. Os serviços de atenção à
saúde guardam especificidades que lidam com a dor e com o sofrimento das pessoas, tornando os profissio-
nais inseridos neste meio vulneráveis ao desenvolvimento da síndrome. Portanto é necessário a difusão de
informações relevantes sobre a SB. Descrição das ações. Aplicaram-se questionários aos funcionários de uma
unidade básica de saúde em Santarém-Pará para verificar o nível de conhecimento dos participantes sobre
a SB, após a aplicação dos questionários foi feita a intervenção educativa através de palestra e participação
dos funcionários através do diálogo para sanar dúvidas, visando a produção de conhecimento e em seguida o
mesmo questionário foi aplicado novamente para avaliar a efetividade da intervenção. Resultados. Antes da
intervenção, 87,5% das respostas foram negativas. É importante ressaltar a média de 67,5% de respostas ne-
gativas para a pergunta que exigia o mínimo de conhecimento possível sobre a síndrome antes da aplicação da
intervenção. Após a abordagem educativa observou-se significativa mudança nas repostas dos participantes,
visto que 100% das respostas foram positivas para todas as perguntas. Conclusão. Em razão do pouco grau de
instrução dos funcionários públicos a respeito da síndrome, esta acaba sendo negligenciada e não vista como
226 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

SÍNDROME DE BURNOUT: EDUCAÇÃO EM SAÚDE PARA FUNCIONÁRIOS DE UMA


UNIDADE BÁSICA DE SAÚDE EM SANTARÉM

Keliane dos Santos Serra, Matheus Eduardo Horta da Costa e Elidiane Moreira Kono
erivanlima226@yahoo.com
Universidade Do Estado Do Pará - UEPA

Resumo: Introdução. A Síndrome de Burnout (SB) é considerada um tipo de estresse de caráter duradouro,
vinculado a situações de trabalho, sendo causada pela constante pressão emocional associada ao intenso en-
volvimento com pessoas. Entre os fatores agravantes para SB estão a sobrecarga de trabalho, remuneração
deficitária e falta de reconhecimento e autonomia na instituição que em que atuam. Os serviços de atenção à
saúde guardam especificidades que lidam com a dor e com o sofrimento das pessoas, tornando os profissio-
nais inseridos neste meio vulneráveis ao desenvolvimento da síndrome. Portanto é necessário a difusão de
informações relevantes sobre a SB. Descrição das ações. Aplicaram-se questionários aos funcionários de uma
unidade básica de saúde em Santarém-Pará para verificar o nível de conhecimento dos participantes sobre
a SB, após a aplicação dos questionários foi feita a intervenção educativa através de palestra e participação
dos funcionários através do diálogo para sanar dúvidas, visando a produção de conhecimento e em seguida o
mesmo questionário foi aplicado novamente para avaliar a efetividade da intervenção. Resultados. Antes da
intervenção, 87,5% das respostas foram negativas. É importante ressaltar a média de 67,5% de respostas ne-
gativas para a pergunta que exigia o mínimo de conhecimento possível sobre a síndrome antes da aplicação da
intervenção. Após a abordagem educativa observou-se significativa mudança nas repostas dos participantes,
visto que 100% das respostas foram positivas para todas as perguntas. Conclusão. Em razão do pouco grau de
instrução dos funcionários públicos a respeito da síndrome, esta acaba sendo negligenciada e não vista como
uma doença. Portanto, faz-se necessária a educação continuada para ficção das informações nos serviços de
saúde e posterior repasse para a população.

Palavras-chave: Síndrome de Burnout, Educação em saúde, intervenção.

227 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

DURAÇÃO DE VIDA DAS FOLHAS DO PANICUM MAXIMUM CV. BRS ZURI SOB DOSES
CRESCENTES DE NITROGÊNIO EM SOLO AMAZÔNICO

Ana Júlia da Silva Corrêa, Carlos Mikael Mikael, Rogério Rangel Rodrigues, Luciano de Sousa Chaves,
Adriano Araújo da Silva, Carlos Eduardo Pedroso de Sousa, Mailana Almeida de Souza e Clécio Henrique
Limeira
anajuliasc002@gmail.com
Instituto Federal de Educação, Ciência e Tecnologia do Pará - IFPA

Resumo: A prática da adubação e o conhecimento das exigências nutricionais das forrageiras do gênero Pani-
cum são fatores de grande importância para o manejo de pastagens, que se reflete na maior ou menor produção
de forragem. Desta forma, objetivou-se avaliar a duração de vida das folhas (DVF) do Panicum maximum
cv. BRS Zuri sob doses de nitrogênio no solo. O experimento foi realizado em casa de vegetação no setor de
agropecuária do Instituto Federal de Educação, Ciência e Tecnologia do Pará, Campus Santarém. Utilizou-se
o delineamento experimental inteiramente casualizado, com quatro tratamentos e quatro repetições (vasos).
Os tratamentos foram constituídos por doses crescentes de nitrogênio (Ureia – 45% de N), sendo: 0, 50, 100
e 150% da recomendação mínima para a cultura (50 kg ha-1), equivalente as doses de 0, 25, 50 e 100kg ha-
1. O solo utilizado foi um latossolo amarelo, predominante na região, extraído da camada de 20 cm. Este foi
distribuído em vasos,com capacidade de 2,5 dm³, que foram saturados com água e deixados drenar por 24 h.
Após este período, anotou-se o peso dos vasos, equivalendo ao peso do solo na capacidade de campo. Assim,
as irrigações foram feitas com base na reposição (até o peso inicial) da água evapo transpirada diariamente,
utilizando balança eletrônica.Após semeadura, as plantas cresceram por 45 dias, ocasião em que foi realizado
o corte de uniformização a 25 cm de altura, simulando a altura ideal de saída por animais em pastejo, dando
início ao experimento. Após 28 dias de experimento, a variável avaliada foi a DVF. A mensuração de vida
das folhas foi realizada a cada três dias. A DVF é o intervalo médio de tempo, em dias, entre o surgimento e
a morte de uma folha.Os dados foram submetidos à análise de variância e teste de média. De acordo com os
resultados, observou-se diferença significativa (P<0,05) entre os tratamentos avaliados. A DVF foi maior no
tratamento de 150% da recomendação (equivalente a 100 kg ha-1 de N), apresentando média de 16,75 dias,
diferindo estatisticamente dos tratamentos de 0 e 50%, cujas médias foram de 13 dias. O tratamento de 150%
não diferiu estatisticamente do de 100% (média de 14,5 dias). Desta forma, notou-se que a adubação nitroge-
nada de 150% da recomendação mínima favoreceu uma maior duração de vida das folhas da cultivar avaliada.

Palavras-chave: morfogênese,forrageira,adubação

228 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

PRÁTICAS MUSICAIS PARA CRIANÇAS E ADOLESCENTES EM CONTEXTO DE ACO-


LHIMENTO INSTITUCIONAL EM SANTARÉM, PARÁ: UM RELATO DE ATIVIDADE EX-
TENSIONISTA

Antônio Vitor Ribeiro,Iani Dias Lauer Leite, Adria Miranda Silva, Iana Maria Rodrigues Cordovil, Samara
Tavares Silva e Raquel dos Santos Correa
ianilauer@gmail.com
Universidade Federal do Oeste do Pará - UFOPA1, Universidade Federal do Oeste do Pará - , UFOPA2,
Universidade do Estado do Pará - , UEPA3, UNIVERSIDADE FEDERALDO OESTE DO PARÀ - , UFO-
PA4, Universidade Federal do Oeste do Pará - , UFOPA5 e Universidade Federal do Oeste do Pará - e
UFOPA6

Resumo: A música faz parte da cultura humana e está presente em diferentes contextos de desenvolvimento. O
abrigo é considerado um contexto desenvolvimental, conforme a Bioecologia do Desenvolvimento Humano
(BRONFENBRENNER, 2011). Esse trabalho relata as atividades musicais que ocorreram em uma Casa de
Acolhimento ou abrigo, na cidade de Santarém, Pará. As atividades em questão fizeram parte do plano de tra-
balho de iniciação à extensão, desenvolvido no âmbito do projeto Musicaliza Bebê, em uma instituição federal
de ensino superior na cidade. O plano de trabalho teve como objetivos: propiciar a crianças em situação de
acolhimento uma extensão do projeto Musicaliza Bebê; inserir vivências musicais no quotidiano de crianças
moradoras de uma Casa de Acolhimento em Santarém, Pará e despertar a expressão corporal e musical dos
envolvidos. As ações realizadas ocorreram em duas fases distintas. A primeira fase ocorreu na casa de acolhi-
mento, tendo como público-alvo apenas crianças. As atividades executadas visaram a musicalização mediante
o ensino de flauta doce. A partir das vivências iniciais, duas importantes alterações foram realizadas: 1) as
atividades foram replanejadas para incorporar a participação de adolescentes em situação de institucionaliza-
ção, e 2) houve necessidade de transferir as “aulas” para a sala do projeto Musicaliza Bebê, na UFOPA, uma
vez que na casa de acolhimento não existia um espaço adequado para que as atividades fossem realizadas a
contento. Quanto às práticas musicais, nessa fase trabalhou-se com percussão corporal e uso de instrumentos
percussivos tradicionais e alternativos. Trabalhou-se com a livre expressão musical dos participantes, quan-
do ao final do encontro, eles escolhiam canções que gostariam de cantar. Foram realizadas 19 encontros no
período de agosto de 2016 a de agosto de 2017, com participação média de 8 crianças e/ou adolescentes. A
equipe técnica de execução foi composta por 4 pessoas. Um fator presente no momento dos encontros era a
variabilidade da faixa etária. E tal situação representou um desafio para o planejamento das atividades, que de-
veriam contemplar desde bebês até adolescentes. Ao longo dos encontros, percebeu-se o engajamento gradual
dos adolescentes nas atividades percussivas propostas. Em se tratando das crianças, observou-se a preferência
por atividades manuais, como desenhar e pintar. O número de encontros, a mudança do locus de execução
das atividades, a heterogeneidade da equipe, somada ao desafio da constante mudança de público, trouxeram
ganhos para a execução dos encontros, bem como para a criação de um ambiente seguro de expressão o que
foi compreendido pelos autores como o melhor resultado advindo dessa experiência.

Palavras-chave: acolhimento institucional,crianças e adolescentes institucionalizados,musicalização.

229 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

TAXA DE ALONGAMENTO FOLIAR DO PANICUM MAXIMUM CV. BRS ZURI SOB DO-
SES CRESCENTES DE NITROGÊNIO EM SOLO AMAZÔNICO

Jackson Marinho Sarmento, Carlos Mikael Mikael, Rogério Rangel Rodrigues, Luciano de Sousa Chaves,
Adriano Araújo da Silva, Mailana Almeida de Souza, Carlos Eduardo Pedroso de Sousa e Clécio Henrique
Limeira
jmarinho.sarmento@gmail.com
Instituto Federal de Educação, Ciência e Tecnologia do Pará - IFPA

Resumo: Existem diversos fatores que exercem influência sobre os padrões de resposta produtiva do gênero
Panicum nos sistemas de produção a que são inseridos. Dentre eles, a disponibilidade de nutrientes no solo,
em quantidade adequada, mostra-se como fator preponderante ao desenvolvimento adequado dessas forragei-
ras, de modo a maximizar sua eficiência produtiva. Nesse sentido, objetivou-se avaliar a taxa de alongamento
foliar (TAlF) do Panicum maximum cv. BRS Zuri sob doses crescentes de nitrogênio no solo. O experimen-
to foi realizado em casa de vegetação no setor de agropecuária do Instituto Federal de Educação, Ciência e
Tecnologia do Pará, Campus Santarém. Utilizou-se o delineamento experimental inteiramente casualizado,
com quatro tratamentos e quatro repetições (vasos). Os tratamentos foram constituídos por doses crescentes
de nitrogênio (Ureia – 45% de N), sendo: 0, 50, 100 e 150% da recomendação mínima para a cultura (50 kg
ha-1), equivalente as doses de 0, 25, 50 e 100 kg ha-1 respectivamente. O solo utilizado foi um latossolo ama-
relo, predominante na região, extraído da camada de 20 cm. Este foi distribuído em vasos, com capacidade
de 2,5 dm³, que foram saturados com água e deixados drenar por 24 h. Após este período, anotou-se o peso
dos vasos, equivalendo ao peso do solo na capacidade de campo. Assim, as irrigações foram feitas com base
na reposição (até o peso inicial) da água evapotranspirada diariamente, utilizando balança eletrônica. Após
semeadura, as plantas cresceram por 45 dias, ocasião em que foi realizado o corte de uniformização a 25 cm
de altura, simulando a altura ideal de saída por animais em pastejo, dando início ao experimento. Após 28 dias
de experimento, foi avaliada a variável a TAlF, que representa a relação quociente do número de novas folhas
pelo número de perfilhos multiplicado pela duração da avaliação em dias. Os dados foram submetidos à análi-
se de variância e teste de média. Observou-se diferença significativa (P<0,05) entre os tratamentos avaliados.
Os tratamentos de 100 e 150% da recomendação (equivalente a 50 e 100 kg ha-1 de N, respectivamente) não
diferiram estatisticamente entre si, sendo superiores aos demais, apresentando TAlF de 4,10 e 3,60 cm/per-
filho/dia. Também não houve diferença estatística entre os tratamentos de 0 e 50% (equivalentes a 0 e 25 kg
ha-1de N), apresentando média de TAlF 2,15 e 2,10 cm/perfilho/dia, respectivamente. A adubação nitrogenada
de 100 e 150% da recomendação mínima proporciona resultados positivos sobre a TAlF da cultivar avaliada.

Palavras-chave: forrageira,adubação,ureia.

230 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

SELEÇÃO DE PLANTAS MATRIZES PARA O CULTIVO IN VITRO DE ANANAS COMO-


SUS CV. IMPERIAL

Tanara Pletsch Dalla Costa, Iasmin Laís Damasceno Paranatinga e Eliandra Sia de Freitas
iasminlais@hotmail.com
Universidade Federal do Oeste do Pará - UFOPA

Resumo: O abacaxizeiro (Ananas comosus) é tradicionalmente multiplicado por propagação vegetativa que
proporciona baixa taxa de multiplicação e disseminação de doenças. Nesse sentido, a micropropagação é uma
alternativa para a obtenção de plantas de qualidade genética e fitossanitária, com produção em larga escala
com tempo e espaço reduzidos. Contudo, a resposta in vitro depende de vários fatores, dentre eles as diferen-
ças genotípicas das matrizes. Portanto, objetivou-se neste trabalho avaliar o potencial de diferentes matrizes
no estabelecimento in vitro de gemas axilares de Ananas comosus cv. Imperial. Incialmente, foram seleciona-
das plantas matrizes de abacaxizeiro da variedade Imperial, das quais foram extraídas gemas axilares. Após a
assepsia, os explantes foram cultivados in vitro com meio MS na ausência de fitormônios por 35 dias. Após
este período, avaliou-se a porcentagem de contaminação, de explantes estabelecidos e de brotações. O expe-
rimento foi conduzido em delineamento inteiramente casualizado, avaliando-se oito plantas matrizes, com 36
repetições cada. Verificou-se que as plantas matrizes 3, 4, 5 e 6 atingiram o estabelecimento máximo de ex-
plantes aos 15 dias após a introdução in vitro. Aos 35 dias, a matriz 6 (M6) promoveu os maiores percentuais
de estabelecimento e de brotações (83,33%), enquanto a matriz 1 propiciou 58,33% de explantes estabelecidos
e 38,89% de brotações. Portanto, nota-se que a M6 foi a melhor matriz de abacaxizeiro e que a seleção das
matrizes é de fundamental importância para o sucesso do cultivo in vitro.

Palavras-chave: Ananas comosus,cultura in vitro,plantas matrizes

231 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

MOBILIZAÇÃO PRECOCE, SUA INFLUÊNCIA NA FORÇA MUSCULAR E NO TEMPO DE


INTERNAÇÃO DO PACIENTE CRÍTICO EM UMA UNIDADE DE TERAPIA INTENSIVA:
REVISÃO DE LITERATURA

Liliana Pauline Cavalcante Dos Santos, Camila Chaves Lamareira, Maria Ayrtes Ximenes Pontes Colaço ,
Brena Oliveira Nascimento Diniz, Milene Ribeiro Duarte Sena, Amanda De Almeida Sena, Daniely Leal Da
Costa E Jonival Furtado Wanderley
lilianapauline@yahoo.com.br
HOSPITAL REGIONAL DO BAIXO AMAZONAS - HRBA1, HOSPITAL REGIONAL DO BAIXO AMAZO-
NAS - , HRBA2, FACULDADE INSPIRAR - , 3, HOSPITAL REGIONAL DO BAIXO AMAZONAS - , HRBA4,
Fundação esperança - , IESPES5, HOSPITAL REGIONAL DO BAIXO AMAZONAS - , HRBA6, INSTITUTO
ESPERANÇA DE ENSINO SUPERIOR - , IESPES7 e SANTA CASA DE MISERICÓRDIA DE ÓBIDOS - e
SCM8

Resumo: A mobilização precoce vem ganhando espaço importante na recuperação do paciente crítico devido
os seus benefícios sobre o imobilismo e no tempo de internação. O objetivo deste estudo é buscar na literatura
trabalhos e pesquisas que mostrem a influência da mobilização precoce na força muscular e sua correlação
com o tempo de internação dos pacientes críticos internados em unidades de terapia intensiva (UTI). Tratou-
-se de uma pesquisa de revisão de literatura, do tipo exploratória-descritiva, desenvolvida por meio da análise
bibliográfica. Foi realizada uma busca ativa por artigos nas bases de dados da Biblioteca Virtual em Saúde
(BVS), SCIELO, MEDLINE e LILACS, e o período da busca compreendeu de abril a junho de 2016. Foram
selecionados 13 artigos para o estudo.Como resultado dessa pesquisa Verificou-se que a mobilização precoce,
quando realizada, contribui para o aumento da força muscular, da capacidade funcional e reduz o tempo de
internação dos pacientes críticos, além de diminuir o gasto com medicamentos. E com isso gerando rotativi-
dade nos leitos da UTI, levando a um declínio no tempo de uso da ventilação mecânica e o desmame desses
pacientes, facilitando o retorno às suas atividades diárias e dando melhores condições de vida e sobrevida aos
pacientes.

Palavras-chave: Mobilização Precoce, Fisioterapia, Unidade de Terapia Intensiva, Cuidados Críticos.

232 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ATRASO NO DESENVOLVIMENTO MOTOR E FATORES SOCIOECONÔMICOS E NUTRI-


CIONAIS ASSOCIADOS EM CRIANÇAS QUILOMBOLAS DA REGIÃO DO BAIXO-AMA-
ZONAS

Diego Sarmento de Sousa, Silvania Yukiko Lins Takanashi , Adjanny Estela Santos de Souza , Luiz Fernando
Gouvêa e Silva, Assis Junior Cardoso Pantoja e Maiara Silvana Salgado Batista
sousads.stm@outlook.com
Universidade Norte do Paraná - UNOPAR1, Universidade do Estado do Pará - , UEPA2, Universidade do
Estado do Pará - , UEPA3, Universidade do Estado do Pará - , UEPA4, Universidade do Estado do Pará - ,
UEPA5 e Universidade do Estado do Pará - e UEPA6

Resumo: Introdução: O desenvolvimento motor é um processo de mudança contínua e sequencial do com-


portamento motor ao longo da vida do indivíduo, associado a idade cronologia e provocada pela interação do
biólogo com as condições do meio ambiente, exigindo assim a realização de tarefas motoras. Fatores adver-
sos nestas duas dimensões (biológico e ambiental) podem alterar o ritmo normal do desenvolvimento. Entre
as crianças que estão mais expostas a condições socioeconômicas precárias e a desnutrição, destacam-se as
crianças negras remanescentes de quilombos em zonas rurais, pois estão mais vulneráveis aos agravos à saúde,
apresentando dessa forma maior risco de adquirir doenças e menor oportunidade de proteção da saúde. Obje-
tivo: verificar a prevalência de atraso no desenvolvimento motor e os fatores socioeconômicos e nutricionais
associados em crianças quilombolas. Metodologia: estudo transversal realizado com 212 crianças provenien-
tes de nove comunidades quilombolas, sendo 77 crianças da região de várzea e 135 do planalto. Participaram
da pesquisa menores com idades entre 4 a 10 anos, de ambos os sexos, afrodescendentes, residentes em áreas
reconhecidas pelo Instituto Nacional de Colonização e Reforma Agrária (INCRA) como remanescentes de
antigos quilombos. O estado nutricional foi avaliado a partir de dados antropométricos (escore-Z do peso para
idade, estatura para idade e índice de massa corporal para idade), além da ocorrência de anemia. Para a clas-
sificação socioeconômica foram utilizados critérios preconizados pela Associação Brasileira de Empresas de
Pesquisa. O desenvolvimento motor foi avaliado através da Escala de Desenvolvimento Motor proposto por
Rosa Neto. Verificou-se a distribuição de probabilidade através do teste Qui-quadrado, além da análise de as-
sociação de risco através do teste risco relativo do tipo Razão de Prevalência. Usou-se o aplicativo BioEstat®
5.3, com p≤0.05 para a significância estatística e intervalo de confiança de 95%. Resultados: a prevalência
de atraso no desenvolvimento motor da amostra foi de 10,8%, sendo que as crianças da região de planalto
apresentaram taxas um pouco mais elevada (11,1%) em comparação a várzea (10,4%). No planalto, os fatores
socioeconômicos foram os que influenciaram significativamente a ocorrência de atraso no desenvolvimento
motor, sendo que na região de várzea foram os fatores nutricionais. No geral, tantos fatores socioeconômicos
quanto nutricionais associaram-se significativamente com a prevalência de atraso no desenvolvimento motor.
Conclusão: os dados nos sugerem que tanto as condições socioeconômicas, quanto nutricionais, influenciaram
negativamente no desenvolvimento motor da amostra de crianças quilombolas.

Palavras-chave: Desenvolvimento infantil,Desnutrição proteico-calórica,Fatores socioeconômicos

233 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ALTURA DO PANICUM MAXIMUM CV. BRS ZURI SOB DOSES CRESCENTES DE NITRO-
GÊNIO EM SOLO AMAZÔNICO

Carlos Eduardo Pedroso de Sousa, CARLOS MIKAEL MIKAEL, Rogério Rangel Rodrigues, Luciano de
Sousa Chaves, Adriano Araújo da Silva, Mailana Almeida de Souza, Klebson Santos Brito e Clécio Henri-
que Limeira
carloseduardopedroso38@gmail.com
Instituto Federal de Educação, Ciência e Tecnologia do Pará - IFPA

Resumo: O Panicum maximum cv. BRS Zuri é uma forrageira recentemente lançada pela Embrapa Gado de
Corte, para a qual há poucas informações sobre a resposta à adubação. A disponibilidade de nutrientes no solo,
em quantidade adequada, é fundamental para o desenvolvimento dessa cultivar, de modo a maximizar sua
eficiência produtiva. Nesse sentido, objetivou-se avaliar o desenvolvimento da altura do Panicum maximum
cv. BRS Zuri sob doses crescentes de nitrogênio no solo. O experimento foi realizado em casa de vegetação
no setor de agropecuária do Instituto Federal de Educação, Ciência e Tecnologia do Pará, Campus Santarém.
Utilizou-se o delineamento experimental inteiramente casualizado, com quatro tratamentos e quatro repeti-
ções (vasos). Os tratamentos foram constituídos por doses crescentes de nitrogênio (Ureia – 45% de N), sendo:
0, 50, 100 e 150% da recomendação mínima para a cultura (50 kg ha-1), equivalente as doses de 0, 25, 50 e
100 kg ha-1 respectivamente. O solo utilizado foi um latossolo amarelo, predominante na região, extraído da
camada de 20 cm. Este foi distribuído em vasos, com capacidade de 2,5 dm³, que foram saturados com água
e deixados drenar por 24 h. Após este período, anotou-se o peso dos vasos, equivalendo ao peso do solo na
capacidade de campo. Assim, as irrigações foram feitas com base na reposição (até o peso inicial) da água eva-
potranspirada diariamente, utilizando balança eletrônica. Após semeadura, as plantas cresceram por 45 dias,
ocasião em que foi realizado o corte de uniformização a 25 cm de altura, simulando a altura ideal de saída por
animais em pastejo, dando início ao experimento. Após 28 dias de experimento, utilizando régua milimetrada,
foi avaliada a variável de altura da planta (medida do solo até a ponta da maior folha). Os dados foram subme-
tidos à análise de variância e teste de média. De acordo com os resultados, observou-se diferença significativa
(P<0,05) entre os tratamentos avaliados. Os tratamentos de 100 e 150% da recomendação (equivalente a 50 e
100 kg ha-1 de N, respectivamente) não diferiram estatisticamente entre si, sendo superiores aos demais, apre-
sentando altura média de 102,87 e 104,73 cm por perfilho analisado. Também não houve diferença estatística
entre os tratamentos de 0 e 50% (equivalentes a 0 e 25 kg ha-1de N), apresentando média de altura de 90,37
e 91,37 cm, respectivamente. A adubação nitrogenada de 100 e 150% da recomendação mínima proporciona
resultados positivos sobre a variável de altura da cultivar avaliada.

Palavras-chave: forrageira,adubação,ureia

234 POSTER
I CONGRESSO INTERNACIONAL DE PESQUISA E CIÊNCIA DO IESPES

ISOLAMENTO, CARACTERIZAÇÃO E IDENTIFICAÇÃO DE BACTÉRIAS AMILOLÍTI-


CAS DO RIO NEGRO

Tanara Pletsch Dalla Costa, Gabriela Sousa Dourado, Rogério de Oliveira Neves, Eraldo Ferreira Lopes e
Spartaco Astolfi Filho
carloseduardopedroso38@gmail.com
Universidade Federal do Oeste do Pará - UFOPA1, Universidade Federal do Oeste do Pará - , UFOPA2,
Universidade Federal do Amazonas - , UFAM3, Universidade Federal do Amazonas - , UFAM4 e Universi-
dade Federal do Amazonas - e UFAM5

Resumo: As amilases são enzimas responsáveis por degradar o amido em moléculas menores, como a glicose.
São largamente comercializadas no mundo todo, devido a sua vasta aplicação em diferentes bioprocessos,
como na indústria alimentícia, de biocombustíveis, de detergentes, entre outras. Atualmente, os microrganis-
mos representam a maior fonte de enzimas industriais, justificando a seleção de novas amilases com potencial
biotecnológico. O Rio Negro é o maior tributário do Rio Solimões/Amazonas e sua microbiota é ainda pouco
estudada. Neste sentido, objetivou-se realizar o isolamento de bactérias amilolíticas do Rio Negro, escolhen-
do-