Escolar Documentos
Profissional Documentos
Cultura Documentos
Limeira
2021
THAMIRIS CANDREVA ROBLES
Limeira
2021
FOLHA DE APROVAÇÃO
Comissão examinadora:
Aos meus pais, pelo amor e pelos esforços imensuráveis, que sem eles, eu
não teria chegado até aqui. Espero que este trabalho represente um dos
À minha família por acreditar em mim, por me motivar e fazer de tudo para que
eu pudesse concluir este trabalho. Vocês são minha base de amor e meu refúgio nos
momentos difíceis.
Aos meus amigos, a aqueles que convivem comigo e aos que mesmo distantes
estão sempre em meus pensamentos e me ajudando de alguma forma a vivenciar meus
sonhos.
(Clarice Lispector)
RESUMO
The cutaneous wound healing is a physiological process essential for the survival of every
living organism. This process consists of three sequential and overlapping phases:
inflammation, formation of granulation tissue and remodelling of the extracellular matrix
(ECM). Alteration in any of these phases influences the tissue repair. Polyunsaturated fatty
acids from the omega-3 (ω-3) and omega-6 (ω-6) families are incorporated into cell
membranes, modulate inflammatory responses and, consequently, the healing. We recently
demonstrated that FAT-1 transgenic mice, capable of producing ω-3 fatty acids endogenously,
increased the incorporation of docosapentaenoic acid (DPA) and docosahexaenoic acid
(DHA) in the skin, obtaining a reduction of 50% in the ω-6/ω-3 ratio. In these animals, there
was an increase in inflammation in the early stages of the tissue repair process and an increase
in the wound area until the 14th day of analysis. However, at 21 days post-injury, the wounds
of both groups: FAT-1 and its wild type control (WT), were similarly closed. Thus, in the
present study, we evaluated whether these inflammatory changes modulated the last stages of
the repair process, in which a new ECM is formed. ECM is responsible for the structural and
functional reconstitution of the tissue, supporting cellular interactions, in addition to offering
biomechanical properties. FAT-1 mice showed an increase in the pro-inflammatory ratio (IL-
1β/IL-10 and TNF-α/IL-10) and in the marking of vimentin, fibronectin and elastin during the
intermediate phase (10 days post-injury), in relation to the WT group. Together, the FAT-1
mice increased the type I, III and IV collagen gene expression, as well as increased the
deposition of elastic and reticular fibers in the final phase of the healing process (21 days
post-injury), which favored to the gain of tensile strength and specific elongation capacity
(elasticity) in the repaired tissue. The increase in the production of ECM macromolecules by
FAT-1 mice, was also confirmed in fibroblasts isolated from the skin of these animals.
Fibroblasts derived from transgenic animals exhibited a higher concentration of cytoplasmic
and extracellular components, such as fibronectin deposition. These results show an anabolic
function of ω-3 fatty acids, correlated with greater deposition of ECM and improvement of
biomechanical functions in the healed tissue of FAT-1 animals.
Tabela 1. Sequência dos primers sense e anti sense dos genes avaliados............................49
Angp-1: Angiopoetina 1
B: Borda
Col: Colágeno
COX: Ciclooxigenase
CP: Corpo-de-prova
D: Derme
F: Ferida
GAGs: Glicosaminoglicanos
HP: Heparina
IL-10: Interleucina-10
IL-33: Interleucina-33
IL-6: Interleucina-6
Itg: Integrina
LOX: Lipoxigenase
MMPs: Metaloproteases
MPO: Mieloperoxidase
PC: Fosfatidilcolina
PE: Fosfatidiletanolamina
PFA: Paraformaldeído
PGs: Proteoglicanos
TE: Tris-EDTA
ω-3: Ômega-3
ω-6: Ômega-6
LISTA DE SÍMBOLOS
%: porcentagem
±: mais-menos
×: vezes
µ: micro
α: alfa
β: beta
Δ: delta
ω: ômega
SUMÁRIO
1. INTRODUÇÃO...................................................................................................................20
3. OBJETIVOS........................................................................................................................41
4. MATERIAIS E MÉTODOS..............................................................................................42
4.2. Genotipagem................................................................................................................42
5. ANÁLISE ESTATÍSTICA.................................................................................................54
6. RESULTADOS....................................................................................................................55
6.1. Camundongos FAT-1 apresentaram aumento da razão pró-inflamatória durante
a fase intermediária do processo de cicatrização............................................................55
7. DISCUSSÃO........................................................................................................................82
8. CONCLUSÃO.....................................................................................................................87
9. REFERÊNCIAS BIBLIOGRÁFICAS..............................................................................88
11. ANEXOS............................................................................................................................98
1. INTRODUÇÃO
1.1. Processo de cicatrização de feridas cutâneas
Em uma condição de lesão, a pele pode ser reparada através dos processos de
regeneração ou de cicatrização. A regeneração caracteriza-se pela substituição específica do
tecido, enquanto que a cicatrização restaura o tecido com formação de cicatriz ou fibrose [4].
Apesar destas importantes diferenças conceituais, os termos regeneração e cicatrização são
utilizados como sinônimo na literatura e no presente trabalho.
(FvW) liberado pelas plaquetas também se liga à esta matriz, fortalecendo o tampão
plaquetário. Finalmente, as vias extrínseca e intrínseca, da cascata de coagulação,
ativam o fator X, que resulta na clivagem do fibrinogênio em fibrina. A fibrina
reticulada então, se liga ao tampão plaquetário, formando o trombo que interrompe a
hemorragia no local e, fornece uma matriz provisória para o processo de cicatrização em
andamento [3] (Figura 2). Neste momento, uma variedade de citocinas e fatores de
crescimento são liberados, mediando a comunicação e a sinergia de diferentes tipos
celulares [4].
As fibras elásticas são outro elemento fibroso que compõe a MEC. Elas
consistem em microfibrilas (fibrilinas, fibulinas, glicoproteínas associadas a
microfibrilares e proteínas de ligação a TGF-β latentes) e elastina amorfa [20]. Dentre
as inúmeras funções, as microfibrilas fornecem suporte à deposição apropriada de
tropoelastina, para a posterior ação das enzimas lisil-oxidases, promovendo as reações
de “cross-linking” entre estes monômeros, formando, então, o polímero insolúvel e
amorfo de elastina. Na pele, as fibras elásticas adotam uma arquitetura característica
altamente ordenada, com microfibrilas ricas em fibrilina orientadas perpendicularmente
na derme papilar e fibras elásticas de grande diâmetro na derme reticular, compostas
principalmente de elastina [20].
28
células imunológicas que migram para o coágulo e é substituída por uma matriz à base
de colágeno, com uma proporção excessiva de colágeno tipo III (cerca de 20% a 25%)
em comparação com a pele saudável [25]. Outras proteínas, tais como: fibronectina,
tenascina-C e ácido hialurônico, também se encontram aumentadas. Durante a
subsequente fase de remodelamento a longo prazo, a rede de fibras elásticas é
restabelecida e a matriz se reorganiza para alcançar uma composição mais próxima da
MEC [23-25] (Figura 4).
Durante mais de 100 anos, a nutrição tem sido reconhecida como um fator
importante no processo de cicatrização de feridas [29]. O uso da nutrição como terapia,
fez surgir o conceito de imunonutrição. Este conceito tem conduzido à suplementação
de substâncias denominadas nutrientes imunomoduladores, que incluem: arginina,
glutamina, cisteína, nucleotídeos, ácidos graxos, fibras, zinco e vitaminas A, C, D e E,
em condições de saúde e/ou doença [30]. Estes nutrientes influenciam a resposta
inflamatória por possuírem ação direta ou indireta no sistema imunológico, via ativação
de células como linfócitos e macrófagos, produção de moléculas vasodilatadoras,
antioxidantes e hormônios, inibição da função neutrofílica e estímulo a vias
32
Após o consumo, os ácidos graxos ω-6 e ω-3 são incorporados nas membranas
celulares, onde modulam a função de proteínas de membrana, a sinalização celular e a
expressão gênica. Os ácidos graxos ω-3 competem com os ácidos graxos ω-6 para
serem incorporados e, quando os ácidos graxos ω-6 predominam nas membranas
celulares, mediadores pró-inflamatórios como tromboxanos, prostaglandinas e
leucotrienos das classes 2 e 4, são produzidos através da ação das enzimas
ciclooxigenase (COX) e da 5-lipoxigenase (LOX-5). Por outro lado, a presença de
ácidos graxos ω-3 induz a produção de prostaglandinas e leucotrienos da série 3 e 5, os
quais têm características menos inflamatórias [32-33]. Além disso, a metabolização do
EPA e DHA é capaz de atuar na resolução da inflamação, através de mediadores
especializados pró-resolução (Specialized pro-resolving mediators - SPMs),
classificados como resolvinas, protectinas e maresinas. Os SPMs têm potencial de
estimular eventos celulares importantes na resolução da inflamação, tais como: inibir a
ativação e o recrutamento de células inflamatórias e reduzir a expressão de citocinas
pró-inflamatórias nestas células [34]. Assim, o controle da inflamação pelos ácidos
graxos poli-insaturados ω-6 e ω-3, deve-se à capacidade de alterarem a permeabilidade
de membrana, à produção de eicosanoides, os quais se ligam a fatores de transcrição e, à
33
1 4 d ia s
*** 4 **
120
WT
Á r e a d a f e r id a ( % )
Á r e a d a f e r id a ( % )
F A T -1
3
***
80
** 2
40
1
*
**
0 0
0 1 3 5 12 14 WT F A T -1
d ia s
36
tiveram sua expressão modulada pelos camundongos transgênicos. Dentre estes genes,
destacam-se os que estão associados à MEC, tais como: os genes da família das
integrinas (Itg), do colágeno (Col) e do fator de crescimento epidérmico (EGF), assim
como, o membro 5a da família do sítio de integração Wingless-type MMTV (Wnt5a), a
metaloprotease de matriz-1a (MMP-1a), o inibidor de serina ou cisteína proteinase,
clade E, membro 1 (Serpine-1), o receptor do ativador de plasminogênio tipo
uroquinase (Plaur) e a angiopoetina-1 (Angpt-1) (Figura 10).
sinalização via Wnt5a modulou a expressão de integrinas, bem como, a sua fixação à
fibronectina [58].
3. OBJETIVOS
4. MATERIAIS E MÉTODOS
4.2. Genotipagem
polimerase (PCR), utilizou-se: tampão específico (2,5 µL), MgCl2 (1,5 µL), DNTP (0,5
µL), primer sense (0,5 µL) (5’ACCAACTGTGGATGCTTTCC-3’) e primer anti-sense
(0,5 µL) (5’GCATTGCTTCCCAATCCTTA-3’), Taq DNA polymerase platinum (0,1
µL) (Invitrogen, Carlsbad, CA) e água livre de RNAse (17,4 µL). Em eppendorfs de 0,1
mL, adicionou-se 23 µL do mix, mais 2 µL do DNA extraído (volume correspondente a
50 ng/µL de DNA), sendo posteriormente colocados no termociclador para a PCR
(ciclagem: 3 minutos-94ºC; 40 ciclos de 30 segundos-95ºC; 1 minuto-60ºC; 1 minutos-
72ºC; 10 minutos-72ºC; 10ºC para esfriar as amostras). Para a eletroforese, preparou-se
o gel de agarose (1,5%) com tampão TBE 1x e 2 µL de Sybr Safe DNA gel stain
(Invitrogen, Carlsbad, CA). No gel pronto, foi adicionado no primeiro poço o ladder
(100 pares de base, Invitrogen) e, em seguida, as amostras produto da PCR, previamente
diluídos com o corante 6X DNA loading dye (Thermo Fisher Scientific Baltics UAB |
V.A. Graiciuno 8, LT-02241 Vilnius, Lithuania) (10 µL de ladder ou amostra + 2 µL do
corante) (Figura 11).
A coleta do tecido cicatricial foi realizada uma única vez no animal, tendo
havido diferentes animais para cada tempo determinado de coleta. Os animais foram
sacrificados imediatamente após a remoção do tecido cicatricial.
45
Tabela 1. Sequência dos primers sense e anti sense dos genes avaliados.
Gene Sequência
Desmina ATCCAGACCTTCTCTGCTCTCAA
TGTCTTTTTGGTATGGACTTCAGAAC
Fibronectina CCGGGCCTCAATCCAAA
GGAACGGCGTCCAAGAGAT
Vimentina TGGTTGACACCCACTCAAAAAG
TCTCATTGATCACCTGTCCATCTC
Col1a1 CGTCTGGTTTGGAGAGAGCAT
GGTCAGCTGGATAGCGACATC
Col1a2 GGTGGCTATGACTTTGGTTTTGA
CTTCATAGTCCTTGGGTCTGAGTGA
Col1a3 ATGGAGCAAGACAGTCTTTGAATATC
TCAGGACCCCCAATGTCATAG
Angpt-1 GCCTGAGGATGTTTTCCCGA
GAGCTGTTGGCAGATCAGGT
Serpine-1 TGCCCCACTTCTTCAAGCTC
TGGTAGGGCAGTTCCACAAC
Hbegf CCAGTTGCTACCCTGACTGG
GAAGGGCTCACTCGATCCTG
Egfr GGCTATGTCCTCATTGCCCT
GGATGGCTAAGGCATAGGTGT
Csf2 CTGGCCCCATGTATAGCTGA
TCCTCCTCAGGACCTTAGCC
Plaur CCTGCAATGCCGCTATCCTA
TAACTCCGGTTTCCCAGCAC
Stat3 TCTGTGTGACACCAACGACC
TGTTCCCCTTTGCCTCCCTT
Itga1 CTGGGTTCTGCTTTCCTCAA
ATGACTTCCAAAGCTGGCGA
Col4a3 ACGGTGTGTTCCTTGTCTCC
CCTGAAACATCATGGGGCCT
CATCTCCTCAGGCTGTCGTC
Tgf-α TCTGCCATTGGCCTTGCTAA
Col3a1 ATGGAGCAAGACAGTCTTTGAATATC
TCAGGACCCCCAATGTCATAG
Ubc ACAGACGTACCTTCCTCACCA
CCCCATCACACCCAAGAACAA
50
B2m CCCCACTGAGACTGATACATACG
CGATCCCAGTAGACGGTCTTG
No dia seguinte, as amostras foram lavadas com água milliQ cinco vezes
por 3 minutos cada em gelo e desidratadas em concentração crescente de etanol (20%,
50%, 70%, 80%, 90% e 2x 100%). Foi realizada uma etapa adicional de etanol 100% à
temperatura ambiente por 3 minutos. Em seguida, foi iniciada a embebição em resina
Epon e etanol 1:1 à temperatura ambiente por 30 minutos sob agitação e depois 4 a 5
trocas completas (1 hora cada, sendo uma delas overnight) de resina Epon pura à
temperatura ambiente. Finalmente no outro dia, foi trocada a solução de resina Epon
pura 2x e as amostras permaneceram à 60ºC em estufa controlada, por 60-72 horas para
polimerização completa.
5. ANÁLISE ESTATÍSTICA
6. RESULTADOS
800 40000
* WT
*** 30000
pg/mg de proteína
pg/mg de proteína
FAT-1
600 20000
10000
400 2000
1500
200 *** 1000
500
0 0
CXCL-1 CXCL-2 TIMP-1 MMP-9
IL-1 IL-6 IL-10 TNF- VEGF
**
* 60
MMP-9/TIMP-1
6
TNF-/IL-10
IL-1 /IL-10
1.0
4 40
0.5
2 20
0 0.0 0
WT FAT-1 WT FAT-1 WT FAT-1
Inicialmente, o gene Ubc foi considerado como housekeeping, uma vez que
este não sofreu modulação entre os grupos WT e FAT-1 nos tempos avaliados (Figura
16A). Através de análise temporal, quando comparados aos animais WT, os
camundongos FAT-1 apresentaram expressão elevada dos genes Col1a1, Col1a2,
Col1a3, Col3a1, Col4a3, Tgf-α e de Itga-1 em 10 dias pós-lesão (Figura 16B e 16C).
Estes resultados sugerem que os animais transgênicos possuem uma deposição precoce
aumentada de colágeno e que a relação célula-componentes da MEC esteja favorecida.
57
58
59
60
A
Amostras LRT (Mpa) Alongamento específico (%)
FAT #1 (F427) 1.44 6
FAT #2 (F427) 1.31 7
FAT #1 (F455) 0.97 5.3
Tecido não cicatricial FAT #2 (F455) 1.05 4.5
(0 hora) Média FAT -1 1.2 (±0.2) 6 (±1.5)
WT #1 (W457) 0.88 8.5
WT #2 (W457) 0.89 8
WT #1 (W458) 0.81 6.5
Média WT 0.85 (±0.4) 7.5 (±1)
N ã o c ic a t r ic ia l ( 0 h o r a ) N ã o c ic a t r ic ia l ( 0 h o r a )
1 .5 40% 10
A lo n g a m e n to e s p e c ífic o
8
L R T (M P a )
1 .0
6
(% )
4
0 .5
0 .0 0
WT F A T -1 WT F A T -1
76
2 1 d ia s p ó s -le s ã o 2 1 d ia s p ó s -le s ã o
2 .0 * 30% 40
* 20%
A lo n g a m e n to e s p e c ífic o
WT
F A T -1
1 .5 30
L R T (M P a )
60%
(% )
**
1 .0 20
0 .5 10
0 .0 0
B o rd a F e r id a B o rd a F e r id a
77
C
40
2 .0 *
A lo n g a m e n to e s p e c ífic o
* WT
30 F A T -1
1 .5
L R T (M P a )
(% )
1 .0 20
0 .5 10
0 .0 0
0 h o ra 2 1 d ia s 0 h o ra 2 1 d ia s
7. DISCUSSÃO
a mesma deveria exibir um perfil resolutivo, para que a fase subsequente de proliferação
e de formação da MEC tivesse início.
Estudos mais específicos, demonstraram que o ácido graxo ω-3 EPA foi
capaz de melhorar a elasticidade da pele [81]. O uso tópico de EPA em pele humana,
reduziu o espessamento dérmico e a produção de MMPs (MMP-1 e MMP-9) em
fibroblastos dérmicos, através da inibição da via de sinalização JNK (c-Jun N-terminal
quinase). Adicionalmente, o EPA reduziu COX-2 e apresentou aumento de colágeno e
de fibras elásticas como a tropoelastina e a fibrilina-1, mediante aumento do TGF-β
[81]. Paralelamente, outro grupo de pesquisa demonstrou que o tecido adiposo presente
abaixo da derme, libera ácidos graxos livres que modulam a função de fibroblastos
dérmicos e propriedades biomecânicas da pele [82]. Verificou-se que adipócitos
maiores (presentes em condição de obesidade) liberam ácido palmítico, o qual estimula
a produção da MMP-13 e reduz a proliferação de fibroblastos, bem como a produção de
86
8. CONCLUSÃO
9. REFERÊNCIAS BIBLIOGRÁFICAS
1. Pereira RF e Bártolo PJ. Traditional Therapies for Skin Wound Healing. Advances
in Wound Care (New Rochelle), 2016; 5(5): 208–229.
4. Krafts KP. Tissue repair: the hidden drama. Organogenesis, 2010; 6(4): 225-233.
5. Pyter LM.; et al. Tumors Alter Inflammation and Impair Dermal Wound Healing
in Female Mice. PloS One, 2016; 11(8): e0161537.
8. Eming SA.; Krieg T e Davidson JM. Inflammation in wound repair: molecular and
cellular mechanisms. The Journal of investigative dermatology, 2007; 127(3): 514-525.
9. Serhan CN.; Chiang N e Dalli J. The resolution code of acute inflammation: Novel
proresolving lipid mediators in resolution. Seminars in Immunology, 2015; 27(3): 200-
215.
11. Demidova-Rice TN.; Hamblin MR e Herman IM. Acute and Impaired Wound
Healing: Pathophysiology and Current Methods for Drug Delivery, Part 1: Normal
and Chronic Wounds: Biology, Causes, and Approaches to Care. Advances in Skin
and Wound Care, 2012; 25(7): 304–314.
12. Wilgus T.A. Alerting the body to tissue injury: The role of alarmins and DAMPs
in cutaneous wound healing. Current pathobiology reports, 2018; 6(1): 55–60.
89
14. Silva JR.; et al. Wound Healing and Omega-6 Fatty Acids: From Inflammation to
Repair. Mediators of Inflammation, 2018; 2503950.
15. Barrientos S.; et al. Growth factor and cytokines in wound healing. Wound Repair
and Regeneration, 2008; 16(5): 585-601.
16. Gonzalez ACO.; et al. Wound healing – a literature review. Anais Brasileiros de
Dermatologia. 2016; 91(5): 614-20.
18. Larouche J.; et al. Immune Regulation of Skin Wound Healing: Mechanisms and
Novel Therapeutic Targets. Advances in Wound Care (New Rochelle), 2018; 7(7):
209–231.
20. Shin JW.; et al. Molecular Mechanisms of Dermal Aging and Antiaging
Approaches. International journal of molecular sciences, 2019; 20(9): 2126.
21. Gosline J.; et al. Elastic proteins: biological roles and mechanical properties.
Philosophical transactions of the Royal Society of London. Series B, Biological
sciences, 2002; 357(1418): 121–132.
22. Tracy LE.; Minasian RA e Caterson EJ. Extracellular Matrix and Dermal
Fibroblast Function in the Healing Wound. Advances in wound care, 2016; 5(3): 119–
136.
26. Larouche J.; et al. Immune Regulation of Skin Wound Healing: Mechanisms and
Novel Therapeutic Targets. Advances in Wound Care (New Rochelle), 2018; 7(7):
209–231.
27. Hinz B. Formation and Function of the Myofibroblast during Tissue Repair.
Journal of Investigative Dermatology, 2007; 127: 526–537.
28. Krzyszczyk P.; et al. The Role of Macrophages in Acute and Chronic Wound
Healing and Interventions to Promote Pro-wound Healing Phenotypes. Frontiers in
Physiology, 2018; 9: 419.
29. Guo S e DiPietro LA. Factors Affecting Wound Healing. Journal of Dental
Research, 2010; 89(3): 219–229.
33. Borges, MC.; et al. Polyunsaturated omega-3 fatty acids and systemic lupus
erythematosus: what do we know?. Revista brasileira de reumatologia, 2014; 5 4(6):
459–466.
34. Serhan CN.; et al. Protectins and maresins: New pro-resolving families of
mediators in acute inflammation and resolution bioactive metabolome. Biochimica et
biophysica acta, 2015; 1851(4): 397–413.
35. Rodrigues HG.; et al. Oral administration of oleic or linoleic acid accelerates the
inflammatory phase of wound healing. The Journal of Investigative Dermatology,
2012; 132(1): 208-15.
36. Rodrigues HG.; et al. Oral Administration of Linoleic Acid Induces New Vessel
Formation and Improves Skin Wound Healing in Diabetic Rats. Plos One, 2016;
11(10): e0165115.
37. Burger B.; et al. Oral administration of EPA-rich oil impairs collagen
reorganization due to elevated production of IL-10 during skin wound healing in
mice. Scientific Reports, 2019; 9: 9119.
91
38. McDaniel JC.; et al. ω-3 fatty acids effect on wound healing. Wound Repair and
Regeneration, 2008; 16(3): 337–345.
39. Arantes EL.; et al. Topical Docosahexaenoic Acid (DHA) Accelerates Skin Wound
Healing in Rats and Activates GPR120. Biological Research for Nursing, 2016; vol 18.
40. McDaniel JC.; Massey K e Nicolaou A. Fish oil supplementation alters levels of
lipid mediators of inflammation in microenvironment of acute human wounds.
Wound repair and regeneration, 2011.
41. Kang JX.; et al. Fat-1 transgenic mice convert n-6 to n-3 fatty acids. Nature, 2004;
vol 427: 504.
42. Kang JX. Fat-1 transgenic mice: A new model for omega-3 research.
Prostaglandins, Leukotrienes and Essential Fatty Acids, 2007; 77: 263–267.
43. Margaret JR.; et al. Transgenic Increase in N-3/N-6 Fatty Acid Ratio Reduces
Maternal Obesity-Associated Inflammation and Limits Adverse Developmental
Programming in Mice. Plos One, 2013; 8(6): e67791.
44. Shaonin J.; et al. Transgenic Expression of n-3 Fatty Acid Desaturase (fat-1) in
C57/BL6 Mice: Effects on Glucose Homeostasis and Body Weight. Journal of Cellular
Biochemistry, 2009; 107(4): 809–817.
45. Delpech JC.; et al. Transgenic Increase in n-3/n-6 Fatty Acid Ratio Protects
Against Cognitive Deficits Induced by an Immune Challenge through Decrease of
Neuroinflammation. Neuropsychopharmacology, 2015; 40(3): 525–536.
46. Kathryn E.; et al. Brain omega-3 polyunsaturated fatty acids modulate microglia
cell number and morphology in response to intracerebroventricular amyloid-β 1-40 in
mice. Journal of Neuroinflammation, 2016; 13: 257.
47. Bellenger J.; et al. High Pancreatic n-3 Fatty Acids Prevent STZ-Induced Diabetes
in Fat-1 Mice: Inflammatory Pathway Inhibition. Diabetes, 2011; 60(4): 1090–1099.
48. Mohammed A.; et al. Endogenous n-3 Polyunsaturated Fatty Acids Delay
Progression of Pancreatic Ductal Adenocarcinoma in Fat-1-p48Cre/+-LSL-
KrasG12D/+ Mice. Neoplasia, 2012; 14(12): 1249–1259.
49. Hwang WM.; et al. Omega-3 Polyunsaturated Fatty Acids May Attenuate
Streptozotocin-Induced Pancreatic β-Cell Death via Autophagy Activation in Fat1
Transgenic Mice. Endocrinology and Metabolism (Seoul), 2015; 30(4): 569–575.
92
50. Kang X.; et al. Inhibition of the HER2 pathway by n-3 polyunsaturated fatty acids
prevents breast cancer in fat-1transgenic mice. The Journal of Lipid Research, 2013;
54(12): 3453–3463.
51. Weylandt KH.; et al. Suppressed liver tumorigenesis in fat-1 mice with elevated
omega-3 fatty acids is associated with increased omega-3 derived lipid mediators and
reduced TNFα. Carcinogenesis, 2011; 32(6): 897–903.
53. Monk JM.; et al. Th17 Cell Accumulation Is Decreased during Chronic
Experimental Colitis by (n-3) PUFA in Fat-1 Mice. The Journal of Nutrition, 2012;
142(1): 117–124.
54. Cai A.; et al. Metabolic enrichment of omega-3 polyunsaturated fatty acids does
not reduce the onset of idiopathic knee osteoarthritis in mice. Osteoarthritis Cartilage,
2014; 22(9): 1301–1309.
55. Yanli Li.; et al. Endogenous n-3 Polyunsaturated Fatty Acids Attenuate T
CellMediated Hepatitis via Autophagy Activation. Frontiers in Immunology, 2016; 7:
350.
56. Candreva T.; et al. Docosahexaenoic acid slows inflammation resolution and
impairs the quality of healed skin tissue. Clinical Science, 2019; 133: 2345–2360.
57. Vecina E.; et al. Influence of Extracellular Matrix Components on the Expression
of Integrins and Regeneration of Adult Retinal Ganglion Cells. Plos One, 2015; 10(5):
e0125250.
60. Zhao X.; et al. Metabolic regulation of dermal fibroblasts contributes to skin
extracellular matrix homeostasis and fibrosis. Nature Metabolism, 2019; 1(1): 147-
157.
93
63. Bradford MM. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Analytical
Biochemistry, 1976; 72: 248-54.
64. Velez AMA.; Zapata YAU e Howard MS. Periodic Acid-Schiff Staining Parallels
the Immunoreactivity Seen by Direct Immunofluorescence in Autoimmune Skin
Diseases. North American journal of medical sciences, 2016; 8(3): 151–155.
65. Calder PC. Functional roles of fatty acids and their effects on human health.
JPEN. Jo8urnal of Parenteral and Enteral Nutrition, 2015; 39(1 Suppl): 18S-32S.
66. Zeng Z.; et al. Omega-3 Polyunsaturated Fatty Acids Attenuate Fibroblast
Activation and Kidney Fibrosis Involving MTORC2 Signaling Suppression. Scientific
Reports, 2017; 7: 46861.
68. Xu F.; Zhang C e Graves DT. Abnormal Cell Responses and Role of TNF-a in
Impaired Diabetic Wound Healing. Biomed Research International, 2013; 2013:
754802.
69. Zhuang W.; et al. Omega-3 Polyunsaturated Fatty Acids Reduce Vascular
Endothelial Growth Factor Production and Suppress Endothelial Wound Repair.
Journal of cardiovascular translational research, 2013; 6(2): 287-93.
70. Ishak WMW.; et al. Topical application of omega-3-, omega-6-, and omega-9-rich
oil emulsions for cutaneous wound healing in rats. Drug Delivery and Translational
Research, 2019; 9: 418–433.
94
71. Mado K.; et al. On the Role of Tubulin, Plectin, Desmin, and Vimentin in the
Regulation of Mitochondrial Energy Fluxes in Muscle Cells. American journal of
physiology. Cell physiology, 2019; 316(5): C657-C667.
72. Boss GR e Seegmiller JE. Age-Related Physiological Changes and Their Clinical
Significance. The Western journal of medicine, 1981; 135(6): 434–440.
74. Mecham RP.; et al. Elastin synthesis by ligamentum nuchae fibroblasts: effects of
culture conditions and extracellular matrix on elastin production. Journal of Cell
Biology, 1981; 90(2): 332-8.
75. Rosenbloom J.; Abrams WR e Mecham R. Extracellular matrix 4: the elastic fiber.
FASEB Journal, 1993; 7(13): 1208-18.
77. Ross R e Bornstein P. The elastic fiber. I. The separation and partial
characterization of its macromolecular components. The Journal of cell biology, 1969;
40(2): 366-81.
78. Raghunath M.; et al. Fibrillin and elastin expression in skin regenerating from
cultured keratinocyte autografts: morphogenesis of microfibrils begins at the dermo-
epidermal junction and precedes elastic fiber formation. The Journal of investigative
dermatology, 1996; 106(5): 1090-5.
79. Segger D.; Matthies A e Saldeen T. Supplementation with Eskimo Skin Care
improves skin elasticity in women. A pilot study. The Journal of dermatological
treatment, 2008; 19(5): 279-83.
80. Albina JE.; Gladden P e Walsh WR. Detrimental effects of an omega-3 fatty acid-
enriched diet on wound healing. JPEN. Journal of parenteral and enteral nutrition,
1993; 17(6): 519-21.
95
11. ANEXOS