Você está na página 1de 8

O que caiu no vestibular ??

Genética- prof.ª Carol


JUNHO de 2010- 2º E.M

1. (FUVEST 2010) Há uma impressionante continuidade entre os seres vivos (...). Talvez o exemplo mais
marcante seja o da conservação do código genético (...) em praticamente todos os seres vivos. Um
código genético de tal maneira “universal” é evidência de que todos os seres vivos são aparentados e
herdaram os mecanismos de leitura do RNA de um ancestral comum
Morgante & Meyer, Darwin e a Biologia, O Biólogo 10:12–20, 2009.
O termo “código genético” refere-se
a) ao conjunto de trincas de bases nitrogenadas, cada trinca correspondendo a um determinado
aminoácido.
b) ao conjunto de todos os genes dos cromossomos de uma célula, capazes de sintetizar diferentes
proteínas.
c) ao conjunto de proteínas sintetizadas a partir de uma sequência específica de RNA.
d) a todo o genoma de um organismo, formado pelo DNA de suas células somáticas e reprodutivas.
e) à síntese de RNA a partir de uma das cadeias do DNA, que serve de modelo.

2. (Unicamp 2010) Em famílias constituídas a partir da união de primos em primeiro grau, é mais alta a
ocorrência de distúrbios genéticos, em comparação com famílias formadas por casais que não têm
consanguinidade.

a) A que se deve essa maior ocorrência de distúrbios genéticos em uniões consanguíneas?

b) A fenilcetonúria (FCU) é um distúrbio genético que se deve a uma mutação no gene que expressa a
enzima responsável pelo metabolismo do aminoácido fenilalanina. Na ausência da enzima, a fenilalanina
se acumula no organismo e pode afetar o desenvolvimento neurológico da criança. Esse distúrbio é
facilmente detectado no recém-nascido pelo exame do pezinho. No caso de ser constatada a doença, a
alimentação dessa criança deve ser controlada. Que tipos de alimento devem ser evitados: os ricos em
carboidratos, lipídeos ou proteínas?
Justifique.

3. (Unicamp 2010) Nos cães labradores, apenas dois genes autossômicos condicionam as cores preta,
chocolate e dourada da pelagem. A produção do pigmento da cor preta é determinada pelo alelo
dominante B e a do pigmento chocolate, pelo alelo recessivo b. O gene E também in ter fere na cor do
animal, já que controla a deposição de pigmento na pelagem. A cor dourada é determinada pelo
genótipo ee. Uma fêmea dourada cruzou com um macho chocolate e teve filhotes com pelagem preta e
filhotes com pelagem chocolate, na mesma proporção. Quando essa mesma fêmea dourada cruzou com
um macho preto, nasceram oito filhotes sendo um chocolate, três pretos e quatro dourados.

a) Qual o genótipo da fêmea mãe? Identifique e expli que o tipo de interação gênica observa da entre os
genes envolvidos.

b) Quais são os genótipos do cão preto (pai) e do seu filho te chocolate? Mostrar como chegou
à resposta.
4. (UNESP 2010) Um estudante de biologia tem em seu quintal um lindo pé de malva-rosa (Hibiscus
mutabilis), planta cujas flores apresentam
pétalas que são brancas pela manhã, quando a flor se abre, e vão se tornando de um cor-de-rosa
intenso conforme o dia vai passando. Em um mesmo pé de malva-rosa, pode-se apreciar flores com
cores de diferentes tons: desde as totalmente brancas, que acabaram de se abrir, até as totalmente
rosas, abertas há várias horas.
O estudante tem uma hipótese para explicar o fenômeno: ao longo do dia a radiação solar induz
mutações genéticas nas células das pétalas, que as levam à alteração da cor; se flores já totalmente cor-
de-rosa forem polinizadas com pólen de flores da mesma cor, ou seja, se a polinização ocorrer depois da
ocorrência das mutações, as sementes resultantes darão origem a plantas que produzirão apenas flores
cor-de-rosa.
A explicação do estudante para a mudança da cor da pétala de malva-rosa e sua explicação para a
transmissão hereditária dessa característica estão corretas? Justifique.

5. (UNIFESP 2010) No ano de 2009, o mundo foi alvo da pandemia provocada pelo vírus influenza A
(H1N1), causando perdas econômicas, sociais e de vidas. O referido vírus possui, além de seus
receptores protéicos, uma bicamada lipídica e um genoma constituído de 8 genes de RNA.
Considerando:
1. a sequência inicial de RNA mensageiro referente a um dos genes deste vírus:

5’ AAAUGCGUUACGAAUGGUAUGCCUACUGAAU 3’

2. a tabela com os códons representativos do código genético universal:

respo
nda:

a) Qual será a sequência de aminoácidos que resultará da tradução da sequência inicial de RNA
mensageiro, referente a um dos genes deste vírus indicada em 1?

b) Considerando os mecanismos de replicação do genoma viral, qual a principal diferença entre o vírus
da gripe e o vírus que causa a AIDS?

6. (UFSCAR 2010) Considere que as abelhas da espécie Partamona helleri possuem 34 cromossomos,
sendo que as fêmeas originam-se por reprodução sexuada e os machos, por partenogênese. É esperado
que fêmeas e machos tenham nos núcleos de suas células somáticas, respectivamente,
a) 34 e 17 cromossomos.
b) 68 e 34 cromossomos.
c) 17 e 34 cromossomos.
d) 34 e 68 cromossomos.
e) 51 e 17 cromossomos.
7. (PUC- SP 2010) Leia o texto com atenção:
Alternativa para daltonismo
Macacos daltônicos passaram a enxergar cores após terem sido submetidos a um tratamento baseado
em terapia genética. A novidade, descrita na edição desta quinta-feira (17/9) da revista Nature,
demonstra o potencial da terapia para o tratamento de problemas de visão em
humanos. Os pesquisadores introduziram genes para fotopigmentação presentes em algumas
fêmeas em células fotorreceptoras nas retinas de dois machos adultos. A introdução se deu por meio de
vírus inofensivos. Os genes produziram proteínas chamadas opsinas, que atuam para a produção, na
retina, de pigmentos sensíveis ao vermelho e ao verde.
Cinco semanas após o tratamento, testes físicos e comportamentais comprovaram que os animais
passaram a distinguir entre as cores verde e vermelho, o que não conseguiam fazer antes da terapia
genética.
(Extraído da Agência de Noticias da FAPESP, 17/09/2009)

Considerando as informações contidas no texto e supondo que esse tipo de daltonismo encontrado nos
macacos seja determinado geneticamente da mesma forma que na espécie humana, um estudante do
Ensino Médio fez cinco afirmações. Assinale a única ERRADA.

a) As fêmeas doadoras de genes produziam normalmente opsinas.


b) As sequências de nucleotídeos introduzidas nas retinas dos dois machos controlaram, no interior das
células fotorreceptoras, os processos de transcrição e tradução gênica.
c) Após o tratamento, os macacos receptores passaram a expressar gene dominante localizado no
cromossomo X.
d) Originalmente, os macacos receptores apresentavam gene recessivo localizado no cromosomo X.
e) Os vírus utilizados como vetores no experimento foram responsáveis pela transferência de RNA
mensageiro de fêmeas para machos.

8- (UERJ-2010) Em uma pesquisa, cientistas extraíram amostras de DNA de três espécies diferentes e
determinaram suas relações (G=T) / (A=T), apresentadas na tabela abaixo.

Em seguida, aqueceram-se as amostras e mediu-se a


temperatura de desnaturação de cada uma delas. Sabe-se
que, na temperatura de desnaturação, todas as pontes de
hidrogênio entre as bases nitrogenadas estão rompidas.
Identifique a amostra com maior temperatura de
desnaturação. Justifique sua resposta.

9- (FATEC-2010) Observe o heredograma a seguir que representa indivíduos albinos (afetados) e com
pigmentação normal (normais).

Hélio e Maria vão se casar.


A chance de que o casal tenha uma filha albina, considerando que Maria é filha de pais heterozigotos, é
a) zero. b) 1/12 c) 1/8 d) 1/6 e) ¼
10- (UEL-2010) A alcaptonúria e uma doença hereditária que afeta o metabolismo dos aminoácidos
fenilalanina e tirosina. Ela e causada por uma mutação no gene HGD, que codifica a enzima
homogentisato- 1,2-dioxigenase. A diminuição da atividade dessa enzima, que se expressa
principalmente no fígado e nos rins, e acompanhada pelo acumulo do acido homogentísico em diversos
tecidos, bem como a sua eliminação na urina. Esta substancia e oxidada quando em contato com o ar ou
com o oxigênio dissolvido nos tecidos, formando um pigmento de coloração marrom-avermelhada,
chamado de alcaptona. O acúmulo desse acido nos tecidos leva ao desenvolvimento de artrite
progressiva. O heredograma a seguir indica que
os indivíduos I-4 e III-2 apresentam essa doença.

Diante de tais informações, e correto afirmar:


a) O individuo II-3 tem 50% de probabilidade de ser
portador do alelo causador da alcaptonúria.

b) E esperado que esse distúrbio afete uma proporção


maior de homens do que de mulheres na população.

c) O individuo III-2 irá passar o alelo causador dessa


doença apenas para suas filhas e jamais para seus
filhos.

d) A probabilidade de que o sexto descendente do


casal II-2 e II-3 seja normal e homozigoto e de 75%.
e) O individuo III-4 tem 2/3 de probabilidade de ser portador do alelo causador da alcaptonúria.

11- (UFRJ- 2010) As variações na cor e na forma do fruto de uma espécie diploide de planta estão
relacionadas às variações nas sequências do DNA em duas regiões específicas, vc e vf.
Duas plantas dessa espécie, uma delas apresentando frutos vermelhos e redondos (Planta A), outra
apresentando frutos brancos e ovais (Planta B), tiveram essas regiões cromossômicas sequenciadas. As
relações observadas entre o fenótipo da cor e da forma do fruto e as sequências de pares de
nucleotídeos nas regiões vc e vf nessas duas plantas estão mostradas nos quadros a seguir:

Identifique as sequências de pares de nucleotídeos das regiões cromossômicas vc e vf de uma terceira


planta resultante do cruzamento entre a Planta A e a Planta B. Justifique sua resposta.

12- (UFSC 2010) Seu José da Silva, um pequeno criador de porcos do Oeste do Estado de Santa Catarina,
desejando melhorar a qualidade de sua criação, comprou um porco de raça diferente daquela que ele
criava. Preocupado com as consequências de criar este animal junto com os outros porcos, ele discute
com seu um vizinho sobre o assunto.

Parte de seu diálogo é transcrito abaixo:

Sr. José – O porco que comprei e apelidei de Napoleão é maior, mais forte e possui peso acima da média
da raça que crio. Além disso, possui manchas marrons pelo corpo todo. Gostaria que boa parte de
minha criação tivesse estas características.
Vizinho – Seu José, isto vai ser muito difícil de conseguir; melhor o senhor comprar outros porcos com
esse “jeitão”.

Com base nos conhecimentos de genética, assinale a(s) proposição(ões) correta(s) sobre o assunto.

1) ( ) As preocupações do Sr. José não se justificam, pois animais com fenótipos distintos
apresentam, obrigatoriamente, genótipos distintos para as mesmas características.
2) ( ) O vizinho do Sr. José tem razão, pois não se pode obter mistura de características cruzando
animais de raças diferentes na mesma espécie.
4) ( ) Atualmente não se pode criar e cruzar porcos de raças diferentes, pois é impossível controlar a
seleção das características geneticamente desejadas.
8) ( ) Quando duas raças distintas entram em contato e seus membros passam a cruzar-se livremente,
as diferenças raciais tendem a desaparecer nos descendentes devido à mistura de genes.
16) ( ) As manchas na pele do porco Napoleão são uma característica determinada geneticamente; já o
peso e o tamanho resultam somente da oferta de boa alimentação.
32) ( ) O melhoramento genético em animais que apresentam características de valor comercial é
necessariamente prejudicial ao ser humano, já que não ocorre naturalmente.
64) ( ) Muitas características animais, como a fertilidade, a produção de carne e a resistência a doenças,
são condicionadas por genes e dependem muito das condições nas quais os animais são criados.

13-(UFF 2010) O heredograma abaixo mostra a ocorrência de uma determinada anomalia em uma
família.

A condição demonstrada no heredograma é herdada como característica:

a) dominante autossômica.
b) recessiva autossômica.
c) recessiva ligada ao cromossomo Y.
d) recessiva ligada ao cromossomo X.
e) dominante ligada ao cromossomo X.

14- (UFPR 2009 Num estudo sobre uma família, representada no heredograma abaixo, constatou-se que
Antonio é afetado por uma anomalia causada pelo alelo recessivo de um gene ligado à porção ímpar do
cromossomo X.
Considerando essa informação, é correto afirmar que são, com certeza, portadores(as) do alelo em
questão:

a) Elisa e Nancy.
b) Adélia e Cláudia.
c) Nancy e Maria.
d) Rogério e Fernando.
e) Elisa e Maria.

15-(VUNESP 2009) A Doença de Huntington ocorre em um par de genes alelos presentes no


cromossomo n.º 4. Esse par de alelos promove uma progressiva degeneração do Sistema Nervoso
Central provocando problemas motores e mentais. Não possui cura, manifesta-se após os 40 anos de
idade. O heredograma representa uma família que apresenta a doença.

Analisando o heredograma, pode-se concluir que se trata de uma herança genética:

a) ligada ao sexo.
b) autossômica recessiva.
c) restrita ao sexo.
d) codominante.
e) autossômica dominante.

16- (VUNESP 2009) Nos cães da raça labrador, a determinação das cores chocolate, preta e dourada é
determinada pela interação de dois pares de genes, no qual o alelo B determina a produção de
pigmento preto e seu alelo recessivo, o pigmento marrom. O alelo E condiciona a produção de
pigmentos nos pelos, já o seu alelo recessivo não condiciona essa deposição, atua como epistático sobre
B e b, determinando a cor dourada. Do cruzamento entre um macho e uma fêmea, ambos pretos e
duplo heterozigotos, espera-se uma prole na proporção de:

a) 9: 3: 3:1. b) 9: 4: 3. c) 12: 3: 1. d) 9: 7. e) 15: 1.

17- (UFRGS 2010) Imagine que, num canil, existem cães amarelos e cães brancos, todos da mesma raça.
Com relação ao comportamento, alguns destes cães são ferozes e outros são dóceis, independente da
cor. Suponhamos que a genética destes cães seja conhecida e que o amarelo seja determinado por um
gene dominante ligado ao cromossomo X, enquanto que o branco é determinado pelo seu alelo
recessivo. O comportamento dócil é determinado por um gene autossômico dominante e o feroz por
seu alelo recessivo. Digamos que você receba a encomenda de um filhote macho branco e dócil. Se você
tiver o cruzamento entre uma fêmea branca feroz com um macho amarelo e dócil, heterozigoto, a
probabilidade de nascer um cão com o fenótipo encomendado será de:
a) 75% b) 50% c) 25% d) 0% e) 100%
(PUC RS 2010 ) INSTRUÇÃO: Para responder à questão 18, considere as quatro premissas a seguir.
- Genes transmitidos por cromossomos diferentes.
- Genes com expressão fenotípica independente.
- Modo de herança com dominância.
- Padrão de bialelismo.

18- Um cruzamento diíbrido entre dois indivíduos duplo heterozigotos teria como resultado a proporção
fenotípica de
a) 1:2:1.
b) 1:2:2:1.
c) 1:3:3:1.
d) 3:9:3.
e) 9:3:3:1.

19-(PUC RS 2010) Qual das seguintes alternativas descreve a formação de um zigoto?


a) Fusão de núcleos haplóides de duas células compatíveis (cariogamia).
b) Promoção da replicação do DNA e mitose.
c) Sucessão de divisões celulares que forma uma massa sólida de células.
d) Divisão da célula com 46 cromossomos para a formação de células com 23 cromossomos cada.
e) Promoção da transcrição do DNA e meiose.

20- (UFABC 2010) O daltonismo tem herança recessiva ligada ao cromossomo X. Observe o
heredograma em que os indivíduos afetados estão representados pelas figuras preenchidas.

a) Indique, pelo número, quais pessoas podem ter seus


genótipos identificados com certeza?

b) Se a mulher 6 se casar com um homem daltônico, qual


a probabilidade de gerar uma criança daltônica? Se essa
criança for do sexo masculino, qual a probabilidade de
que seja daltônico?

21- (FATEC 2010) O esquema a seguir mostra o processo de síntese de proteínas em uma célula.

adaptado de http://www.geocities.com/ctv11ano/imsinpro.jpg . Acessado em 20.09.2009)


Os processos A e B e as estruturas numeradas de 1 a 5 são, respectivamente:
22-(UFC 2010) A Agência Nacional de Vigilância Sanitária (ANVISA) proibiu a venda e a utilização de
equipamentos para bronzeamento artificial no Brasil. A Sociedade Brasileira de Dermatologia solicitava
a proibição, alertando sobre o risco de câncer de pele. Responda os itens a seguir, relacionados ao tema.

a) Que células produzem o bronzeamento quando estimuladas pela radiação ultravioleta tipo A (UVA),
emitida pelo equipamento? A que tecido pertencem essas células?

Células:
Tecido:

b) A radiação UVA, absorvida pela timina no DNA, pode causar a formação de ligações covalentes entre
bases de nucleotídeos adjacentes. Por que essas ligações covalentes podem induzir mutações?
c) Existem nas células mecanismos moleculares de reparo do DNA. Porém esses mecanismos nem
sempre funcionam em células somáticas que se dividem com elevada frequência. No tecido em questão,
que células apresentam essa característica?

d) As células somáticas que sofreram mutação podem tornar-se malignas (cancerosas). Elas perdem o
controle sobre a divisão celular e passam a expressar o gene da telomerase. Qual a consequência da
ativação dessa enzima na reprodução dessas células?