Você está na página 1de 42

FACULDADE DE CINCIAS DA UNIVERSIDADE DO PORTO INSTITUTO DE CINCIAS BIOMDICAS ABEL SALAZAR UNIVERSIDADE DO PORTO

Relatrios das aulas prticas de Biologia Molecular


Licenciatura em Bioqumica
CATARINA CRUZ VAZ E PATRCIA FERREIRA DE CASTRO GRUPO 5 TURMA P3
Ano lectivo 2012/2013 2 semestre

Biologia Molecular

Relatrios das aulas prticas

NDICE
Extraco do DNA genmico da Drosophila melanogaster ........................................................................ 3 Introduo ................................................................................................................................................ 3 Resultados obtidos ................................................................................................................................... 4 Discusso dos resultados e concluso ...................................................................................................... 6 Extraco do DNA plasmdico de Escherichia coli ....................................................................................... 8 Introduo ................................................................................................................................................ 8 Resultados experimentais ........................................................................................................................ 9 Discusso dos resultados e concluso .................................................................................................... 10 Anlise electrofortica de DNA digerido com enzimas de restrio ........................................................ 11 Introduo .............................................................................................................................................. 11 Resultados obtidos ................................................................................................................................. 12 Discusso dos resultados e concluso ...................................................................................................... 1 Bibliografia................................................................................................................................................ 1 Elaborao de um mapa de restrio de um plasmdeo recombinante .................................................... 2 Introduo ................................................................................................................................................ 2 Resultados experimentais ........................................................................................................................ 4 Discusso de resultados e concluso ....................................................................................................... 7 Polymerase Chain Reaction (PCR) ............................................................................................................... 8 Introduo ................................................................................................................................................ 8 Resultados experimentais ........................................................................................................................ 9 Discusso de resultados e concluso ..................................................................................................... 12 Transformao de Escherichia Coli com DNA plasmdico ......................................................................... 14 Introduo .............................................................................................................................................. 14 Resultados obtidos ................................................................................................................................. 16 Discusso dos resultados e concluso .................................................................................................... 17 Sequenciao de DNA ................................................................................................................................ 20 Introduo e Objectivo ........................................................................................................................... 20 Tratamento de dados e Resultados ........................................................................................................ 22 Discusso de resultados e Concluses ................................................................................................... 24 Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013 Pgina 1 de 41

Biologia Molecular

Relatrios das aulas prticas

Clonagem de cDNA -TUB.......................................................................................................................... 26 Introduo .............................................................................................................................................. 26 Procedimento adoptado......................................................................................................................... 27 Resultados experimentais ...................................................................................................................... 28 Discusso de resultados e concluso ..................................................................................................... 28

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 2 de 41

Biologia Molecular

Relatrios das aulas prticas

E XTRACO DO DNA GENMICO DA D ROSOPHILA


MELANOGASTER
RELATRIO DA AULA PRTICA N1
CATARINA CRUZ VAZ E PATRCIA FERREIRA DE CASTRO GRUPO 5, TURMA P3 Data de realizao: 15 de Maro de 2013

I NTRODUO
O objectivo deste trabalho consiste em extrair e isolar o DNA genmico da Drosophila melanogaster, para posteriormente determinar a sua concentrao e grau de pureza por mtodos

espectrofotomtricos, e ainda verificar qual seria a consequncia da aco de alguns tratamentos fsicos sobre a integridade do DNA. Para conseguirmos fazer a extraco do DNA, foi necessria a libertao de todo o material celular por utilizao de um tampo de lise celular e posterior purificao do DNA. Este ltimo processo baseia-se, ento, na remoo dos resduos celulares e precipitao das protenas por centrifugao. A desnaturao das protenas obtida atravs de um tratamento com fenol ou clorofrmio, e so separadas aps centrifugao, permanecendo na interface entre a fase aquosa (superior), contendo as cidos nucleicos, e a fase orgnica (inferior). De seguida, tendo em conta a insolubilidade do DNA em etanol, recorre-se a este princpio para o fazer precipitar e em soluo vo ficar resduos de fenol/clorofrmio e solutos orgnicos, sendo recuperados os cidos nucleicos. Para a determinao da concentrao do DNA recorremos ao mtodo espectrofotomtrico, que se baseia na absoro de radiao UV por parte dos cidos nucleicos, sendo a quantidade destes directamente proporcional concentrao de DNA na amostra, pelo que a leitura a um comprimento de onda de 260 nm permite o clculo da concentrao dos cidos nucleicos na amostra. Para determinarmos o grau de pureza, fizemos ainda a leitura das absorvncias a um comprimento de onda de 280 nm, que sero proporcionais quantidade de protenas e fenol presentes na amostra. A relao entre A260 e A280 fornece uma estimativa do grau de pureza dos cidos nucleicos. Solues puras de DNA e RNA possuem valores de protenas, a relao entre 1,8 e 2,2, respectivamente. Se existe contaminao com fenol ou

ser muito menor, e a preciso nas quantidades de cidos nucleicos ser baixa.

Na segunda parte do trabalho, realizou-se uma electroforese para comparar os danos causados por diferentes tratamentos fsicos ao DNA. Submetemos, ento, a amostra de DNA aos seguintes tratamentos: Vortexao

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 3 de 41

Biologia Molecular

Relatrios das aulas prticas

Provocar variaes extremas de temperatura no meio envolvente (ebulio seguida de banho de gelo)

Pipetagens sucessivas.

Guardamos ainda uma amostra de DNA sem qualquer tratamento para ento pudermos comparar atravs de uma electroforese as diversas amostras e concluir sobre a aco dos tratamentos fsicos no DNA genmico.

R ESULTADOS OBTIDOS
Abs 260nm
0,247

Abs280nm
0,123

Abs 260nm/ Abs280nm


2,01

T ABELA 1. R EGISTO DOS VALORES DE ABSORVNCIA A 260 E A 280 NM E A RESPECTIVA RAZO .

C O NCE NT R A O

DE

DNA

Tendo em conta o factor de diluio, que 140, ento

GRAU

DE

PUREZA

Absorvncia/nm 260 nm

Equivalncia / g.mL 50 dsDNA 37ssDNA 40 ssDNA

-1

T ABELA 2. P ROPORCIONALIDADE ENTRE A QUANTIDADE DE CIDOS NUCLEICOS NA A MOSTRA E A ABSORVNCIA REGISTADA A 260 NM .

Clculos:
[ [ [ ] ] ] Abs260nm 0,247 [dsDNA] g/mL 1729 [ssDNA] g/mL 1279,5 [ssRNA] g/mL 1383,2

T ABELA 3. R EGISTO DOS VALORES O BTIDOS PARA A CONCENTRAO DE CADA TIPO DE CIDO NUCLEICO PR ESENTE NA AMOSTRA
ANALISADA .

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 4 de 41

Biologia Molecular

Relatrios das aulas prticas

R E SU LT A D O S

OB T I D O S N A E LE CT R OF OR E SE

F IGURA 1. G EL DE AGAROSE RESULT ANTE DA SEPARAO DO DNA GENMICO POR ELECTROFORESE DE CADA UM A DAS AMOSTRAS
SUJEITAS A UM TRATAM ENTO FSICO DIFERENTE .

LEGENDA (DO LADO DIREITO PARA O ESQUERDO) 1. 2. 3. 4. 5. 6. Marcadores de peso molecular (fago ) DNA plasmdico isolado (trabalho prtico 2) DNA sem tratamento (controlo) DNA sujeito a ebulio e de seguida sujeito a arrefecimento no gelo DNA sujeito a vortexao DNA sujeito a mltiplas passagens atravs da ponta de uma pipeta Distncia migrada/cm 2,40 2,70 3,05 3,30 3,65 4,10 4,45 4,90 5,65 6,60 7,10 7,75 8,60 9,65 Peso molecular/pb 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 600 400 200

T ABELA 4. D ISTNCIA MIGRADA PAR A CADA MARCADOR DE P ESO MOLECULAR NO GEL DE AGAROSE E RESPECTIVO PESO MOLECULAR EM
PB .

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 5 de 41

Biologia Molecular

Relatrios das aulas prticas

4,50 4,00 3,50 3,00 2,50 2,00 1,50 1,00 0,50 0,00 0 2 4 6 8 10 12 14 16 y = -0,1208x + 4,1862 R = 0,9803

log(MM)

distncia migrada pelos padres de massa molecular/ cm


F IGURA 2. R EPRESENTAO GRFICA DA DISTNCIA MIGRADA PELOS PADR ES DE PESO MOLECULAR EM FUNO DO PESO MOLECUL AR
CORRESPONDENTE , EM BP

Tratamento Sem tratamento (controlo) Ebulio e posterior arrefecimento em gelo Vortexao Mltiplas passagens atravs da ponta de uma pipeta

Distncia migrada/cm 1,95 --2,00 1,95

Peso molecular/pb 8926 --8802 8926

T ABELA 5. D ISTNCIA DE MIGRAO PARA AS AMOSTRAS SUJEITAS AOS DIFERENTES TRATAMENTOS FSICOS E RESPECTIVO PESO
MOLECULAR EM PB .

D ISCUSSO DOS RESULTA DOS E CONCLUSO


Pela razo , foi-nos possvel concluir que o DNA genmico isolado da Drosophila melanogaster se encontrava relativamente puro, estando pouco contaminado com fenol e outras protenas com cadeias laterais aromticas, pois obtivemos um valor para o grau de pureza de 2,01, que est entre 1,8 e 2,2. Como j foi dito, a razo entre as absorvncias permite-nos quantificar o grau de pureza do DNA, sendo que a uma absorvncia de 260 nm se quantificam as protenas com cadeias laterais aromticas e fenis e a 280nm se quantificam os cidos nucleicos. Por espectrofotometria a 260nm determinou-se a concentrao de DNA genmico (dsDNA), presente na amostra, obtendo-se um valor de 1729 g/mL. Este valor no corresponde ao valor real da concen trao de DNA genmico, pois apesar de termos visto que o grau de pureza se encontrava dentro do esperado, existem ainda outros compostos nucleicos presentes na amostra (por exemplo RNA) e que interferem, pois absorvem a um mesmo comprimento de onda que o DNA. Por isso, para termos uma estimativa mais correta da quantidade de dsDNA na amostra, do que aquela obtida pelo mtodo espectrofotomtrico, podemos recorrer a uma electroforese em gel de agarose,

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 6 de 41

Biologia Molecular

Relatrios das aulas prticas

que consiste na separao pelo tamanho dos vrios componentes que podem existir na amostra. Para a visualizao do DNA aps a corrida no gel, utiliza-se um corante especfico do DNA (brometo de etdeo) que tem a capacidade de se intercalar entre os pares de bases. Sob radiao ultravioleta, o brometo de etdeo emite fluorescncia, surgindo corado apenas o DNA. A quantidade de dsDNA existente numa amostra proporcional quantidade de fluorescncia emitida por essa amostra. Pelos resultados obtidos na electroforese efectuada podemos verificar que o DNA genmico no se encontrava totalmente puro, pois para alm da banda correspondente a este, foram observadas mais duas bandas a pesos moleculares menores, que podem ento corresponder a uma contaminao por RNA. Podemos ento concluir que o mtodo espectrofotomtrico no muito fivel para este tipo de determinaes. Por fim, analisando as amostras do DNA que foram submetidas a diferentes tratamentos fsicos, pde-se verificar pela electroforese em gel de agarose, que apenas a amostra que foi exposta ao tratamento de ebulio e posterior arrefecimento em gelo levou alterao da integridade do DNA, pois a banda correspondente ao DNA genmico desapareceu, o que significa provavelmente que o DNA foi desnaturado. Os restantes tratamentos fsicos no levaram a qualquer alterao na integridade do DNA pois como podemos observar pelos resultados da electroforese nenhuma banda desapareceu nem houve alterao na intensidade das bandas, pelo que o DNA se manteve estvel.

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 7 de 41

Biologia Molecular

Relatrios das aulas prticas

E XTRACO DO DNA PLASMDICO DE E SCHERICHIA COLI


RELATRIO DA AULA PRTICA N2
Data de realizao: 22 de Maro de 2013

I NTRODUO
Muitas bactrias possuem para alm do seu DNA genmico grandes quantidades de pequenas molculas de DNA, os plasmdeos. Estes so molculas circulares de DNA em cadeia dupla capazes de se reproduzirem independentemente do DNA cromossmico, ou seja, replicam-se de forma autnoma. Os plasmdeos so muito frequentes na natureza e podem conter genes que desempenham um papel importante na adaptao e evoluo bacteriana, constituindo uma vantagem selectiva, dado que podem conferir-lhes resistncia a antibiticos, a metais pesados, entre muitos outros factores. Apesar de a replicao ser independente da replicao do cromossoma bacteriano, depende de enzimas e protenas que so codificadas pelo hospedeiro para a sua replicao. Hoje em dia, estes plasmdeos j tm vrias aplicaes ao nvel de inmeras reas. A estes plasmdeos podem ser feitas alteraes para melhorar a sua qualidade e para obter o que se quer especificamente (por exemplo alter-los de forma a se obter um maior nmero de cpias e serem mais pequenos em tamanho), assim sendo j se criaram os chamados vectores plasmdicos de clonagem e de expresso. Neste trabalho tnhamos como objectivo a preparao do plasmdeo pSK-polo de E. coli. Para realizarmos a extraco do DNA plasmdico, foi necessrio separar este da grande quantidade de DNA cromossmico existente nas clulas bacterianas. Esta separao relativamente simples devido sua dimenso e devido a conformaes especficas que este pode assumir, entre elas a denominada cccDNA (covalently-closed-circular DNA), sendo que assim o DNA plasmdico pode ser facilmente separado do DNA cromossmico. Para a extraco do DNA plasmdico, pode-se recorrer lise bacteriana, sendo que a maioria do DNA cromossmico fica sedimentado com os resduos celulares ficando o DNA plasmdico em soluo. Uma alternativa a desnaturao do DNA cromossmico a pH bsico ou por uma fervura rpida. Sendo assim, aps o arrefecimento a desnaturao do cccDNA facilmente revertida ao contrrio do DNA cromossmico, permitindo ento uma fcil separao. Para uma purificao completa ainda necessrio retirar as protenas da soluo. No actual trabalho foi utilizado o procedimento da mini-preparao de DNA plasmdico por fervura rpida (miniprep), com posterior averiguao do estado da amostra purificada por electroforese em gel de agarose 1%.

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 8 de 41

Biologia Molecular

Relatrios das aulas prticas

R ESULTADOS EXPERIMENTAIS

I MAGEM 1. G EL DE AGAROSE RESULT ANTE DA SEPARAO POR ELECTROFORESE DE DNA PLASMDICO ISOLADO .

LEGENDA (DA DIREITA PARA A ESQUERDA): 1. 2. 3. Marcadores de peso molecular (fago ) DNA plasmdico isolado DNA genmico

As restantes amostram fazem parte do trabalho 1. Distncia migrada/cm 2,40 2,70 3,05 3,30 3,65 4,10 4,45 4,90 5,65 6,60 7,10 7,75 8,60 9,65 Peso molecular/pb 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 600 400 200

T ABELA 1. D ISTNCIA MIGRADA PAR A CADA MARCADOR DE P ESO MOLECULAR NO GEL DE AGAROSE E RESPECTIVO PESO MOLECULAR EM
PB .

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 9 de 41

Biologia Molecular

Relatrios das aulas prticas

Amostra DNA plasmdico isolado

Distncia migrada / cm 1,85 3,30

Pesos moleculares / pb 9177 6131

T ABELA 2. D ISTNCIA DE MIGRAO DAS DIVERSAS BANDAS VISUALIZADAS PARA A AMOSTRA DE DNA PLASMDICO ISOLADO E
RESPECTIVOS PESOS MOLECULARES EM PB .

Os valores dos pesos moleculares para o DNA plasmdico foram obtidos pela mesma recta de calibrao usada para o trabalho 1, pois os padres de peso molecular so os mesmos.

D ISCUSSO DOS RESULTA DOS E CONCLUSO


Pela anlise dos resultados obtidos por electroforese em gel, para o DNA plasmdico que isolamos verificamos a existncia de apenas 2 bandas (e no muito visveis), o que no era esperado. Sendo assim, podemos concluir que o processo de extraco do DNA plasmdico no ocorreu como estvamos espera, pelo que no foi bem sucedido, provavelmente por alguma pipetagem mal efectuada, ou por outro erro experimental. O que seria de esperar seria a visualizao de 3 bandas bem definidas. A conformao do DNA um dos parmetros importante a ter em conta quando se fala na sua migrao no gel de electroforese. As formas possveis que o DNA plasmdico pode adquirir e que vo afectar a forma como vai migrar no gel so: cccDNA (covalently-closed-circular DNA), de cadeia dupla, circular fechado. Caracteriza-se por ser a forma mais compacta, portanto mais pequena, devido ao superenrolamento, pelo que vai a sua migrao no gel maior, pois passa mais facilmente entre os poros, sendo assim este DNA iria corresponder banda de menor peso molecular. DNA circular com uma quebra numa ligao fosfodister entre nucletidos adjacentes de uma cadeia. Assim o super enrolamento desaparece com a quebra da ligao fosfodister, o que vai levar a que este tipo de DNA seja a forma que migra menos no gel, pois tem maior raio hidrodinmico. Por fim, temos ainda o DNA linear de cadeia dupla (dsDNA). Esta forma do DNA migra menos do que a forma cccDNA, mas mais do que o DNA que tem uma quebra numa ligao fosfodister. O cccDNA migra mais rapidamente do que os fragmentos do mesmo tamanho de dsDNA porque a conformao circular tem menor raio hidrodinmico devido aos super enrolamentos. Pode-se ainda verificar que a amostra do DNA plasmdico se encontrava contaminada, pois observa-se uma banda intensa de menor peso molecular, que pode corresponder a RNA que se encontrava presente. Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013 Pgina 10 de 41

Biologia Molecular

Relatrios das aulas prticas

A NLISE ELECTROFORTICA DE DNA DIGERIDO COM


ENZIMAS DE RESTRIO
RELATRIO DA AULA PRTICA N3
Data de realizao: 29 de Maro de 2013

I NTRODUO
O isolamento de segmentos de DNA de sequncia conhecida com recurso a enzimas de restrio hoje considerado um dos maiores avanos na Biotecnologia e na Gentica, sendo um processo que envolve grande preciso e que garanta resultados semelhantes. As enzimas de restrio so endonucleases que podem ser purificadas a partir de bactrias, e que reconhecem sequncias especficas de DNA, nomeadamente sequncias palindrmicas, e que a cortam as ligaes fosfodister no interior da cadeia dupla de DNA. Deste modo, estas enzimas reconhecem determinadas sequencias nucleotdicas do DNA e fragmentam a molcula sempre que identificam essa sequncia, produzindo extremidades coesivas (sticky ends) nas cadeias seccionadas, que quando contactam com outras resultantes da aco da mesma enzima podem emparelhar por complementaridade. Juntamente com enzimas do tipo DNA ligase, as enzimas de restrio permitem criar molculas de DNA recombinante, que cortam a cadeia dupla de DNA original para a inserir uma poro de DNA exgeno, sendo este um processo que segue o mecanismo esquematizado pela figura 1. As enzimas de restrio podem ter mecanismos de funcionamento diferentes, da surgir a necessidade de as distribuir em 3 tipos de endonucleases - tipos I, II e III. As enzimas do tipo I e III tm aco nuclesica, ou seja, funcionam custa da degradao de ATP e seccionam a cadeia aleatoriamente, nas

proximidades da sequncia de reconhecimento e aco modificadora de metilao. As enzimas de


F IGURA 1. M ECANISMO DE PRODUO DE DNA
RECOMBINANTE COM RECURSO A ENZIMAS DE RESTRIO E

restrio tipo II, pelo contrrio actuam em locais especficos dentro da sequncia de reconhecimento.

DNA LIGASE .

Neste trabalho prtico, o objectivo foi analisar por electroforese o gene recombinante pSK-POLO digerido por duas enzimas de restrio: EcoR1 e HindIII. Estas enzimas cortam a molcula nas Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013 Pgina 11 de 41

Biologia Molecular

Relatrios das aulas prticas

extremidades do gene POLO, inserido no plasmdeo pSK a enzima EcoR1 reconhece a sequncia GAATTC e HindIII reconhece a sequncia AAGCTT. Procedeu-se, ento, anlise do plasmdeo recombinante, primeiro isoladamente, depois digerido com cada uma das enzimas de restrio utilizadas em separado, e, por ltimo, com ambas as enzimas simultaneamente.

R ESULTADOS OBTIDOS

F IGURA 3. B ANDAS DE DNA PLASMDICO OBTIDAS EM ELECTROFORESE EM G EL DE AGAROSE .

LEGENDA DAS PISTAS DE ELECTROFORESE EM GEL Da esquerda para a direita, as pistas de electroforese reveladas correspondem a: 1. 2. 3. Marcador de pesos moleculares () DNA plasmdico (controlo) DNA plasmdico cortado com HindIII 4. 5. DNA plasmdico cortado com EcoRI DNA plasmdico cortado com EcoRI e com HindIII

Nota: Dada a ausncia de resultados obtidos pelo grupo, Adoptamos os resultados obtidos pelo grupo 4 da turma 3. Foram utilizados os mesmos marcadores de peso molecular dos trabalhos anteriores, pelo que o peso molecular correspondente a cada banda de DNA pode ser determinado a partir da mesma recta de calibrao associada. Assim: Amostra DNA plasmdico + HindIII DNA plasmdico + EcoRI DNA plasmdico + EcoRI + HindIII Distncia migrada / cm 0,75 1,25 2,90 1,90 2,75 Pesos moleculares / pb 12462 10844 6852 9050 7144

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 12 de 41

Biologia Molecular

Relatrios das aulas prticas

T ABELA 1. D ISTNCIA DE MIGRAO DAS DIVERSAS BANDAS VISUALIZADAS PARA A AMOSTRA DE DNA PLASMDICO ISOLADO E
RESPECTIVOS PESOS MOLECULARES EM PB

D ISCUSSO DOS RESULTA DOS E CONCLUSO


Neste trabalho prtico, recorde-se, o objectivo foi analisar por electroforese o gene recombinante pSKPOLO digerido por duas enzimas de restrio (EcoRI e HindIII), que cortam a molcula nas extremidades do gene POLO, inserido no plasmdeo pSK. Dado que estamos na presena de cadeias de DNA circular, o corte do DNA apenas num local de restrio (no caso deste trabalho prtico, isto acontece com a enzima HindIII) gerar uma nica molcula linear logo, uma nica banda no gel de electroforese. Pelo contrrio, o corte com ambas as enzimas de restrio, neste caso do plasmdeo recombinante pSK-POLO com EcoRI e HindIII, gerar dois fragmentos de DNA. Assim, prev-se a visualizao de duas bandas no gel de electroforese para a anlise do DNA digerido com ambas as enzimas, a pesos moleculares diferentes. O mesmo sucede com a enzima EcoRI, que corta o DNA plasmdico analisado em dois locais distintos geram-se, portanto, dois fragmentos distintos. Assim, analisando os resultados obtidos no presente trabalho prtico, verifica-se que os resultados obtidos correspondem ao expectvel: A observao de trs bandas na pista correspondente ao DNA plasmdico de controlo, apesar de estarmos perante o plasmdeo sem qualquer enzima de restrio (serve tambm, portanto, de pista de controlo), deve-se s diferentes conformaes que o DNA pode adoptar: circular naturalmente relaxado, linear de cadeia dupla relaxado e superenrolado (supercoiled). Dado que a enzima HindIII apenas corta o plasmdeo num nico local de restrio, o corte com esta endonuclease apenas transforma o plasmdeo recombinante, anteriormente circular, numa molcula linear. Deste modo, observa-se apenas numa banda no gel de electroforese. A enzima EcoRI fragmenta o plasmdeo recombinante em dois locais de restrio, pelo que, tratando-se de uma molcula circular, se observam duas bandas. Finalmente, a digesto do DNA plasmdico com ambas as endonucleases resulta em duas bandas visveis no gel de electroforese, dados os cortes anteriormente descritos efectuados por cada enzima utilizada. Atravs da anlise electrofortica, possvel determinar, atravs da recta de calibrao dos marcadores de peso molecular como descrito anteriormente, o peso molecular do vector, do gene inserido e, consequentemente, do plasmdeo recombinante no seu todo, e elaborar ainda o mapa de restrio do plasmdeo analisado (processo descrito no relatrio da aula prtica 4). No entanto, os resultados obtidos no gel de electroforese, por conterem bandas muito pouco visveis, no permitiram a determinao desses valores.

B I B LI OG R A FI A

Moreira, C. (2012), WikiCincias, 3(01):0423

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 1 de 41

Biologia Molecular

Relatrios das aulas prticas

E LABORAO DE UM MAPA DE RESTRIO DE UM


PLASMDEO RECOMBINANTE
RELATRIO DA AULA PRTICA N 4
Data de realizao: 05 de Abril de 2013

I NTRODUO
As tcnicas de DNA recombinante tm grande impacto nas cincias da sade e da vida, pois a sua descoberta constitui o primeiro passo na direco da produo de vacinas, medicamentos e tcnicas de diagnstico, entre outros grandes avanos nestes domnios da Biologia, e ainda na engenharia qumica e agronmica. Em Biologia Molecular, clonagem significa a utilizao de vectores (nesta aula prtica, utilizaram-se os mais simples os plasmdeos), onde, num local especfico, se insere um fragmento de DNA de interesse com recurso a enzimas de restrio que cortem especificamente o DNA plasmdico no local de insero pretendido. Desta forma, criam-se molculas de DNA recombinantes, que facilitam o estudo de um fragmento de DNA exgeno de interesse atravs de tcnicas como o PCR ( polymerase chain reaction), transformao bacteriana, entre outras tcnicas de DNA recombinante. Os plasmdeos so molculas de DNA circular presentes em bactrias caracterizam, por exemplo, a resistncia a antibiticos que por vezes desenvolvem. Dado que so os vectores de clonagem mais simples e de fcil obteno, logo, mais facilmente manipulveis, tornaram-se largamente utilizados neste tipo de tcnicas laboratoriais. No entanto, os plasmdeos possuem naturalmente vrios locais de restrio, pelo que, de modo a facilitar a insero de DNA exgeno, foram manipulados de modo a que todos esses locais se localizassem consecutivamente na sequncia de DNA plasmdico essa regio designada como polylinker ou multiple cloning site. De modo a conhecer todos os locais de corte por endonucleases existentes num dado fragmento de DNA seja plasmdico, exgeno ou recombinante elaborado um mapa de restrio, o que constitui uma das etapas iniciais de anlise de DNA. Um mapa de restrio consiste na compilao de todos esses locais de corte, reunindo o nmero, ordem e distncia entre cada um. Estes dados podem ser determinados por electroforese em gel de agarose, dado que, por possurem tamanhos diferentes, os fragmentos resultantes da digesto do DNA por endonucleases iro produzir diferentes distncias de migrao no gel de agarose, pelo que o seu tamanho, distncia entre fragmentos e ordem na sequncia (torna possvel ainda verificar a orientao da sequncia sense ou antisense) pode ser determinado por comparao com um padro de pesos moleculares.

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 2 de 41

Biologia Molecular

Relatrios das aulas prticas

ainda importante destacar que a elaborao de mapas de restrio permitiu grandes avanos na caracterizao de DNA, mapeamento gentico e ainda o desenvolvimento de tcnicas de diagnstico de doenas genticas. Esta aula prtica tem, portanto, como objectivo a elaborao do mapa de restrio de um plasmdeo recombinante, que consiste num fragmento inserido no plasmdeo pGEM-3, de 2867 pb, atravs da anlise do peso molecular dos fragmentos obtidos aps digesto de cada plasmdeo recombinante com as enzimas de restrio Sa1I, HindIII, PstI, XhoI, SacI e BamH1, e posterior anlise por electroforese em gel de agarose, como esquematizado na figura abaixo representada.

F IGURA 1. P ROCESSO DE ELABORAO DE UM MAPA DE REST RIO .

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 3 de 41

Biologia Molecular

Relatrios das aulas prticas

R ESULTADOS EXPERIMENT AIS


P LA SM D E O
D O FR A G M E N T O

L
Peso molecular/pb 23130 9416 6557 4361 2322 2027 564

Distancia migrada/cm 2,50 3,00 3,40 3,90 4,80 5,00 7,00

F IGURA 3. D ISTNCIAS MIGRADAS E RESPECTIVOS PESOS MOLECULARES ( MARCADOR DE PESOS MOLECULARES , ).

4,5 4,3 4,1 3,9 log PM 3,7 3,5 3,3 3,1 2,9 2,7 2,5 2 2,5 3 3,5 4 4,5 5 5,5 6 Distancia migrada (cm)
F IGURA 4. R EPRESENTAO GRFICA DE LOG ( PESOS MOLECULARES ) = F ( DISTNCIA MIGRADA ), E RESPECTIVA RECTA DE CALIBRAO
PADRO DOS PESOS MOLECULARES .

log PM = -0,4084d + 5,0176 R = 0,9657

As distncias migradas por cada banda electrofortica no gel, para cada enzima utilizada, foi calculada, portanto, com base na recta de calibrao obtida. Fig.4.3: Registo dos valores das distncias migradas, em cm, e dos respectivos pesos moleculares, em pb, das diferentes bandas visveis no gel referente ao plasmdeo L. Distncia migrada/cm 2 Peso molecular/bp BamHI 3523 Sal1 4058 3693 Total

3,60 3,45 3,55

3523

7751 Pgina 4 de 41

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Biologia Molecular

Relatrios das aulas prticas

3,25 3,95 3,15 4,10 2,95 4,35 3,5 5,65 2,75 3,4 4,15 4,35

HindIII 4900 2533 PstI 5384 2199 XohI 6501 1738 PvuII 3871 510 SacI 7849 XohI/SacI 4254 2098 1738
r

7433

7583

8238

4382

7849

8089

A banda a cerca de 4000 bp na pista Sal1 corresponde ao gene Amp Plasmdeo vazio Plasmdeo recombinante Gene 3523 7500 7500 3500 = 4000
D O M A P A D E R E ST R I O

E LA B OR A O

O processo de elaborao de um mapa de restrio envolve a digesto do DNA com enzimas de restrio e a anlise dos fragmentos de DNA resultantes atravs de electroforese em gel de agarose. A distncia entre os locais de restrio pode assim ser determinada por comparao do peso molecular, em bp, dos fragmentos obtidos. Neste trabalho prtico, elaborado o mapa de restrio do plasmdeo recombinante pGEM-3, de 2867 pb, onde foi inserido um fragmento Amp , digerido pelas enzimas de restrio SaI1, HindIII, PstI, XhoI, SacI e BamHI. So j conhecidos os locais de restrio para cada enzima no plasmdeo:
r

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 5 de 41

Biologia Molecular

Relatrios das aulas prticas

A partir desta informao e aps anlise dos resultados obtidos em electroforese, possvel determinar os locais de restrio do fragmento inserido. O tamanho do plasmdeo mais correcta e facilmente determinado com o DNA na sua conformao linear. Assim, o peso molecular da banda da pista 2, resultante do corte com a enzima de restrio BamHI, corresponde ao tamanho do plasmdeo recombinante total. Deste modo, conclui-se que o plasmdeo pGEM-3 tem 6000 bp. Na pista do gel de electroforese relativo digesto do plasmdeo recombinante com a enzima de restrio SalI, verifica-se o aparecimento de uma banda que resulta da sobreposio de duas bandas, o que nos indica que o plasmdeo e o fragmento tm pesos moleculares bastante prximos. Ento, o fragmento inserido no plasmdeo tem um peso molecular de 3818 pb. Caso o local de corte para insero do gene corresponda ao local de corte da SalI, ser normal que se obtenham 2 bandas, pois, com a insero do gene, passam a haver dois locais de corte para ambas as extremidades do gene inserido. Para a digesto com a enzima de restrio HIndIII, so observveis duas bandas no gel de electroforese que correspondem a um fragmento menor (2372 pb) e a um fragmento maior (4782 pb). Como esta enzima corta o pGEM-3 a 18 pb do local Sal I e origina duas bandas, ento ter de possuir um local de corte no fragmento inserido, a 2500 bp de distncia do primeiro local de restrio: A distncia entre os locais de corte da HIndIII e da SalI de 18 pb. O fragmento mais pequeno resultante da digesto com HIndIII tem peso molecular de 232 pb.

Conclui-se, portanto, que o local de restrio da enzima HIndIII ser a 2354 pb (2372 pb 18 pb). Na mesma linha de raciocnio, a enzima PstI tambm apresenta duas bandas (5168 pb e 2200 pb). Sabendo que esta enzima corta o pGEM3 a 2 pb antes do local de insero do fragmento (a 2 pb do local SalI) , originando dois fragmentos, o local de corte da PstI ser a 2198 pb do local onde se encontra a SalI. Foi possvel observar que a enzima SacI origina apenas uma banda no gel e sabe-se que corta o vector 31 pb depois do local SalI. Assim, no ter nenhum corte no fragmento inserido. Conclumos ento que o seu peso molecular correspondente ao tamanho do plasmdeo recombinante (vector+ fragmento) que 7619 pb. A enzima Xho I no corta o vector pGEM-3 (no se conhecem locais de restrio no plasmdeo vazio), pelo que se pode inferir que as duas bandas presentes no gel de electroforese correspondem a dois locais de corte no fragmento inserido, sendo que a distancia que separa estes dois cortes 1094 pb. Para conseguir determinar a sua localizao exacta, necessrio conjugar esta endonucleases com uma que corte, efectivamente, o plasmdeo num local conhecido. Assim, ao conjugar as enzimas de restrio Xho I e Sac I, sabendo a priori que esta ltima corta o plasmdeo recombinante em apenas um local, ocorre o aparecimento de trs bandas no gel de electroforese, que correspondem a 1094 pb, 2036 pb e Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013 Pgina 6 de 41

Biologia Molecular

Relatrios das aulas prticas

4099 pb. Tendo em conta que a SacI corta o pGEM3 31pb aps o local de insero, um dos locais de corte da XhoI ser a 2005 pb (2036 pb-31 pb) do local onde se encontra a SalI final, ou seja, a 1813 pb (3818 pb-2005 pb) do local da SalI inicial. O outro local de corte da XhoI ser a 719 pb (1813 pb-1094 pb) do local da SalI inicial. Por ltimo, verifica-se que a enzima de restrio Pvu II origina duas bandas no gel de electroforese (7050 pb e 466 pb), e sabe-se que tem um local de corte a 79 pb do local de insero do fragmento. Assim, o local onde a PvuII corta o fragmento inserido ser a pb do local onde se encontra a SalI (3431 pb - (466 pb 79 pb)). Deste modo, o mapa de restrio obtido ser o seguinte: PstI PstI BamHI

SalI

XohI

XohI

HindIII

PvuII

SalI SacI

F IGURA 4. M APA DE RESTRIO DET ERMINADO PARA O PLAS MDEO P G EM -3.

D ISCUSSO DE RESULTADOS E CONCLUSO


A elaborao do mapa de restrio do fragmento foi dificultada por algumas incoerncias no clculo do peso molecular das bandas obtidas em cada digesto, o que se pode dever medio pouco rigorosa das distncias percorridas pelas bandas no gel de electroforese. Tal como apresentado anteriormente, o mapa de restrio do fragmento em estudo foi determinado a partir do mapa de restrio do plasmdeo (vector) sem o gene de interesse inserido. Deste modo, no possvel avaliar concretamente os resultados obtidos, dado que no possumos qualquer informao acerca do gene inserido.

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 7 de 41

Biologia Molecular

Relatrios das aulas prticas

P OLYMERASE C HAIN R EACTION (PCR)


RELATRIO DA AULA PRTICA N5
Data de realizao: 12 de Abril de 2013

I NTRODUO
O objectivo desta aula prtica foi, a partir das sequncias de cDNA fornecidas pelo professor, desenhar os primers destinados amplificao por PCR do gene POLO. Posteriormente, recorrendo ento reaco de PCR a partir de DNA genmico e de cDNA, seria possvel ento concluir acerca da presena de regies com intres na sequncia do gene. A reaco em cadeia da polimerase (PCR) um mtodo de amplificao que permite amplificar um gene de cpia nica em milhes de cpias, a partir de uma pequena quantidade do DNA original (DNA molde), sem que para isso seja necessrio recorrer a um organismo vivo. O processo de amplificao tem em conta a actividade cataltica de uma DNA polimerase e envolve dois primers, que flanqueiam o fragmento de DNA que pretendemos que seja amplificado. Cada ciclo da reaco envolve desnaturao de DNA de cadeia dupla (que se promove atravs do aquecimento), hibridao dos primers s sequncias complementares e extenso destes com a referida DNA polimerase. Assim sendo, neste trabalho prtico usa-se uma enzima que aguenta uma temperatura necessria para que o DNA se desnature (a Taq polimerase) e que, atravs das pequenas sequncias conhecidas nas extremidades, executa duplicaes repetidas, numa variao exponencial da fraco de DNA entre estas sequncias conhecidas. Essas sequncias so usadas para construir os chamados primers. Assim, o trabalho consistiu em colocar em tubos de PCR, DNA genmico, os 4 nucletidos que que compes a cadeia de DNA (dNTPs), a DNA polimerase j referida em cima (Taq polimerase), os primers, a soluo tampo que permite as condies necessrias de pH e salinidade para que a sntese seja possvel e MgCl2 que um cofactor da Taq polimerase. O tubo ento colocado no termociclador, onde submetido primeiramente a uma temperatura de 94C, temperatura essa que suficientemente alta para permitir que se d a desnaturao da cadeia dupla de DNA mas que no desnature a Taq polimerase. Em seguida, diminui-se a temperatura para 50C, o que vai permitir que ocorra a hibridao entre os primers e as respetivas sequncias complementares de DNA genmico (se a temperatura baixasse para alm dos 50C os primers iriam ligar-se inespecificamente). Por fim, a temperatura aumentada para 72C, temperatura esta que a temperatura ptima para que a Taq polimerase actue, dirigindo a sntese de novas cadeias de DNA. Repetindo estes trs passos (desnaturao, hibridao e extenso) durante vrios ciclos, vai permitir a

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 8 de 41

Biologia Molecular

Relatrios das aulas prticas

produo de milhes de cpias de uma sequncia especfica de DNA em cadeia dupla, sendo que esta produo se d de forma exponencial. Um parmetro extremamente importante a escolha correta dos primers a utilizar, pois estes vo ditar o sucesso ou o insucesso do processo de amplificao. Sendo assim, existem algumas regras que permitem ter uma ideia dos primers corretos a utilizar em cada caso, para permitir uma correta hibridao destes. Essas regras so: A sequncia do primer deve complementar correctamente a sequncia de bases da cadeia molde. A sequncia do primer deve incluir na extremidade 3 um resduo de guanina ou citosina, pois a ligao tripla G-C que se forma ajuda a uma correta hibridao na terminao 3, devido forte interaco entre esses dois pares de bases que se deve formao de pontes de hidrognio. No entanto deve-se ter em conta que no podem estar presentes mais de 3 C ou G seguidos nessa terminao. Os primers devem ser desenhados sem qualquer homologia entre eles, para que no haja possibilidade de emparelhamento entra ambos. A autocomplementaridade entre as sequncias no aconselhvel, pois pode levar formao de estruturas secundrias no primer. Sendo assim, como se pode verificar, a composio do primer muito importante. De um modo geral, estes devero ser constitudos por um nmero de nucletidos que se encontre no intervalo de 17 a 25, e devem ter um contedo em G/C que se encontre entre 45% e 55%. ainda importante que os primers possuam temperaturas de hibridao semelhantes.

R ESULTADOS EXPERIMENT AIS


D E SE N HO
DOS PRIMERS

Para o primer sense consideramos a seguinte sequncia: 5 AGCTATGCTATGCTATGCTAGCCAGTCAGCTGAACGTG 3 Sendo assim, para o primer 1 escolhemos a sequncia que se encontra colorida. Para o primer antisense consideramos a sequncia sense fornecida no protocolo, fazendo a sequncia antisense correspondente para obter o segundo primer: 5 TCTAATTCCAAGCCAATTGCCAAAAAGGAACCG 3 sense 3 AGATTAAGGTTCGGTTAACGGTTTTTCCTTGGC 5 antisense Agora, convm verificar se obedecemos s regras acima descritas: Tendo em conta o primer sense, este tem 17 nucletidos possuindo uma % em G/C de 47,06%, e a sua temperatura de hibridao pode ser calculada a partir de:

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 9 de 41

Biologia Molecular

Relatrios das aulas prticas

Tm = (n G+C 4C) + (n A+T 2C) = (8 4) + (9 2) = 50C No existe autocomplementaridade entre sequncias contguas. Comea e termina numa citosina. Nenhuma das extremidades tem mais de 3 C ou G. Tendo em conta o primer antisense, este tem igualmente 17 nucletidos, possuindo uma % em G/C de 47,06 % e uma Tm = (8 4) + (9 2) = 50C, e no existe complementaridade suficiente entre a sequncia para formar estruturas secundrias. Pelo que podemos observar, ambos os primers obedecem s regras anteriormente referidas, pois apresentam temperaturas de melting semelhantes (neste caso at coincidentes), tm uma percentagem em G/C entre os 45 e 55% e no apresentam complementaridade suficiente para ocorrer emparelhamento dentro da prpria sequncia, sendo assim podamos usar estes dois primers para a amplificao por PCR do gene POLO. Comparando agora as sequncias dos dois primers (sense e antisense): GCTATGCTATGCTATGC CGGTTAACGGTTTTTCC (sense) (antisense)

Como podemos verificar existem poucos pares de bases complementares, sendo que no mximo existem dois pares de bases complementares seguidos.

E LE CT R O F OR E SE

E M G E L D E A G A R O SE

Usamos a electroforese da turma P2 grupo 6, pois a nossa no foi bem-sucedida, sendo que no nos foi possvel visualizar nenhuma das bandas que seriam supostas de ver.

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 10 de 41

Biologia Molecular

Relatrios das aulas prticas

F IGURA 1. R ESULTADOS OBTIDOS ATRAVS DE ELECTROFORESE EM GEL DE AGAROSE 1% COM AMOSTRAS DE DNA GENMICO , DNA
COMPLEMENTAR E O RES PECTIVO PADRO DE PESOS MOLECULARES .

LEGENDA (DA ESQUERDA PARA A DIREITA) 1. 2. 3. Marcador de pesos moleculares cDNA gDNA Pesos moleculares/pb 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 600 400 200 Distncia migrada no gel/cm 2,40 2,70 3,05 3,30 3,65 4,10 4,45 4,90 5,65 6,60 7,10 7,75 8,60 9,65

T ABELA 1. P ESOS MOLECULARES EM PB E RESPECTIVA DISTNCIA MIGRA DA POR CADA BANDA EM CM .

4,50 4,00 3,50 3,00 log(MM) = -0,2188d + 4,435 R = 0,9911

log(MM)

2,50 2,00 1,50 1,00 0,50 0,00 0 2 4 6 8 10 12

Distncia migrada / cm

G RFICO 1. R EPRESENTAO GRFICA DO LOG (MM) EM FUNO DA DISTNCIA MIGRADA PELOS PESOS MOLECULARES EM CM .

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 11 de 41

Biologia Molecular

Relatrios das aulas prticas

Assim, pela recta de calibrao obtida, possvel calcular o peso molecular do DNA genmico e do DNA complementar, sabendo as distncias migradas por estes no gel de electroforese. cDNA Log (MM) = -0,2188 6,65 + 4,435 = 2,98 MM = 10 gDNA Log (MM) = -0,2188 6,35 + 4,435 = 3,05 MM = 10
3,05 2,98

= 955 pb

= 1122 pb Amostra gDNA cDNA Distncia migrada/cm 6,35 6,65 Peso molecular/ pb 1122 955

T ABELA 2. D ISTNCIAS MIGRADAS EM CM PELO DNA GENMICO E PELO DNA COMPLEMENTAR E RESPECTIVOS PESOS MOLECULA RES
EM PB .

O DNA complementar no tem intres, o que facilita a identificao e a caracterizao dos genes. Apenas representa os genes que esto a ser activamente utilizados pela clula, pois a RNA polimerase apenas transcreve genes activados. O DNA genmico contm todo a informao gentica armazenada num organismo. O DNA complementar j no apresenta intres no seu contedo, pois o RNA mensageiro j passou pelo processo de splicing, sendo esta uma reaco catalisada pela enzima transcriptase reversa. Assim sendo, podemos concluir acerca do contedo de intres no DNA genmico fazendo a diferena de pares de bases entre o DNA genmico e o complementar.

D ISCUSSO DE RESULTADOS E CONCLUSO


Na primeira parte do trabalho prtico era-nos pedido o desenho dos primers para a amplificao do gene POLO a partir de primers sense fornecidos no protocolo. Tendo em conta as regras que tm de ser obedecidas para a escolha dos primers, chegamos concluso e como j explicamos nos resultados que os primers escolhidos poderiam ser: GCTATGCTATGCTATGC CGGTTAACGGTTTTTCC (sense) (antisense)

A partir da electroforese efectuada podemos ver que o DNA complementar contm um menor nmero de pares de bases na sua constituio, o que nos indica que de facto h uma diferena entre este e o DNA genmico. Pois como sabemos o cDNA j no possui intres, apenas as regies codificantes, pois j Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013 Pgina 12 de 41

Biologia Molecular

Relatrios das aulas prticas

sofreu o processo de splicing. Ao contrrio, o DNA genmico tem na sua constituio toda a informao gentica de um indivduo, ou seja, intres, exes e regies controladoras de expresso de genes. Assim, obtivemos valores esperados de pares de bases para o cDNA e para o gDNA, sendo o primeiro constitudo por 955pb e o segundo tem um nmero de pb maior de 1122, o que j seria de esperar, como referimos em cima.

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 13 de 41

Biologia Molecular

Relatrios das aulas prticas

T RANSFORMAO DE E SCHERICHIA C OLI COM DNA


PLASMDICO
RELATRIO DA AULA PRTICA N6
Data de realizao: 19 de Abril de 2013

I NTRODUO
A transformao o mecanismo pelo qual as bactrias absorvem o DNA externo, que pode ou no ser integrado no seu genoma. Assim sendo, a transformao de bactrias com plasmdeos recombinantes tornou-se uma tcnica bastante usada para a amplificao de fragmentos de DNA especficos. As bactrias capazes de incorporar DNA denominam-se clulas competentes, e para isso acontecer pode recorre-se a variadas tcnicas, como por exemplo, deixar as clulas em crescimento, retirando-as na fase de crescimento exponencial, trata-las com uma soluo de CaCl2 a baixas temperaturas seguidamente de um choque trmico. Os ies de metal e as mudanas bruscas de temperatura alteram a permeabilidade da parede celular, fazendo com que estas clulas permitam a entrada de DNA exgeno atravs da membrana plasmtica. Assim molculas de plasmdeos recombinantes contendo DNA exgeno podem ser introduzidas na bactria, onde se replicam normalmente. A eficincia da transformao calculada em funo do nmero de transformantes por micrograma de DNA. O tratamento utilizado neste trabalho prtico foi ento o cultivo das clulas at meio da fase exponencial, seguido da lavagem com uma soluo de cloreto de clcio. O DNA foi posteriormente adicionado suspenso e as clulas foram sujeitas a um choque trmico (ou seja so expostas a gelo e depois a uma temperatura de 42C). Aps uma breve incubao num meio no selectivo (em que neste perodo so expressos os genes do plasmdeo, incluindo os genes de resistncia a antibiticos, assegurando que as bactrias sintetizem protenas suficientes quando posteriormente foram transferidas para um meio com antibitico), as clulas so espalhadas em placas com um meio selectivo. Por exemplo, quando temos bactrias resistentes ampicilina no meio selectivo, o gene plasmdico que confere resistncia codifica a enzima -lactamase, que responsvel pela degradao do antibitico. Neste trabalho usamos a plasmdeos diferentes: pEMBL9 e pBR322. a) O plasmdeo pBR322 representado na figura ao lado, contm uma regio de replicao, o gene amp , que codifica a protena de resistncia a ampicilina e o gene tet , que codifica a protena de resistncia tetraciclina. A partir deste plasmdeo originou-se um outro modificado, o pBR322-CAT, ao qual foi inserido o gene CAT no local do gene que codifica a resistncia tetraciclina (pelo que assim h inactivao da resistncia tetraciclina). O gene CAT codifica a enzina cloranfenicol acetil transferase. Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013 Pgina 14 de 41
R R

Biologia Molecular

Relatrios das aulas prticas

O segundo plasmdeo usado foi o pEMBL9, em que a insero dos fragmentos de DNA se d num polylinker (que uma sequncia de DNA curta que contm vrios locais de reconhecimento de enzimas de restrio estando contida nos vectores de clonagem) localizado na extremidade 5 que codifica a enzima -galactosidase, que quando expostas lactose a degradam (sendo esta o indutor natural da expresso da enzima). Assim sendo, o plasmdeo contm tambm os elementos do promotor que so necessrios expresso da enzima -galactosidase. Este plasmdeo foi tambm modificado de forma a obtermos um outro, o pEMBL9-CAT. O gene CAT foi inserido nos locais BamHI e HInd III do polylinker. Isto permite observar a expresso do gene CAT em resposta presena de lactose no meio, sendo que as bactrias portadoras deste gene so resistentes ao cloranfenicol quando crescidas num meio com lactose.

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 15 de 41

Biologia Molecular

Relatrios das aulas prticas

Os meios de cultura usados foram os seguintes: Mac/Lac/Amp, LA/Amp e LA/Amp/Tet. Um dos meios usados foi o MasConkey agar que contm um indicador de pH (neutral red) e lactose. Assim, se por exemplo as bactrias de uma determinada colnia metabolizam a lactose, h produo de substncias acdicas que vo alterar o pH do meio, havendo a produo de colnias vermelhas. Se a colnia de bactrias no possuir actividade -galactosidase, ento as colnias tero uma cor branca/amarela. O objectivo deste trabalho laboratorial foi ento calcular a eficincia de transformao (atravs do nmero de colnias crescidas em cada placa) para cada plasmdeo usado, observando as diferenas obtidas em cada meio de cultura e tirar concluses acerca disso. A partir dos resultados obtidos tnhamos tambm como objectivo verificar se houve ou no expresso do gene CAT no meio com lactose.

R ESULTADOS OBTIDOS
Plasmdeo Meio de cultura Mac+Lac+Amp LA+Amp Mac+Lac+Amp LA+Amp LA+Amp+Tet N de colnias 61 524 105 1 2 Cor Vermelhas Brancas/amarelas Brancas/amarelas Brancas/amarelas Brancas/amarelas Eficincia de transformao 1,22 10
4 5

pLEMB9 pLEMB9CAT pBR322

1,048 10 2,110 2 10 4 10
4

2 2

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 16 de 41

Biologia Molecular

Relatrios das aulas prticas


3

LA+Amp pBR322CAT Controlo LA+Amp+Tet LA+Amp LA+Amp

15 0 6 0

Brancas/amarelas ---Brancas/amarelas ----

3 10 ----

1,2 10 ---

T ABELA 1. R EGISTO DOS DADOS OBTIDOS NA TRANSFORMAO DE E. C OLI NA PRESENA DOS DIFE RENTES PLASMDEOS ( P LEMB9,
P LEMB9-CAT, P BR322 E P BR322-CAT), OU SEJA REGISTO DO NMERO DE COLNIAS OBSERVADAS E DA COR DESTAS , E AINDA O CLCULO DA EFICINCI A DE TRANSFORMAO .

A eficincia de transformao calculada pela seguinte expresso: E.T (eficincia de transformao) = Deve ser tido em conta o factor de diluio, ou seja, como cada um dos tubos contendo um plasmdeo diferente tem uma quantidade de DNA de 10ng em 250 mL de volume total no tubo, como cada placa foi plaqueada com 125mL de cada um desses tubos, cada placa vai conter ento 5ng de DNA (ou seja 5 10 g de DNA). Plasmdeo pLEMB9 pLEMB9-CAT pBR322-CAT LA+Amp Mac+Lac+Clo Meio inicial Novo meio Crescimento no sim sim
-3

T ABELA 2. R ESULTADOS OBTIDOS PA RA O CRESCIMENTO DAS COLNIAS NOS DIFERENTES MEIOS , TRANSFERIDAS DE UM M EIO INICIAL (LA+A MP ) PARA UM NOVO MEIO (M AC +L AC +C LO ).

D ISCUSSO DOS RESULTA DOS E CONCLUSO


A eficincia de transformao foi calculada para todos os plasmdeos com excepo para aqueles em que no houve crescimento de colnias, como o caso da placa controlo, que no possui plasmdeo. Neste tipo de transformao em que o mtodo que se usa o do cloreto de clcio so esperadas eficincias de 10 -10 transformantes/g de DNA. Como se pode observar pelos nossos resultados isso no aconteceu, tendo-se obtido eficincias de transformao bastante inferiores. Isto pode dever-se a vrios factores, como por exemplo, uma m preparao das clulas competentes, a colheita das clulas no ter sido efectuada na fase de crescimento exponencial, o contacto das clulas com o cloreto de clcio no ter sido efectuada durante tempo suficiente e ainda os reagentes no serem totalmente puro. Agora analisando os resultados obtidos com cada plasmdeo em diferentes meios de cultura podemos tirar vrias concluses. Usando o plasmdeo pEMBL9, num meio de cultura contendo ampicilina, lactose e o indicador MacConkey, verificou-se o crescimento de colnias de cor vermelha. Assim sendo, podemos concluir Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013 Pgina 17 de 41
6 7

Biologia Molecular

Relatrios das aulas prticas

que estas clulas expressam o gene que codifica a enzima -galactosidase, pois como vimos o indicador neutral red identifica uma mudana no pH junto das colnias proveniente da metabolizao da lactose que origina substncias cidas. Ou seja, como se formaram colnias vermelhas, isso significa que estas possuam a enzima (em que a sue expresso foi induzida pela presena de lactose no meio) que degradou a lactose presente no meio originando colnias de cor vermelha. Para o meio contendo apenas lactose e ampicilina, seria de esperar o crescimento de colnias, tal como se verificou, pois o plasmdeo pEMBL9 tem genes que lhe conferem resistncia ampicilina, a cor das colnias obtidas foi amarelo/branco pois no havia indicador de pH (MacConkey) no meio. Para o plasmdeo modificado, pEMBL9-CAT, as clulas transformadas com este no so capazes de fermentar a lactose, pois no possuem actividade -gal, pelo que a colorao das colnias amarela/branca. Estes no possuem actividade -gal pois as colnias de bactrias tm plasmdeos que contm um fragmento exgeno inserido no polylinker que no vo permitir a degradao da lactose, pois h uma alterao no quadro de leitura o que leva a que no haja a expresso da protena, pelo que a enzima tambm no atua. O pBR322, como j for referido na introduo, apresenta genes que lhe conferem resistncia tanto ampicilina como tetraciclina. Pelo que como era esperado houve crescimento de colnias nos meios com ambos os antibiticos. Para o plasmdeo pBR322-CAT num meio de cultura com tetraciclina no se observou o crescimento de colnias o que tambm era de esperar visto que as clulas que so portadoras do gene CAT, e este inactiva a resistncia tetraciclina, sendo que de facto no se verificou o crescimento de colnias neste caso, pois as clulas com este gene ficam susceptveis ao antibitico. Para as clulas com o plasmdeo pBR322-CAT num meio LA+Amp, sem tetraciclina, o crescimento das colnias ocorreu porque apesar de no terem resistncia tetraciclina, tambm no precisavam de a ter neste caso pois o meio no possui Tet. No controlo no se verificou o crescimento de colnias num meio com LA+Amp, o que era de fato esperado, pois o controlo no possua DNA plasmdico. Para verificar se houve ou no induo da expresso do gene CAT no meio com lactose e testar a resistncia das clulas ao cloranfenicol, transferiram-se 10 colnias de um meio inicial (LA+Amp) para um novo meio (Mac+Lac+Clo). Assim sendo, podemos concluir que os resultados foram de acordo com o esperado. Para o caso das clulas com o plasmdeo pEMBL9 no se verificou crescimento de colnias no novo meio de cultura (Mac/Lac/Clo), isto verifica-se pois este plasmdeo no possui o gene CAT (codifica para a enzima cloranfenicol acetil transferase, conferindo resistncia ao cloranfenicol), pelo que as clulas no so resistentes ao cloranfenicol quando crescidas na presena de lactose e assim no se observa o crescimento.

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 18 de 41

Biologia Molecular

Relatrios das aulas prticas

No caso de clulas contendo o plasmdeo pEMBL9-CAT, h expresso do gene CAT (que confere resistncia ao cloranfenicol) pois este foi inserido entre o opero da lactose e a extremidade 5 do gene que codifica para a -galactosidase. A expresso do gene CAT assim induzida pelo opero da lactose que, por sua vez, induzido pela lactose. Por fim, para o plasmdeo pBR322-CAT, este tem o gene CAT inserido no local do gene que codifica para a resistncia tetraciclina, pelo que se contm o gene CAT, codifica para a enzima cloranfenicol acetil transferase e assim as clulas com este gene so resistentes ao cloranfenicol e da ocorrer o crescimento de colnias no meio com cloranfenicol e lactose.

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 19 de 41

Biologia Molecular

Relatrios das aulas prticas

S EQUENCIAO DE DNA
RELATRIO DA AULA PRTICA N7
Data de realizao: 17 de Maio de 2013

I NTRODUO E O BJECTIVO
O objectivo deste trabalho prtico foi a aplicao da tcnica de sequenciao de Sanger assim como a utilizao do PCR (polymerase chain reaction) para a clonagem do cDNA. Isolou-se uma protena e determinou-se a sequncia dos primeiros 10 aminocidos da regio Nterminal. Assim, com base nesta sequncia, foram desenhados os primers degenerados para a amplificao do correspondente DNA complementar por PCR, a partir de uma biblioteca da cDNA orientada. Os produtos obtidos por PCR foram clonados atravs da utilizao de um plasmdeo (orientao 5 EcoRI 3HindIII). Aps isolamento, procedeu-se sequenciao de 3 clones independentes para verificar qual dos trs codifica para a protena que se pretende clonar. A sequenciao nucleotdica de um gene de grande importncia, pois esta representa a caracterizao da sua estrutura gentica. Um ponto importante a destacar que para a realizao da sequenciao necessrio obter fragmentos definidos de DNA e como a clonagem possibilita a obteno de um grande nmero desses fragmentos, estas duas tcnicas esto altamente interrelacionadas. A sequenciao pode ser realizada por vrias tcnicas, duas delas so as chamadas degradao qumica de Maxam e Gilbert e o mtodo enzimtico de Sanger. Ambos os mtodos geram uma grande quantidade de nucletidos que comeam num ponto especfico e terminam num resduo particular.

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 20 de 41

Biologia Molecular

Relatrios das aulas prticas

F IGURA 2. R EPRESENTAO GERAL DO MTODO DE S ANGER , EM QUE SO USADAS QU ATRO REACES ( ACTUALMEN TE J S SE
REALIZA UMA REACO ).

No mtodo de Sanger para alm dos dNTP so incorporados ddNTP (terminadores) marcados fluorimetricamente, onde na posio 3 da desoxirribose um grupo OH substitudo por um H. Isto leva impossibilidade da formao de uma ligao fosfodister e continuao da reaco de polimerizao que termina cada vez que incorporado um ddNTP marcado.

F IGURA 3.D IFERENA ENTRE OS DI DESOXINUCLOTIDOS QUE VARIAM DOS NUCLETIDOS NORMAIS DEVIDO AUSNCIA DE UM
GRUPO HIDROXILO

(-OH) NO CARBONO 3 DA PENTOSE .

Quatro tipos de populaes de fragmentos podem ser obtidas, ou seja podemos obter populaes que terminam no nucletido A,C,G ou T. Neste mtodo o primer indica a regio de incio do sequenciamento. O primer ou nucletidos podem estar radioactivamente marcados (sequenciamento manual) ou ddNTPs podem estar marcados com molculas fluorescentes (sequenciamento automtico). Basta a realizao de apenas uma reaco de sequenciao, sendo que os produtos desta so corridos em gis existentes no interior de capilares muito finos e visualizados com detectores lasers (mtodo mais recente).

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 21 de 41

Biologia Molecular

Relatrios das aulas prticas

F IGURA 4. E LECTROFORESE USANDO MARCADORES RADIOACTIVOS PARA CADA DIDESOXINUCLOTIDO .

Mtodo de Gilbert (em desuso) baseia-se na marcao radioactiva de um dos extremos do fragmento de DNA e a sua posterior degradao parcial atravs de reaces especficas para as bases do DNA. Assim, medindo a distncia entre o ponto de degradao e a extremidade radioactiva visualizada por autoradiografia possvel determinar a posio de cada base na cadeia de DNA.

T RATAMENTO DE DADOS E R ESULTADOS


a) Determinao da sequncia de cada clone (A,B e C); b) Identificao dos locais de clonagem (EcoRI e HIndIII); c) Identificao do primer degenerado de cada clone utilizado para a reao de PCR;

d) Identificar qual dos clones codifica para a protena que se quer clonar. Sequncia que codifica para a EcoRI Sequncia que codifica para a HindIII Clone A Cadeia no codificante 3ATCGCTTAAGTGGTCCAAGGCTTGTAGCGGTAAGGTCCCTTGAGTAACTCAGATCGGATTGATTGCTGGGTACA GCGGGGCACTTTTCGAAGCGGAT 5 Cadeia complementar (codificante) 5TAG CGA ATT CAC CAG GTT CCG AAC ATC GCC ATT CCA GGG AAC TCA TTG AGT AGC CTA ACT AAC TAA CGA CCC ATG TCG CCC CGT GAA AAGCTTCGCCTA 3 Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013 Pgina 22 de 41 5 GAATTC 3 5 AAGCTT 3

Biologia Molecular

Relatrios das aulas prticas

Primer degenerado 3 GGG TAC AGC GGG GCA 5 5 CCC ATG TCG CCC CGT 3 (PRO-MET-SER-PRO-ARG) Clone B Cadeia no codificante 3ATCGCTTAAGTAATAGGGCTAGATCATTGCGTAGGAGATTGATCGCACTTAATACAGTATAACGGACGGGTACA GGGGCGCACGCTTCGAAGCGGAT 5 Cadeia complementar (codificante) 5TAGCGAATTCATTATCCCGATCTAGTAACGCATCCTCTAACTAGCGTGAATTATG TCA TAT TGC CTG CCC ATG TCC CCG CGT GCG AAGCTTCGCCTA 3 Primer degenerado 3 GGG TAC AGG GGC GCA 5 5CCC ATG TCC CCG CGT 3 (PRO-MET-SER-PRO-ARG) Clone C Cadeia no codificante 3ATCGCTTAAGTTAGCTGGGTCCAGTGTTGGAAGGCCGAGTTCGGATTGGATCAATTCTGGGATACAGAGGGGC TCGATTCGAAGCGGAT 5 Cadeia complementar (codificante) 5TAGCGAATTCAATCGACCCAGGTCACAACCTTCCGGCTCAAGCCTAACCTAGTTAAGACCCATG TCT CCC CGA GCT AAGCTTGCGGAT 3 Primer degenerado 3 GGA TAC AGA GGG GCA 5 5 CCT ATG TCT CCC CGT 3 (PRO-MET-SER-PRO-ARG)

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 23 de 41

Biologia Molecular

Relatrios das aulas prticas

F IGURA 5. T ABELA DO CDIGO GENTICO .

Assim, podemos concluir que o clone B que codifica para a protena que se pretende clonar, pois este que apresenta a sequncia de aminocidos pretendida: N-terminal Ser Tyr Cys Leu Pro Met Ser Pro Arg Ala C terminal Clone B Cadeia no codificante do clone B Cadeia codificante do clone B RNAm RNAt Sequncia de aminocidos na protena Sequncia 3TAC AGT ATA ACG GAC GGG TAC AGG GGC GCA CGC 5 5ATG TCA TAT TGC CTG CCC ATG TCC CCG CGT GCG3 5 UAC AGU AUA ACG GAC GGG UAC AGG GGC GCA CGC3 5 AUG UCA UAU UGC CUG CCC AUG UCC CCC CGU GCG 3 N-terminal Ser Tyr Cys Leu Pro Met Ser Pro Arg Ala C terminal

T ABELA 1. S EQUNCIA NUCLEOTDIC A DA CADEIA NO CODI FICANTE E CODIFICANT E DO CLONE B, DO RNA MENSAGEIRO , RNA
TRANSFERNCIA E RESP ETIVA SEQUNCIA DE AMINOCIDOS DA PROTE NA PRETENDIDA .

D ISCUSSO DE RESULTADOS E C ONCLUSES


Pela anlise das sequncias no codificantes resultantes de cada um dos clones (A,B e C) por PCR, foi possvel obter as respectivas cadeias codificantes de DNA, assim como o primer degenerado utilizado para a reaco de PCR em cada clone. Foi possvel ainda localizar os locais de clonagem EcoRI e HIndIII. Assim, pela anlise realizada no tratamento de dados foi possvel identificar o clone que codifica para a protena de interesse: N-terminal Ser Tyr Cys Leu Pro Met Ser Pro Arg Ala C terminal.

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 24 de 41

Biologia Molecular

Relatrios das aulas prticas

Para identificar o primer degenerado, tivemos que olhar para os trs clones e identificar uma sequncia de aminocidos comum nos trs (para identificar os aminocidos pela tabela do cdigo gentico olhouse para a cadeia codificante). Assim sendo, para o clone A identificamos o primer 3 GGG TAC AGC GGG GCA 5. A sequncia de aminocidos obtida no corresponde sequncia de aminocidos da protena que se pretende clonar, pois este clone codifica para a protena com a seguinte sequncia de aminocidos: Met-Ala-Ile-Pro-Pro-Asn-Ser-Leu-Ser-Ser-Leu-Thr-Asn STOP Para o clone B identificamos o primer com a seguinte sequncia 3 GGG TAC AGG GGC GCA 5. A sequncia de aminocidos que se obteve corresponde sequncia de aminocidos da protena que se pretende clonar: Ser Tyr Cys Leu Pro Met Ser Pro Arg Ala Por fim para o clone C, o primer consiste na seguinte sequncia de nucletidos: 3 GGA TAC AGA GGG GCA 5 . A sequncia de aminocidos obtida diferente da protena de interesse, sendo assim o clone C no codifica para a protena que se quer clonar. Met-Ser-Pro-Arg-Ala Conseguimos portanto, pela aplicao do mtodo de Sanger, encontrar uma sequncia exacta que codifica uma determinada sequncia de aminocidos e por comparao com a sequncia N-terminal da protena isolada neste estudo, conclui-se que o clone B que a codifica.

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 25 de 41

Biologia Molecular

Relatrios das aulas prticas

C LONAGEM DE C DNA -TUB


RELATRIO DA AULA PRTICA N8
Data de realizao: 24 de Maio de 2013

I NTRODUO
As tcnicas de DNA recombinante tm grande impacto nas cincias da sade e da vida, pois a sua descoberta constitui o primeiro passo na direco da produo de vacinas, medicamentos e tcnicas de diagnstico, entre outros grandes avanos nestes domnios da Biologia, e ainda na engenharia qumica e agronmica. Em Biologia Molecular, clonagem significa a utilizao de vectores (nesta aula prtica, utilizaram-se os mais simples os plasmdeos), onde, num local especfico, se insere um fragmento de DNA de interesse (neste trabalho prtico, trata-se do gene TUB) com recurso a enzimas de restrio que cortem

especificamente o DNA plasmdico no local de insero pretendido, para, posteriormente,

criarem-se grandes quantidades de molculas de DNA recombinantes, que facilitam o estudo de um fragmento de DNA exgeno de interesse atravs de tcnicas como o PCR (polymerase chain reaction), transformao bacteriana, entre outras tcnicas de DNA recombinante. Desta forma, e em sntese, aps a obteno do gene de interesse, necessrio inseri-lo num vector (neste caso, o plasmdeo pSK) com recurso DNA ligase e enzimas de restrio (e, eventualmente, de modificao) para criar uma molcula de DNA recombinante. A produo de
F IGURA 1. E SQUEMA REPRESENTATIV O DO PROCEDIMENTO GLOBAL
DE CLONAGEM .

grandes

quantidades

desta

molcula

para

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 26 de 41

Biologia Molecular

Relatrios das aulas prticas

investigao posterior efectuar-se- por insero da molcula num sistema bacteriano (neste trabalho prtico, uma vez mais, foi utilizada a bactria E. coli para este efeito), onde o gene de interesse ser ento replicado e expresso em meio de ampicilina (a presena de um gene de resistncia a este antibitico no vector de expresso Amp permitir assim seleccionar apenas as bactrias resistentes para conter o gene de interesse). A este ltimo procedimento d-se o nome de transformao, que resulta na absoro do DNA pela bactria, que pode ou no ser integrado no seu genoma deste modo, medida que as bactrias se multiplicam, o gene de interesse tambm se replica.
r

F IGURA 2. P ROCEDIMENTO RELATIVO TRANSFORMAO BACTERIANA .

A replicao das clulas bacterianas resultar na criao de colnias transformadas. No entanto, estas podem caracterizar-se por: a) No possurem, de todo, o vector (estas clulas morrem por, ao no incorporarem o plasmdeo, no incorporarem a resistncia ao antibitico presente no meio de cultura) b) Possurem o vector, mas no o gene de interesse. c) Possurem ambos os fragmentos.

Assim, de modo a seleccionar as colnias que, de facto, contm o gene de interesse, necessrio adoptar mais um mecanismo de seleco. Ao utilizar um vector que contenha o gene lacZ, que codifica a -galactosidase (-gal), a enzima que degrada a lactose (includa no meio de cultura) em cido frmico, possvel distinguir as colnias que contm o gene e as que no o contm, dado que adquirem coloraes diferentes, consoante a -gal funcional (-gal ) nessas colnias ou no (-gal ).
+ -

P ROCEDIMENTO ADOPTADO
informao constante no caderno de aulas prticas da unidade curricular, acresce a composio dos tubos Eppendorf usados para transformao das bactrias E. coli: A 5 10 4 1 B 5 10 4 C 10 4 1 4 1 D 5

Vector pSK/L cDNA TUB/L Tampo de ligao/L T4-Ligase/L

T ABELA 4. C OMPOSIO DOS TUBOS USADOS PARA INCUBAO E TRANSFORMAO .

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 27 de 41

Biologia Molecular

Relatrios das aulas prticas

R ESULTADOS EXPERIMENT AIS


Apresentam-se abaixo as colnias obtidas em cada um dos meios preparados:

F IGURA 5. C OLNIAS DESENVOLVIDAS APS TRANSFORMAO E INCUBAO , E LEGENDA DO RESPECTIVO MEIO DE CULTURA .

N ota: fo ra m ado p tado s o s re sul tado s ob tido s pe lo g rupo 6 d a tu rm a P 2. Verificou-se o crescimento de colnias vermelhas e brancas, apesar de estas ltimas se revelarem quase imperceptveis, na placa A, as placas B e C no possuem colnias desenvolvidas e a placa D apenas desenvolveu colnias vermelhas, em quantidade semelhante placa A.

D ISCUSSO DE RESULTADOS E CONCLUSO


A transformao da E. coli por introduo do plasmdeo recombinante pET3a-TUB, seguida de incubao, resultou em colnias de diferentes cores e graus de crescimento, como demonstram os resultados acima apresentados. De facto, os resultados obtidos vo de encontro ao que seria esperado da parte de cada placa, cujas bactrias foram incubadas em diferentes condies: s bactrias da placa A, foi inicialmente adicionado o vector pET3a, o fragmento de DNA de interesse TUB, o tampo de ligao e a T4-DNA ligase todos os componentes necessrios, portanto, a uma transformao com sucesso. No entanto, nem todas as colnias incorporam o fragmento de interesse. Verificam-se ento, tal como esperado, colnias vermelhas e incolores.

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 28 de 41

Biologia Molecular

Relatrios das aulas prticas

A presena de colnias vermelhas indica que no houve incorporao do fragmento TUB, dado que nestas o gene lacZ expressa a -gal (-galactosidase funcional), que degrada a lactose, alterando o pH do meio as colnias sero vermelhas. Pelo contrrio, a presena de colnias brancas indica que as colnias incorporaram, de facto o fragmento de interesse a presena e expresso do gene de interesse causa a expresso por parte do gene lacZ da -gal (-galactosidase no funcional), pelo que o pH permanece inalterado e as colnias sero, portanto, incolores. As placas B e C no apresentam desenvolvimento de colnias, dado que a placa B no contm a enzima T4-DNA ligase, indispensvel na unio das extremidades ( split ends) do vector, nomeadamente ao gene a clonar. Nestas condies, as bactrias no se desenvolvem, visto que, tratando-se de uma bactria, cujo DNA circular, o vector pET3a no adquire essa conformao, pelo que no expressa a resistncia ao antibitico presente no meio de cultura (ampicilina). A ausncia de vector, e, portanto, do gene Amp , levar, portanto, a um efeito semelhante. Na ausncia de fragmento, que ocorre na placa D, como explicitado anteriormente, o gene lacZ expressa a -gal , originando colnias vermelhas. Conclui-se, portanto, que este se trata de um processo simples, que envolve sistemas procariotas de uso comum e que permite reconhecer de forma exacta e imediata, aps incubao, as colnias onde ocorreu incorporao e expresso do gene de interesse, do qual se conseguem obter elevadas quantidades com grande fiabilidade.
+ r +

Licenciatura em Bioqumica FCUP/ICBAS-UP 2012/2013

Pgina 29 de 41