Você está na página 1de 38

Polimorfismos Genticos

na Espcie Humana
Andonai Krauze
NCLEO DE SADE
DEPARTAMENTO DE MEDICINA
1. Polimorfismo de DNA - conceito
Presena de muitas formas.
Ocorrncia de mltiplos alelos num lcus, onde
pelo menos dois alelos aparecem com freqncias
superiores a 1%.
Os alelos de frequncias inferiores a 1% so
considerados RAROS e geralmente causam
doenas genticas.
Um locus dito polimorfo quando nenhum de seus
alelos tem frequncia superior a 99%.
Tipos de
Polimorfismos
Polimorfismos Cromossmicos
Polimorfismos Imunolgicos
Polimorfismos de Protenas
Polimorfismos de Seqncia de DNA
Polimorfismos
Cromossmicos
Vrias espcies so polimrficas quanto ao nmero
e morfologia cromossmica.
Podem ocorrer cromossomos extras, translocaes
recprocas e inverses.
Polimorfismos Imunolgicos
Especificidades antignicas para
os tipos sangneos ABO e para
o sistema HLA (altamente
polimrfico).
Polimorfsmo de Grupos Sanguneos
Sistema ABO:
Landstainer e cols. Descobriram que podem
ser atribudos quatro tipos ao sangue humano
de acordo com a presena de dois antgenos, A
e B, na superfcie das hemcias, e de dois
anticorpos correspondentes, anti-A e Anti-B, no
plasma.
Polimorfismos Sanguneos
Polimorfsmo de Grupos Sanguneos
Sistema ABO:
Landstainer e cols. Descobriram que podem
ser atribudos quatro tipos ao sangue humano
de acordo com a presena de dois antgenos, A
e B, na superfcie das hemcias, e de dois
anticorpos correspondentes, anti-A e Anti-B, no
plasma.
Sistema ABO
Polimorfismo Protico
Alterao no cdon de um gene estrutural pode
modificar a cadeia polipeptdica, resultando no
aparecimento de uma nova variante da protena
especfica.
Polimorfismo Protico (Fentipo)
Utilidade na medicina:
Marcadores de diferentes formas
hereditrias;
Diagnsticos Pr-sintomticos e pr-natal
(doenas genticas);
Deteco de heterozigotos portadores de
doena gentica. Ex.: HEMOGLOBINA
Podem ser detectados por eletroforese;
Consideraes:
Considervel grau de diversidade individual (combinaes
genotpicas);
Constituio qumica gentica singular.
3. Caractersticas dos
polimorfismosde DNA
Ocorrncia simultnea, numa mesma
populao, de duas ou mais formas
alternativas de um gene ou de uma
sequncia de DNA no codificador. A
sua frequncia de pelo menos 1%
Caractersticos de cada indivduo pelo o que
podem servir como marcadores moleculares
Podem representar uma vantagem para a
populao
Polimorfismos de DNA
Quaisquer duas cpias do genoma humano
diferem em 1/100 a 1/500 de todas as posies de
nt.
Podem ser:
Single-Nucleotide Polymormorphism(SNP)
Alteraes em sequncias de DNA repetitivo
consecutivo;
Microssatlite ou Short Tandem Repeats (STRs):
Alteraes em sequncias de DNA repetitivo consecutivo
Minissatlite ou Variable Number of Tandem (VNTRs)
Polimorfismos de DNA
Podem ser:
Alteraes em sequncias de DNA repetitivo
disperso(interspersed)
Short Interspersed Repeat Sequences (SINEs):
Alteraes em sequncias de DNA repetitivo
disperso(interspersed)
Long Interspersed Repeat Sequences (LINEs):
RFLPs (Polimorfismos do Comprimento do Fragmento
de Restrio)
RFLP
Alteraes no DNA que acarretam o aparecimento ou
desaparecimento de stios de Restrio enzimtico.
Os fragmentos de restrio:
So facilmente visualizados em gis aps eletroforese;
So valiosos no diagnstico de doena hereditrias de genes
desconhecidos;
Na identificao de indivduos nas investigaes criminais;
No desvendamento da nossa histria evolutiva
Exemplos de Stios de Restrio de Algumas
Enzimas:
Fingerprinting do DNA
Impresso
digital do DNA
VNTR
TGCACTGATGGTCAGTGAATTCCTCGTATATGCTA
ACGTGACTACCAGTCACTTAAGGAGCATATACGAT
TGCACTGATGGTCAGTGATTTCCTCGTATATGCTA
ACGTGACTACCAGTCACTAAAGGAGCATATACGAT
TGCACTGATGGTCAGTG
ACGTGACTACCAGTCACTTAA
AATTCCTCGTATATGCTA
GGAGCATATACGAT
TGCACTGATGGTCAGTGATTTCCTCGTATATGCTA
ACGTGACTACCAGTCACTAAAGGAGCATATACGAT